Molecular Biology of the Cell click for CBE Life Science Education Page

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E04-04-0273 on January 12, 2005

Vol. 16, Issue 3, 1355-1365, March 2005

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E04-04-0273v1
16/3/1355    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Take-uchi, M.
Right arrow Articles by Katsura, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Take-uchi, M.
Right arrow Articles by Katsura, I.

FLR-4, a Novel Serine/Threonine Protein Kinase, Regulates Defecation Rhythm in Caenorhabditis elegans

Masaya Take-uchi * {dagger} {ddagger}, Yuri Kobayashi *, Koutarou D. Kimura * {dagger}, Takeshi Ishihara * {dagger} §, and Isao Katsura * {dagger}

* Structural Biology Center, National Institute of Genetics, The Graduate University for Advanced Studies, Mishima, Shizuoka-ken 411-8540, Japan; {dagger} Department of Genetics, The Graduate University for Advanced Studies, Mishima, Shizuoka-ken 411-8540, Japan

Submitted April 1, 2004; Revised December 14, 2004; Accepted December 27, 2004
Monitoring Editor: Susan Strome


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The defecation behavior of the nematode Caenorhabditis elegans is controlled by a 45-s ultradian rhythm. An essential component of the clock that regulates the rhythm is the inositol trisphosphate receptor in the intestine, but other components remain to be discovered. Here, we show that the flr-4 gene, whose mutants exhibit very short defecation cycle periods, encodes a novel serine/threonine protein kinase with a carboxyl terminal hydrophobic region. The expression of functional flr-4::GFP was detected in the intestine, part of pharyngeal muscles and a pair of neurons, but expression of flr-4 in the intestine was sufficient for the wild-type phenotype. Furthermore, laser killing of the flr-4–expressing neurons did not change the defecation phenotypes of wild-type and flr-4 mutant animals. Temperature-shift experiments with a temperature-sensitive flr-4 mutant suggested that FLR-4 acts in a cell-functional rather than developmental aspect in the regulation of defecation rhythms. The function of FLR-4 was impaired by missense mutations in the kinase domain and near the hydrophobic region, where the latter allele seemed to be a weak antimorph. Thus, a novel protein kinase with a unique structural feature acts in the intestine to increase the length of defecation cycle periods.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Many biological functions are associated with rhythms that are genetically controlled. Circadian rhythms, which change the metabolism and behavior of animals, plants and microorganisms with periods of ~24 h, are generated by the transcriptional oscillation of special genes (Young and Kay, 2001Go; Stanewsky, 2003Go). These rhythms are said to have innate clocks, based on the following criteria: 1) even in the absence of environmental cues, the rhythm continues at the same period; 2) the period remains constant over a wide range of temperatures; and 3) the phase of oscillations can be reset by certain external stimuli. Rhythms other than circadian rhythms are also known. Some of them are infradian rhythms, which have periods longer than a day, like reproductive cycles of primate females. Others are ultradian rhythms, which have periods shorter than a day.

Ultradian rhythms are found in diverse aspects of many living organisms (Hall, 1995Go; Iwasaki and Thomas, 1997Go; Calabrese, 1998Go). They include heart beat rhythms (Attali, 1996Go), rhythms of locomotion (Grillner, 1985Go), the courtship song of Drosophila (Hall and Rosbach, 1988Go), and the cycle of rapid eye movement (REM) and non-REM sleep (Weitzman, 1981Go). These rhythms have periods ranging from seconds to hours and seem to be based on diverse mechanisms, unlike circadian rhythms. How these rhythms are regulated remains to be elucidated in most cases.

The defecation behavior of Caenorhabditis elegans, which repeats with a period of ~45 s, is a typical example of an ultradian rhythm (Thomas, 1990Go). The unit of behavior consists of three sequential motor steps: posterior body-wall muscle contraction (pBoc), anterior body-wall muscle contraction (aBoc), and expulsion (Exp). Behavioral analysis showed that the defecation rhythm, like circadian rhythms, is controlled by an endogenous clock (Liu and Thomas, 1994Go). First, the rhythm is independent of the motor steps. Animals stop exhibiting defecation behavior when they move away from food. Even in such conditions, the rhythm continues at the same period, and, after returning to the food, animals resume defecation behavior depending on this rhythm. Second, the defecation cycle period remains almost constant over a temperature range of 19–30°C. Finally, the phase of defecation rhythm can be reset to time zero, i.e., just after the expulsion, by lightly touching the body of animals.

The cells and genes that control the motor steps have been investigated. Analysis of mutants showed that there are genes that specifically control pBoc, aBoc, and Exp as well as genes that control both aBoc and Exp (Aex phenotype) (Thomas, 1990Go). Based on these results, a model for the control of defecation behavior was postulated, in which the defecation clock or cycle generator controls aBoc and Exp independently of pBoc. In agreement with the model, laser ablation experiments revealed that two GABAergic neurons, AVL and DVB, are required for aBoc and Exp but not for pBoc (McIntire et al., 1993Go). Attempts to identify neurons that are required for pBoc, however, have resulted in failure (E. M. Jorgensen and H. R. Horvitz, cited in Dal Santo et al., 1999Go). The study on the inositol trisphosphate receptor gene (Dal Santo et al., 1999Go), which is explained below, suggests that the signal for pBoc may be generated in the intestine and transmitted directly to body wall muscles.

Genes that regulate defecation rhythms have been identified by mutations (Dec mutations) that change defecation cycle periods, which map to at least 13 genes and that are classified into two categories: Dec-short and Dec-long (Iwasaki et al., 1995Go). Of the latter genes, itr-1 (= dec-4) gene encodes the IP3 receptor, and its mutants show long defecation cycle periods (hypomorph) or no defecation behavior (amorph), whereas overexpression of this gene results in short defecation cycle periods (Dal Santo et al., 1999Go). Genetic mosaic analysis revealed that expression of the wild-type itr-1 gene in the intestinal cells is sufficient for the wild-type phenotype. Furthermore, itr-1 gene also controls the periods of Ca2+ oscillation in the intestinal cells, where the defecation rhythm has the same periods as Ca2+ oscillation, with pBoc being preceded by the peaks of calcium concentration. Thus, the IP3 receptor in the intestinal cells seems to play an essential role in the defecation rhythm.

Mutants in flr-1, flr-3, and flr-4 are unique among Dec mutants in that they show very short defecation periods (Iwasaki et al., 1995Go). Furthermore, they show other phenotypes such as resistance to fluoride ions, slow growth, abnormal regulation of dauer larva formation (Katsura et al., 1994Go), and frequent skip of Exp (Take-uchi et al., 1998Go). One of these genes, flr-1, has been cloned and shown to encode an ion channel of the DEG/ENaC superfamily that is expressed only in the intestine (Take-uchi et al., 1998Go). However, to elucidate the regulatory system that prolongs defecation cycle periods, it is necessary to clone flr-3 and flr-4 genes and investigate detailed properties of their mutants. Here, we report our analysis of flr-4 genes, which revealed that a novel Ser/Thr kinase is involved in the regulation of defecation cycle periods.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Strains and Nomenclature
All the strains used in this study derive from the wild-type C. elegans var. Bristol N2. The mutations used were flr-1(ut11) X, flr-4(n2259, sa201, ut3, ut7) X, flr-3(ut9) IV, unc-3(e151) X, mnDf19 X, and mnDp1(X;V). The deficiency mnDf19 deletes flr-4 gene (Katsura et al., 1994Go), whereas the duplication mnDp1, which is homozygous sterile, covers mnDf19 (Herman et al., 1979Go). Genetic nomenclature was as described previously (Horvitz et al., 1979Go; Hodgkin, 1997Go). Animals were grown at 20°C as described previously (Brenner, 1974Go), except where otherwise noted.

Assays of Phenotypes
Defecation behavior was observed at 23°C essentially as described (Liu and Thomas, 1994Go), except that the temperature was 20 or 25°C in temperature-shift experiments. The defecation motor steps of flr mutants sometimes became too weak to observe even the pBoc step, and the animals looked as if they ceased defecation behavior for a long time. Hence, we did not include defecation interval lengths longer than 100 s in the statistics. For statistical analysis, we first calculated a mean defecation cycle period for each animal and then a mean and SEM of these results. This method was chosen, because the variation of defecation cycle periods among different animals was often larger than that within the same animal. Dauer formation (Thomas et al., 1993Go), growth rate and fluoride sensitivity (Katsura et al., 1994Go) were measured as described.

Cloning of flr-4 Gene and cDNA
Mutations in the flr-4 gene were genetically mapped in a region between unc-3 and unc-7, covered by the mnDp25 duplication and not detected by the mnDf20 deficiency, on the linkage group X (Katsura et al., 1994Go). By microinjection of genomic clones in this region into the gonad of flr-4 mutants, we found that the cosmid F09B12 (courtesy of the C. elegans genome project) could rescue the phenotypes. We then subcloned several DNA fragments from F09B12 and tested them for the rescuing activity. A clone containing an 8.0-kb KpnI-PstI fragment, pMT11–2, was found to rescue the phenotypes of flr-4 mutants. The sequence of F09B12 by the C. elegans genome consortium revealed that only one complete open reading frame (ORF), which codes for a predicted protein kinase, is present in the 8.0-kb KpnI-PstI region. We cloned the cDNA that encodes the predicted protein kinase by RT-PCR, 5'- and 3'-RACE methods. We think the cDNA is full length, since the SL1 sequence is present at the 5' end and since a single band corresponding to the expected size of the mRNA was detected by Northern analysis.

Reporter Fusions
The plasmid pMTG7–11 is comprised of the flr-4 rescuing construct with the carboxy terminus tagged with GFP through a linker sequence. It was constructed by the following procedures. 1) A 420-base pair fragment, corresponding to the 3' part of flr-4 gene, was amplified from pMT11–2 (minimal rescuing genomic DNA clone) using the primers f4-PK522 (CCTGCAGGGTACCCACCTCATTTATAGTGCGGC) and f4-BG320 (GGGATCCACCGTTTTCTTCATTTGCTGGTCCAGACG), and cloned into a T-vector. The primer f4-PK522 contained a PstI site and a KpnI site located side by side, and f4-BG320 contained the 3' end of the flr-4 coding sequence, a linker sequence and a BamHI site to connect to GFP. 2) The PstI-BamHI fragment of this clone was ligated to the PstI-BamHI-digested pQE9 vector (QIAGEN, Chatsworth, CA). 3) The KpnI-BssHII fragment (99 base pairs) of this clone was replaced by the 7.0-kb KpnI-BssHII fragment of pMT11–2, which contained a 3.5-kb 5' upstream region and the coding region of flr-4 gene, except for a short 3' part. 4) The 7.4-kb PstI-BamHI fragment of this clone, i.e., complete flr-4 gene with a 3.5-kb 5' upstream region and a 3' linker sequence, was ligated into the PstI-BamHI–digested pPD95.77E1 to make pMTG7–11, where pPD95.77E1 is an improved version of the gfp vector pPD95.77 (courtesy of A. Fire) producing a brighter GFP (F64L S65T).

GFP fluorescence was examined as described by Chalfie et al. (1994Go). The DiQ fluorescent marker 4-(p-dihexadecylaminostyryl)-N-methylquinolinium iodide (Molecular Probes, Eugene, OR) was used to help identification of neurons in the head region. The dye-filled cell types and staining method of DiQ were essentially the same as described for DiO (Starich et al., 1995Go). A Rhodamine filter set was used to observe the fluorescence of DiQ.

Tissue-specific Expression
The plasmid pYK4–2.2 is comprised of flr-4 cDNA driven by the intestine-specific C03F11.3 promoter (Rafaz Hoque, Roy Silverstein, and Martin Chalfie, personal communication). It was constructed by the following procedures. 1) An 822-base pair fragment containing the 5' upstream promoter sequence and the translational start point of C03F11.3 (CD36-like protein) gene was amplified from C. elegans genomic DNA, using the primers C03F11.3SalI: CTCGTCGACGCCACTGTACCCAGTTGTTCT and C03F11.3SphI: CTCGCATGCGTAACCTCGGAGAATTGAAAGTG, which contained SalI and SphI restriction sites, respectively. The PCR product, after purification and cleavage with SalI and SphI, was ligated to the SalI-SphI-digested pPD95.79 vector (A. Fire) and cloned. Using this clone (C03F11.3p::GFP), we confirmed that the C03F11.3 promoter drives expression only in the intestine (unpublished data). 2) flr-4 cDNA was amplified from the full-length cDNA clone (see above), using the primers f4-NcoI-ATG: CATGCCATGGATGCCAATAAATTACAATCG and f4-stop-SacI: CGCAGAGCTCCTAGTTTTCTTCATTTGCTG, which contained NcoI and SacI sites, respectively. The PCR product, after purification and cleavage with NcoI and SacI, was ligated to the NcoI-SacI–digested pPD49.26 vector (A. Fire) and cloned. 3) The C03F11.3 promoter-containing sequence was cleaved out with SphI and XbaI from the clone (1), purified, and ligated to the SphI-XbaI sites of the clone (2) to yield pYK4–2.2.

Transgenic Lines
Microinjection was carried out as described (Mello et al., 1991Go). For rescue experiments, the DNA to be tested and the rol-6(su1006) dominant marker plasmid pRF4 (Kramer et al., 1990Go) were coinjected into flr-4(ut7) animals at concentrations of 1 and 99 ng/µl, respectively. Multiple independent lines were established from each injection. A strain carrying a flr-4::GFP chromosomal insertion was obtained serendipitously by injecting a mixture of pMTG7–11 and pRF4 at concentrations of 95 and 5 ng/µl, respectively, to N2 animals. The chromosomal insertion containing pMTG7–11 (flr-4::GFP) was transferred to flr-4(ut7) animals by cross to test the rescue of the phenotypes. The flr-4(ut7) and unc-3(e151) flr-4(ut7) strains that express flr-4 cDNA only in the intestine were obtained as follows. The clones of C03F11.3p::flr-4 cDNA (pYK4–2.2), myo-3p::GFP (marker), and pBluescriptKS(+) (Stratagene, La-Jolla, CA) were mixed to give final concentrations of 20, 2, and 78 ng/µl, respectively, and injected into N2 animals. Then, the extrachromosomal array was transferred to flr-4(ut7) and unc-3(e151) flr-4(ut7) animals by genetic cross.

Laser Microsurgery
AUA cells in anesthetized wild-type and flr-4(n2259) L1 larvae were killed with a 440-nm laser microbeam using a MicroPoint Laser System (Photonic Instruments, St. Charles, IL). Details were as previously described (Bargmann and Avery, 1995Go). After the operation, the animals were grown to young adults at 20°C, and their behavior was analyzed at 23°C.

Determination of Mutation Sites by DNA Sequencing
The flr-4 coding region was amplified by using Expand High Fidelity PCR System (Boehringer Mannheim, Mannheim, Germany) from single animals of various mutants as described (Williams et al., 1992Go). The PCR products were cloned, and at least two independent clones for each PCR product were sequenced with a dye-terminator sequencing system (Perkin Elmer-Cetus, Foster City, CA).

Genetic Interaction between Mutations in the Kinase Domain and C-terminus
The heterozygotes were obtained as the F1 and F2 progeny of crosses between unc-3 flr-4 hermaphrodites and flr-4 (or N2) males or between mnDp1/+; mnDf19 hermaphrodites, and flr-4 males. The deficiency mnDf19 deletes flr-4 (Katsura et al., 1994Go). The unc-3 mutation, which is linked to flr-4 and which has no effect on growth rates as a heterozygote, was used to distinguish cross-progeny from self-progeny and to estimate the genotype of F2 animals by checking the phenotypes of their progeny. To exclude the contribution of maternal effect, reciprocal crosses were performed, and the generation time of both F1 and F2 progeny was measured. mnDf19/flr-4 could be discriminated from mnDp1/+; mnDf19 (self progeny) and mnDp1/+; mnDf19/flr-4 (cross-progeny), because the latter segregated mnDp1 homozygotes, which are sterile (Herman et al., 1979Go).

Temperature-shift Experiments
For temperature-upshift experiments, the cultivation temperature of flr-4(n2259) worms was raised from 20 to 25°C at various developmental stages, and their defecation behavior was observed as young adults at 25°C. For temperature-downshift experiments, the temperature was changed from 25 to 20°C at various developmental stages, and the defecation behavior was observed as young adults at 20°C.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Phenotypes of Various flr-4 Mutants
To characterize the abnormality of flr-4 mutants, we investigated the defecation behavior of four flr-4 alleles, n2259, sa201, ut3, and ut7 at 23°C (Table 1). Wild-type (N2) animals showed a mean defecation cycle period of ~45 s, and all the motor steps (pBoc, aBoc, and Exp) could be detected in most defecation cycles, although aBoc was less obvious than pBoc and Exp. In contrast, flr-4 mutants showed shorter mean defecation cycle periods of ~30 s. Moreover, the Exp step was often absent in flr-4 mutants. The aBoc step seemed to be present at higher probability than Exp, although we could not quantify the aBoc/pBoc ratio. Two of the mutations, n2259 (E. M. Jorgensen, personal communication) and sa201 (Iwasaki et al., 1995Go), were temperature-sensitive in the defecation period abnormality. Namely, they showed short defecation cycle periods at 23 or 25°C, but almost normal defecation cycle periods at 20°C (unpublished data). The Exp/pBoc ratio was higher at 20 than at 23°C, but somewhat lower than that of wild-type animals.


View this table:
[in this window]
[in a new window]
 
Table 1. Phenotypes of various flr-4 and related mutants

 

The mean defecation cycle periods of wild-type animals changed very little even when measurements were repeated over a long time period. However, those of flr-4 mutants varied to a larger extent, possibly because they were more sensitive to unidentified experimental conditions. We therefore did not interpret the difference of mean defecation cycle periods among different flr-4 alleles. The asymmetric distribution of defecation interval length, namely, very short defecation cycle periods around 20 s with occasional much longer periods (the same as that of flr-1 mutants shown in Take-uchi et al. (1998Go)), was common to all the flr-4 mutants and clearly differed from the symmetric distribution in wild-type animals.

It is known that exogenous fluoride ion increases the defecation cycle periods of wild-type animals but not that of flr-1 mutants (Take-uchi et al., 1998Go). We therefore tested the effect of fluoride ion on flr-4 mutants. All the flr-4 mutants, like flr-1 mutants, did not change their defecation interval length in response to fluoride ion, with the possible exception of sa201 (Table 1).

Surprisingly, fluoride ion suppressed the low Exp/pBoc ratio of ut7. This effect was confirmed by measuring the defecation cycle periods of the same animals before and 30 min after transfer the animals to plates containing NaF. The ut7 mutant showed an almost normal Exp/pBoc ratio also on plain agar plates containing no salts (our unpublished results).

Two of the flr-4 mutants, ut3 and ut7, showed resistance to fluoride ion and slow growth rates, as reported already (Katsura et al., 1994Go). The other two flr-4 mutants, n2259 and sa201, which showed temperature-dependent abnormality in defecation cycle periods, also showed temperature-dependent resistance to 400 µg/ml NaF; namely, they were resistant to NaF at 25°C but sensitive at 20°C. However, they grew at almost normal rates at 20 and 25°C.

Some flr-4 mutants as well as some flr-1 and flr-3 mutants show constitutive dauer larva formation in the unc-3(e151) background (Katsura et al., 1994Go), where the dauer larva is special third-stage larvae that appears under high population density and limited food supply (Riddle and Albert, 1997Go), and the unc-3 gene encodes a transcription factor of the Olf-1/EBF family, which is expressed in ASI sensory neurons (Prasad et al., 1998Go). Because dauer larva formation is induced by environmental cues that are sensed by some head neurons, the synthetic dauer-constitutive phenotype may reflect the possible influence of flr-4, flr-1, and flr-3 mutations on neural functions (Take-uchi et al., 1998Go). In this study we investigated which flr-4 alleles showed a stronger tendency to form dauer larvae. As shown in Table 2, the synthetic dauer-constitutive phenotypes were parallel to abnormality in growth rates (Table 1): the mutations ut3 and ut7, which confer slow growth, showed strong dauer-constitutive phenotypes, whereas n2259 and sa201, which affect growth rates very little, showed no or weak dauer-constitutive phenotypes in the unc-3(e151) background.


View this table:
[in this window]
[in a new window]
 
Table 2. Synthetic dauer-constitutive phenotypes of various flr-4 mutants

 

We also studied interaction between flr-4, flr-1, and flr-3 mutations, all of which show similar phenotypes. As shown in Table 1, all the single, double, and triple mutants of flr-1(ut11), flr-3(ut9), and flr-4(ut7) showed essentially the same phenotypes in growth, fluoride-resistance, defecation cycle periods, and the Exp step on NGM plates. The results are consistent with the idea that flr-4 acts in the same pathway as flr-1 and flr-3. The suppression of low Exp/pBoc ratio of flr-4(ut7) by fluoride ion required the wild-type flr-1 and flr-3 genes. This result suggests that the flr-4 gene acts in cooperation with or upstream of flr-3 and flr-1 genes.

The flr-4 Gene Encodes a Novel Protein Kinase with Predicted Transmembrane Regions in the Carboxyl Terminus
To elucidate the molecular mechanism of FLR-4 functions, we cloned the flr-4 gene by the transformation rescue method (See Materials and Methods for details). An 8.0-kb KpnI-PstI fragment (pMT11–2; Figure 1A) from the genomic clone F09B12 rescued all the phenotypes of flr-4(ut7) (Figure 1C). We also cloned the flr-4 cDNA, which consisted of 2060 base pairs and had an SL1 splice leader sequence (Krause and Hirsh, 1987Go) at the 5' end and a poly(A) stretch after the consensus polyadenylation signal sequence AATAAA. Comparison with the genomic sequence in F09B12 indicated that flr-4 gene has 12 exons (Figure 1B). The ORF, corresponding to F09B12.6, encoded a protein consisting of 570 amino acids (Figure 2A).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Cloning of flr-4 gene and cDNA. (A) Genetic and physical map around the flr-4 gene. The cosmid clone F09B12 and its subclones pMT5–3 and pMT11–2 (but not pMT9–1) rescued the flr-4 phenotypes by microinjection. The arrow indicates the direction of transcription of the only complete ORF contained in pMT11–2. S, SalI site; P, PstI site. (B) Top: the structure of the 8-kb genomic clone (pMT11–2) that rescued the flr-4 phenotypes. The 12 exons are indicated by boxes. The coding region is striped. The trans-splice leader SL1 and the poly(A) tail are also shown. Bottom: the structure of pMTG7–11, which codes for a GFP(F64L S65T)-tagged FLR-4 protein. (C) Rescue of the flr-4(ut7) phenotypes by the genomic DNA fragment pMT11–2 and by flr-4 cDNA driven by the intestine-specific C03F11.3 promoter. Various phenotypes of the wild-type (N2), flr-4(ut7), flr-4(ut7);Ex[pMT11–2] and flr-4(ut7);Ex[C03E11.3p::flr-4 cDNA] are presented.

 


View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. flr-4 encodes a novel Ser/Thr protein kinase with a C-terminal hydrophobic region. (A) Amino acid sequence of FLR-4. The kinase domain and the sequence rich in hydrophobic amino acids are shown by lines with arrowheads. The mutation sites of ut3, ut7, n2259, and sa201 are indicated by bold letters with the allele name and the resultant amino acid substitution. The mutation site of ut3 is located at a splice acceptor site (AG to AA). The cDNA sequence has been deposited in the DDBJ/EMBL/GenBank database (accession no. AB012700 [GenBank] ). (B) Comparison of the amino acid sequences between FLR-4 and Ser/Thr protein kinases resembling FLR-4, i.e., human SOK1 (Pombo et al., 1996Go), S. pombe BYR2 (Wang et al., 1991Go) and S. cerevisiae CDC15 (Schweitzer and Philippsen, 1991Go). Similar residues in three or four of them are boxed. The numbers in parentheses show those of amino acids omitted. The horizontal line indicates the STE20 signature GTP(Y/F)WMAPE. (C) Hydrophilicity plot (Hopp and Woods, 1981Go), showing a hydrophobic sequence consisting of 94 amino acids (horizontal line) in the C-terminal part (amino acid residues No. 400–493) of FLR-4.

 

A homology search of the predicted amino acid sequence using the BLAST program revealed that the amino-terminal part of FLR-4 resembles many known protein serine/threonine kinases (Figure 2B). FLR-4 has all the 15 highly conserved amino acids in serine/threonine kinases (Hanks and Quinn, 1991Go) with the exception of Asp in subdomain VII, which is replaced by a similar residue, Asn. Moreover, the amino acid residues 217–224 (TLLYVAPE) in subdomain VIII fit with the serine/threonine kinase consensus but not the tyrosine kinase consensus (Hanks et al., 1988Go). There is no protein kinase with very strong homology to FLR-4. Those that resemble FLR-4 relatively well, for instance, human SOK1 (Pombo et al., 1996Go), S. cerevisiae CDC15 (Schweitzer and Philippsen, 1991Go), and S. pombe BYR2 (Wang et al., 1991Go) had 28, 28, and 26% identity, respectively, to FLR-4 in the protein kinase domain (Figure 2B). Based on this homology, some researchers classified FLR-4 to the STE20 family (Plowman et al., 1999Go). Although this is reasonable from the viewpoint of the overall homology of the kinase domain, it is also true that FLR-4 is not a typical member of the STE20 family. It lacks the STE20 signature GTP(Y/F)WMAPE in subdomain VIII (Sells and Chernoff, 1997Go), which plays a role in substrate recognition (Hanks and Hunter, 1995Go).

The C-terminal part of FLR-4 has no clear similarity to known proteins but contains a 94-amino-acid sequence rich in hydrophobic amino acids (Figure 2, A and C). Many transmembrane prediction programs, such as SOSUI (http://sosui.proteome.bio.tuat.ac.jp/sosuiframe0.html) and TMHMM2 (http://www.cbs.dtu.dk/services/TMHMM-2.0/), predict two or three transmembrane regions in this sequence. Protein kinases with predicted transmembrane region(s) on the C-terminal side are relatively rare, because all the receptor-type protein kinases have their transmembrane region on the N-terminal side of the kinase domain. Examples of those relatively rare protein kinases are rat TAO2 kinase (Chen et al., 1999Go), its human homolog PSK (prostate-derived STE20-like kinase; Mitsopoulos et al., 2003Go), human myotonic dystrophy kinase (Waring et al., 1996Go), and some other kinases predicted in the genome sequences of C. elegans, Arabidopsis, and many prokaryotes. Despite belonging to the same STE20 family, the ortholog of TAO2/PSK in C. elegans is not FLR-4 but KIN-18 (Berman et al., 2001Go), which does not have predicted transmembrane regions. Moreover, none of SOK1, CDC15, and BYR2, which resemble FLR-4 in the kinase domain, possess predicted transmembrane regions.

flr-4::GFP Is Expressed in the Intestine, Part of the Pharynx, and AUA Neurons
To investigate the tissue and subcellular localization of FLR-4, we examined the expression of the flr-4::GFP fusion gene pMTG7–11 (Figure 1B) in wild-type animals. This construct fully rescued all the flr-4 phenotypes (unpublished data), which indicates that the product was functional and present at a proper time in the cells that require the FLR-4 function for the wild-type phenotypes. Comma-stage embryos began to express the GFP-tagged protein in intestinal cells (Figure 3E), and animals retained the intestinal expression through the adult stage (Figure 3, F and D), although the intestinal expression became weaker after the L1 stage. The FLR-4::GFP fusion protein accumulated at the cell membrane of intestinal cells, especially the lateral membrane intervening the intestinal cells (Figure 3D). The fusion protein was also detected in the muscles of the pharyngeal isthmus from the threefold embryonic stage, and in a pair of head neurons, which we identified as AUA neurons, from the late L1 stage, (Figure 3D). These expression patterns were retained through the adult stage (Figure 3G).



View larger version (63K):
[in this window]
[in a new window]
 
Figure 3. Expression of GFP-tagged FLR-4 protein. (A–C) Nomarski images and (D–F) epifluorescence images of the corresponding animals of N2 carrying pMTG7–11 (GFP-tagged flr-4). (A and D) Early L1 larva. (B and E) Comma stage embryo. (C and F) Three-fold stage embryo. (G) Ventral view of an adult head region, showing that the fluorescence of FLR-4::GFP is detected in AUA neurons as well as the muscles of the pharyngeal isthmus. The DiQ fluorescent marker, which penetrates into some neurons (not including AUA), is shown in red. Scale bar, 50 µm.

 

Expression of flr-4 in the Intestine Is Sufficient for the Wild-type Phenotype
Although the functional flr-4::GFP fusion gene was expressed in the intestine, part of the pharynx and AUA neurons, it does not necessarily mean that expression in all these areas is required for the flr-4 functions investigated in this study. We therefore expressed FLR-4 only in the intestine by using the intestine-specific promoter of C03F11.3 (CD36-like protein) gene (Rafaz Hoque, Roy Silverstein, and Martin Chalfie, personal communication) in flr-4(ut7) and unc-3(e151) flr-4(ut7) animals. The results (Figure 1C) showed that expression of FLR-4 in the intestine rescued the flr-4(ut7) mutant phenotypes for defecation cycle periods, the Exp step of defecation behavior, sensitivity to fluoride ion, and growth rates. Furthermore, the dauer-constitutive phenotype of the unc-3(e151) flr-4(ut7) mutant was also rescued by this construct. Very few (0.2%) dauer larvae were found among unc-3(e151) flr-4(ut7) animals carrying the extrachromosomal array of C03F11.3p::flr-4 cDNA at 25°C. Thus, the expression of FLR-4 in the intestine was sufficient for all the wild-type phenotypes investigated in this study.

AUA Neurons Are Not Essential for the Control of Defecation Rhythm and Defecation Behavior
To elucidate the contribution of AUA neurons to defecation behavior and defecation cycle periods, we performed cell-killing experiments using a laser microsurgery technique. AUA neurons in six wild-type animals were killed. The AUA-killed animals showed normal defecation cycle periods (46.9 ± 2.2 s for the average ± SEM of 6 animals) and retained most of the Exp steps (Exp/pBoc = 97%). The results demonstrate that AUA neurons are not essential for normal defecation behavior and defecation cycle periods in wild-type animals. We also killed AUA neurons in flr-4(n2259) animals. Even after the laser surgery, the animals exhibited short defecation cycle periods (27.2 ± 7.4 s for the average ± SEM of 4 animals) and frequently skipped the Exp step (Exp/pBoc = 30%). These findings show that defecation abnormalities of the flr-4 mutant are not caused by the abnormal activity of AUA neurons.

Mutations in the Kinase Domain and near the Hydrophobic Region Impair Normal Defecation Rhythms
To study the structure-function relationship of the FLR-4 protein, we identified mutational changes in four independently derived flr-4 alleles: n2259, sa201, ut3, and ut7 (Figure 2A). Two temperature-sensitive alleles, n2259 and sa201, had missense mutations in the kinase domain (Figure 2A). The mutation n2259 was located at a Proresidue in the activation loop of the protein kinase domain (P223S). This Proresidue is in the highly conserved consensus triplet, Ala-ProGlu, in the subdomain VIII of protein kinases (Hanks et al., 1988Go) and seems to be important for the three-dimensional structure. The neighboring Glu residue probably forms an ion pair with the invariant Arg residue in subdomain XI and stabilizes protein conformation (Knighton et al., 1991Go). The mutation sa201 was a substitution of Arg for Gly at residue 248 (G248R) in subdomain IX. This Gly residue is nearly invariant in protein kinases (Hanks et al., 1988Go). The large volume increase from Gly to Arg may cause instability in the protein structure.

The mutation ut7 was a substitution of Arg for Gly at residue 494 (G494R), just after the stretch of 94 hydrophobic amino acid residues. This allele seems to be a weak antimorph, as shown in the next section.

The mutation ut3 changed a splice acceptor sequence AG to AA, which is located within the DNA sequence for the kinase domain (Figure 2A). The nucleotide change is in agreement with the prediction that this mutation is null or hypomorphic, which is based on the results that ut3/Df shows almost the same phenotype as ut3/ut3 (Katsura et al., 1994Go).

ut7, a Missense Mutation in the C-terminus, Is a Weak Antimorph
To learn about the nature of ut7, a missense mutation in the C-terminus, we investigated the phenotypes of the heterozygotes ut7/n2259 and ut7/sa201, where n2259 and sa201 are weak missense alleles that show normal growth. As controls, we used ut3, an allele with a nucleotide change in a splice-acceptor sequence, and mnDf19, a deficiency deleting the entire flr-4 gene. Although both ut3 and ut7 showed slow growth as homozygotes (Tables 1), they showed distinct phenotypes concerning growth rates when they were placed in trans to the weak alleles, n2259 and sa201 (Table 3). The heterozygotes ut3/n2259 and ut3/sa201 grew at normal rates, but the heterozygotes ut7/n2259 and ut7/sa201 grew slowly. The result indicates that ut7 is antimorphic, because the latter heterozygotes show stronger phenotypes than mnDf19/n2259 and mnDf19/sa201, which grow at normal rates. We conclude that ut7 is a weak antimorph, whose effect is apparent only in heterozygotes ut7/n2259 or ut7/sa201 but not in ut7/+.


View this table:
[in this window]
[in a new window]
 
Table 3. The allele ut7 is antimorphic

 

FLR-4 Function Is Required for the Control of Defecation Cycle Periods at the Time of Behavioral Assay
To estimate the developmental stage at which the flr-4 function is required, we performed temperature-shift experiments using n2259, an allele that exhibits temperature-sensitive abnormality in defecation cycle periods. As shown in Figure 4, when the temperature was shifted upward during larval development, the animals had short defecation cycle periods as young adults, regardless of the time of the temperature shift during the development. Short defecation cycles were observed as soon as 30 min after shift to 25°C (unpublished data). In contrast, when the temperature was downshifted, the animals had normal defecation cycle periods, unless the time of the temperature shift was just before the behavioral assay. From these results we conclude that the FLR-4 function is required at the time of the behavioral assay, which was performed at the adult stage. This suggests that FLR-4 is involved in a cell-functional aspect of defecation rhythm regulation rather than a developmental aspect, for instance, the generation or differentiation of the cells required for the regulation.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 4. Temperature-shift experiments of the flr-4 (n2259ts) mutant concerning defecation cycle periods. For temperature-upshift experiments, the cultivation temperature of flr-4(n2259) worms was raised from 20 to 25°C at various developmental stages, and their defecation behavior was observed as young adults at 25°C. For temperature-downshift experiments, the temperature was changed from 25 to 20°C at various developmental stages, and the defecation behavior was observed as young adults at 20°C. The open and closed circles represent the mean defecation cycle periods of young adult animals after temperature upshift and downshift, respectively, at the developmental stage indicated on the abscissa. "Control" indicates experiments with no temperature-shift. Data are mean ± SEM. The mean and SEM values were calculated from the mean defecation cycle periods of 3–11 animals, each of which was an average of 7–22 defecation cycle periods.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
FLR-4, a Novel Ser/Thr Protein Kinase, Regulates Defecation Rhythm in Intestinal Cells
The flr-4 gene, whose mutants show very short defecation cycle periods, encodes a novel serine/threonine protein kinase. This suggests that the defecation rhythm is regulated by protein phosphorylation. Examples of protein phosphorylation that regulates ultradian rhythms have been reported. Mutants in the Drosophila dco gene, which encodes the major catalytic subunit of protein kinase A, display arrhythmic locomotor activity (Majercak et al., 1997Go). Phosphorylation of the metabotropic glutamate receptor 5a by protein kinase C evokes Ca2+ oscillations in HEK293 cells transfected with the glutamate receptor (Kawabata et al., 1996Go).

Although the functional flr-4::GFP fusion gene was expressed in the intestine, part of pharyngeal muscles and AUA neurons, expression at all these sites may not be necessary for the functions of FLR-4. Experiments with an extrinsic promoter revealed that expression in the intestinal cells was sufficient for the wild-type phenotypes in defecation rhythm, the Exp step of defecation behavior, growth, dauer larva regulation, and fluoride sensitivity. Furthermore, laser ablation of AUA neurons did not change the characteristics of defecation rhythm and defecation behavior of wild-type and flr-4 animals. Thus, the expression of FLR-4 in the intestine is apparently sufficient for all the functions investigated in this study.

The temperature-shift experiments of the flr-4(n2259ts) mutant showed that a functional flr-4 gene product is required at the time of defecation measurements at the adult stage. The result suggests that the flr-4 gene has a function in differentiated cells, and not in the generation or differentiation of cells involved in the regulation of defecation rhythm.

Taking these arguments into consideration, we conclude that FLR-4 acts in the intestine at the time of defecation behavior to increase the length of defecation cycle periods.

Roles of the Kinase Domain and Hydrophobic Region in the Functions of FLR-4
The kinase domain of FLR-4 appears to be important for defecation rhythm. FLR-4 contains essentially all the conserved amino acid residues of protein kinases, except that the DFG motif in subdomain VII is changed to a closely related sequence NFG. Two mutations, n2259 and sa201, are located at nearly invariant residues in the kinase domain. The results suggest that the kinase domain is essential at least for the FLR-4 functions that are impaired by these kinase domain mutations, i.e., normal defecation rhythms, the Exp step of defecation behavior, and sensitivity to fluoride ion. The three-dimensional structures of protein kinases (Knighton et al., 1991Go; DeBondt et al., 1993Go) suggest that the amino acid residues altered by these mutations may play a role in stabilizing the structure of the kinase domain. This is consistent with the temperature-sensitive phenotype on the defecation cycle abnormality of these mutations.

The allele flr-4(ut7), which has a mutation adjacent to the hydrophobic region outside the kinase domain, appears to be a weak antimorph. This study revealed that the heterozygotes ut7/n2259 and ut7/sa201 grow slowly, whereas Df/n2259 and Df/sa201 grow almost normally. The antimorphic effect was clear only in heterozygotes ut7/n2259 or ut7/sa201 but not in ut7/+. The reason may be that flr-4(n2259) and flr-4(sa201) genes, probably supply a smaller number of active FLR-4 protein molecules than the wild-type flr-4 gene, due to protein instability or protein folding abnormality. The antimorphic property suggests that FLR-4(ut7) participates in molecular interactions required for the FLR-4 function but hinders at least one of the interactions, resulting in a poisonous effect. The amino acid substituted by the ut7 mutation, which is adjacent to the C-terminal hydrophobic region, may be located at or near the interaction site. Alternatively, the ut7 mutation may change the overall protein conformation and damage the interaction site that is distantly located from the substituted amino acid.

The function of the predicted transmembrane regions in the C-terminal part is intriguing in relation to the unique structural feature of FLR-4. Only a few protein kinases have predicted transmembrane regions on the C-terminal side of the kinase domain, like FLR-4. Of the predicted transmembrane regions of such exceptional protein kinases, those of prostate-derived STE20-like kinase (PSK) and myotonic dystrophy kinase are actually not transmembrane regions. The former are required for localization to microtubules (Mitsopoulos et al., 2003Go), whereas the latter play a role in the formation of a large self-associated complex that favors peripheral association with membranes (Waring et al., 1996Go). Like these cases, the C-terminal part of FLR-4 may play a role in the interaction with other proteins. Alternatively, it may contain membrane-spanning regions that anchor the FLR-4 molecule to the cell membrane. Unfortunately, it is difficult to study the function of the predicted transmembrane regions by detecting the localization of FLR-4. FLR-4::GFP without the C-terminal part is already localized at the cell membrane, like full-length FLR-4::GFP (unpublished data).

Relationship among Various FLR-4 Functions
flr-4 mutants show diverse phenotypes: resistance to fluoride ion, slow growth, tendency to form dauer larvae, and defects in the Exp step of defecation, in addition to short defecation cycle periods (Katsura et al., 1994Go; Iwasaki et al., 1995Go). This study revealed that they also show a severe decrease in Exp/pBoc ratio. The result suggests that flr-4 has a role in the signaling downstream of the defecation cycle clock in addition to its role in regulating the defecation cycle period. The Exp step is controlled by the DVB neuron, which innervates rectal muscles, whereas expression of flr-4 in the intestine is sufficient for normal Exp. Hence, probably there are signal molecules that are controlled by flr-4 gene and that transmit the signal of Exp from the intestine to the DVB neuron and/or AVL neuron, which is also required for Exp. Other molecules that transmit a signal from the intestine to neurons may be present for the regulation of dauer larva formation by flr-4 gene. Because ut3 and ut7 mutants exhibit a starved appearance as well as slow growth, this signal may be induced by malnutrition due to functional defects of the flr-4 mutant intestine. Investigation of the relationship among those diverse functions may be useful also for elucidating the mechanism of defecation rhythm regulation by flr-4 gene.

Of the phenotypes of flr-4 mutants, short defecation cycle periods, frequent skip of Exp, and resistance to fluoride ion can be separated from slow growth rates and tendency to form dauer larvae. The mutants flr-4(n2259) and flr-4(sa201), as well as the double mutants flr-4(ut3 or ut7); flr-2 and flr-4(ut3 or ut7); flr-5, showed only the former and not the latter phenotypes, except that flr-4(n2259) produced some dauer larvae in the unc-3(e151) background (this study; Katsura et al., 1994Go; our unpublished results). The results indicate either that flr-4 gene acts in different pathways for the two groups of phenotypes or that the threshold of the FLR-4 activity between the mutant and wild-type phenotype is different for the two groups.

The flr-4 gene regulates both defecation rhythm and Exp, although they are controlled in general by distinct genes (Thomas, 1990Go; Iwasaki et al., 1995Go). The results of this study revealed that the Exp phenotype but not the Dec-short phenotype of flr-4(ut7) is suppressed by fluoride ion or by low osmotic pressure. The suppression is specific, because slow growth, which is suppressed relatively easily as discussed above, is not suppressed in this case. These results suggest that FLR-4 may control defecation rhythm and Exp in different pathways.

Fluoride ion kills wild-type larvae and elongates the defecation interval length of wild-type adults. In contrast, it does not kill flr-4 mutant larvae efficiently, nor does it elongate the defecation interval length of flr-4 adults. Namely, the effects of fluoride ion require an intact flr-4 gene. Although the target of fluoride ion for these effects has not been identified, we suspect that a protein phosphatase or a trimeric G-protein may be the target. It is known that fluoride inhibits the activity of some protein phosphatases (Ballou and Fischer, 1986Go), and, as aluminum fluoride, fixes trimeric G-proteins to the active state (Gilman, 1984Go). The FLR-4 kinase may act in the same pathway as a G-protein or a protein phosphatase, although there is so far no evidence. Identification of the target, therefore, may help in elucidating the mechanism of defecation rhythm regulation.

The flr-4 Gene, Together with flr-1 and flr-3, May Constitute a Regulatory System that Controls Defecation Rhythm
The flr-4 gene appears to regulate defecation rhythm in the same pathway as two other genes, flr-1 and flr-3. Mutants in these genes as well as double and triple mutants of flr-1, flr-3 and flr-4 show essentially the same phenotypes as those of flr-4 (Katsura et al., 1994Go; Iwasaki et al., 1995Go; Table 1 of this article). flr-1 and flr-3 are expressed only in the intestine (Take-uchi et al., 1998Go; Kawakami, Ishihara, and Katsura, unpublished results). Furthermore, the expression of flr-4 in the intestine is sufficient for its functions, although it is expressed in part of the pharynx and AUA neurons in addition to the intestine. These results support our hypothesis that flr-1, flr-3, and flr-4 constitute an intestinal regulatory system that controls defecation rhythm (Take-uchi et al., 1998Go).

How do flr-1, flr-3, and flr-4 interact with each other to achieve their functions? The FLR-4 protein kinase may activate the FLR-1 ion channel by phosphorylation, or FLR-1 may activate FLR-4 by changing the intracellular concentration of a certain ion. The former possibility was suggested by the presence of many putative phosphorylation sites in the intracellular domain of the FLR-1 ion channel (Take-uchi et al., 1998Go). However, further studies are necessary to prove the hypothesis.

Dal Santo et al. (1999Go) demonstrated that the calcium concentration in the intestinal cells oscillates with peak calcium levels just before the pBoc steps of defecation and that the activity of the IP3 receptor in the intestine regulates both defecation rhythm and calcium oscillation frequency. Thus, calcium oscillations in the intestine seem to be an essential part of defecation rhythms. On the basis of these results, an important issue that remains to be resolved is how flr-1, flr-3, and flr-4 genes modulate the period of calcium oscillations in the intestine.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Akane Oishi for technical assistance; Marty Chalfie, Kouichi Iwasaki, Erik Jorgensen, Roy Silverstein, and Jim Thomas for personal communications; and Ikue Mori, Yasumi Ohshima, and the members of our laboratory for useful suggestions and discussions. We are also grateful to Jim Thomas for sa201, Erik Jorgensen for n2259, Andy Fire for the pPD vectors, Alan Coulson for cosmids, and the C. elegans Genome Sequence Consortium for C. elegans genome sequences. Some nematode strains were obtained from the Caenorhabditis Genetic Center, which is funded by the National Institutes of Health National Center for Research Resources. This research was supported by grants from the Ministry of Education, Science, and Sports of Japan to I.K. and to T.I. and by a Japan Society for the Promotion of Science Research Fellowship to M.T.


    Footnotes
 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E04-04-0273) on January 12, 2005.

{ddagger} Present address: Special Researchers Program, Masai Initiative Research Unit, The Institute of Physical and Chemical Research (Riken), Hirosawa 2-1, Wako-shi, Saitama 351-0198, Japan. Back

§ Present address: Department of Biology, Faculty of Sciences, Kyushu University Graduate School, Hakozaki, Fukuoka 812-8581, Japan. Back

Address correspondence to: Isao Katsura (ikatsura{at}lab.nig.ac.jp).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Attali, B. ((1996). ). Ion channels. A new wave for heart rhythms. Nature 384, , 24-25.[CrossRef][Medline]

Ballou, L. M., and Fischer, E. H. ((1986). ). Phosphoprotein phosphatases. In: The Enzymes, 3rd Ed., Vol. XVII, , ed. P. D. Boyer and E. G. Krebs, Orlando: Academic Press, 311-361.

Bargmann, C. I., and Avery, L. ((1995). ). Laser killing of cells in Caenorhabditis elegans. Methods Cell Biol. 48, , 225-250.[Medline]

Berman, K. S., Hutchison, M., Avery. L. and Cobb, M. H. ((2001). ). kin-18, a C. elegans protein kinase involved in feeding. Gene 279, , 137-147.[CrossRef][Medline]

Brenner, S. ((1974). ). The genetics of Caenorhabditis elegans. Genetics 77, , 71-94.[Abstract/Free Full Text]

Calabrese, R. L. ((1998). ). Cellular, synaptic, network, and modulatory mechanisms involved in rhythm generation. Curr. Opin. Neurobiol. 8, , 710-717.[CrossRef][Medline]

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., and Prasher, D. C. ((1994). ). Green fluorescent protein as a marker of gene expression. Science 263, , 802-805.[Abstract/Free Full Text]

Chen, Z., Hutchison, M., and Cobb, M. H. ((1999). ). Isolation of the protein kinase TAO2 and identification of its mitogen-activated protein kinase/extracellular signal-regulated kinase kinase binding domain. J. Biol. Chem. 274, , 28803-28807.[Abstract/Free Full Text]

Dal Santo, P., Logan, M. A., Chisholm, A. D., and Jorgensen, E. M. ((1999). ). The inositol triphosphate receptor regulates a 50-second behavioral rhythm in C. elegans. Cell 98, , 757-767.[CrossRef][Medline]

DeBondt, H.D.L., Rosenblatt, J., Jancarik, J., Jones, H. D., Morgan, D. O., and Kim, S.-H. ((1993). ). Crystal structure of cyclin-dependent kinase 2. Nature 363, , 595-602.[CrossRef][Medline]

Gilman, A. G. ((1984). ). G proteins and dual control of adenylate cyclase. Cell 36, , 577-579.[CrossRef][Medline]

Grillner, S. ((1985). ). Neurobiological bases of rhythmic motor acts in vertebrates. Science 228, , 143-149.[Abstract/Free Full Text]

Hall, J. C., and Rosbach, M. ((1988). ). Mutations and molecules influencing biological rhythms. Annu. Rev. Neurosci. 11, , 373-393.[CrossRef][Medline]

Hall, J. ((1995). ). Tripping along the trail to the molecular mechanism of biological clocks. Trends Neurosci. 18, , 230-240.[CrossRef][Medline]

Hanks, S. K., Quinn, A. M., and Hunter, T. ((1988). ). The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, , 42-52.[Abstract/Free Full Text]

Hanks, S. K., and Quinn, A. M. ((1991). ). Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods Enzymol. 200, , 38-62.[Medline]

Hanks, S. K., and Hunter, T. ((1995). ). Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9, , 576-596.[Abstract]

Herman, R. K., Madl, J. E., and Kari, C. K. ((1979). ). Duplication in Caenorhabditis elegans. Genetics 92, , 419-435.[Abstract/Free Full Text]

Hodgkin, J. ((1997). ). Genetics. In: C. elegans II, ed. D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R. Priess, Cold Spring Harbor, NY: Cold Spring Harbor Press, 881-1047.

Hopp, T. P., and Woods, K. R. ((1981). ). Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. USA 78, , 3824-3828.[Abstract/Free Full Text]

Horvitz, H. R., Brenner, S., Hodgkin, J., and Herman, R. K. ((1979). ). A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol. Gen. Genet. 175, , 129-133.[CrossRef][Medline]

Iwasaki, K., Liu, D.W.C., and Thomas, J. H. ((1995). ). Genes that control a temperature-compensated ultradian clock in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 92, , 10317-10321.[Abstract/Free Full Text]

Iwasaki, K., and Thomas, J. H. ((1997). ). Genetics in rhythm. Trends Genet. 13, , 111-115.[CrossRef][Medline]

Katsura, I., Kondo, K., Amano, T., Ishihara, T., and Kawakami, M. ((1994). ). Isolation, characterization and epistasis of fluoride-resistant mutants of Caenorhabditis elegans. Genetics 136, , 145-154.[Abstract]

Kawabata, S., Tsutsumi, R., Kohara, A., Yamaguchi, T., Nakanishi, S., and Okada, M. ((1996). ). Control of calcium oscillations by phosphorylation of metabotropic glutamate receptors. Nature 383, , 89-92.[CrossRef][Medline]

Knighton, D. R., Zheng, J., Ten Eyck, L. F., Ashford, V. A., Xuong, N.-H., Taylor, S. S., and Sowadski, J. M. ((1991). ). Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science 253, , 407-414.[Abstract/Free Full Text]

Kramer, J. M., French, R. P., Park, E.-C., and Johnson, J. J. ((1990). ). The Caenorhabditis elegans rol-6 gene, which interacts with the sqt-1 collagen gene to determine organismal morphology, encodes a collagen. Mol. Cell. Biol. 10, , 2081-2089.[Abstract/Free Full Text]

Krause, M., and Hirsh, D. ((1987). ). A trans-spliced leader sequence on actin mRNA in C. elegans. Cell 49, , 753-761.[CrossRef][Medline]

Liu, D.W.C., and Thomas, J. H. ((1994). ). Regulation of a periodic motor program in C. elegans. J. Neurosci. 14, , 1953-1962.[Abstract]

Majercak, J., Kalderon, D., and Edery, I. ((1997). ). Drosophila melanogaster deficient in protein kinase A manifests behavior-specific arrhythmata but normal clock function. Mol. Cell. Biol. 17, , 5915-5922.[Abstract]

McIntire, S. L., Jorgensen, E., Kaplan, J., and Horvitz, H. R. ((1993). ). The GABAergic nervous system of Caenorhabditis elegans. Nature 364, , 337-341.[CrossRef][Medline]

Mello, C. C., Kramer, J. M., Stinchcomb, D., and Ambros, V. ((1991). ). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, , 3959-3970.[Medline]

Mitsopoulos, C., Zihni, C., Garg, R., Ridley, A. J., and Morris, J.D.H. ((2003). ). The prostate-derived sterile 20-like kinase (PSK) regulates microtubule organization and stability. J. Biol. Chem. 278, , 18085-18091.[Abstract/Free Full Text]

Plowman, G. D., Sudarsanam, S., Bingham, J., Whyte, D., and Hunter, T. ((1999). ). The protein kinases of Caenorhabditis elegans: a model for signal transduction in multicellular organisms. Proc. Natl. Acad. Sci. USA 96, , 13603-13610.[Abstract/Free Full Text]

Pombo, C. M., Bonventre, J. V., Molnar, A., Kyriakis, J., and Force, T. ((1996). ). Activation of a human Ste20-like kinase by oxidant stress defines a novel stress response pathway. EMBO J. 15, , 4537-4546.[Medline]

Prasad, B. C., Ye, B., Zackhary, R., Schrader, K., Seydoux, G., and Reed, R. R. ((1998). ). unc-3, a gene required for axonal guidance in Caenorhabditis elegans, encodes a member of the O/E family of transcription factors. Development 125, , 1561-1568.[Abstract]

Riddle, D. L. and Albert, P. S. ((1997). ). Genetic and environmental regulation of dauer larva development. In: C. elegans II, ed. D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R. Priess, Cold Spring Harbor, NY: Cold Spring Harbor Press, 739-768.

Schweitzer, B., and Philippsen, P. ((1991). ). CDC15, an essential cell cycle gene in Saccharomyces cerevisiae, encodes a protein kinase domain. Yeast 7, , 265-273.[CrossRef][Medline]

Sells, M. A., and Chernoff, J. ((1997). ). Emerging from the Pak: the p21-activated protein kinase family. Trends Cell Biol. 7, , 162-167.

Stanewsky, R. ((2003). ). Genetic analysis of circadian system in Drosophila melanogaster and mammals. J. Neurobiol. 54, , 111-147.[CrossRef][Medline]

Starich, T. A., Herman, R. K., Kari, C. K., Yeh, W. H., Schackwitz, W. S., Schuyler, M. W., Collet, J., Thomas, J. H., and Riddle, D. L. ((1995). ). Mutations affecting the chemosensory neurons of Caenorhabditis elegans. Genetics 139, , 171-188.[Abstract]

Take-uchi, M., Kawakami, M., Ishihara, T., Amano, T., Kondo, K., and Katsura, I. ((1998). ). An ion channel of the degenerin/epithelial sodium channel superfamily controls the defecation rhythm in C. elegans. Proc. Natl. Acad. Sci. USA 95, , 11775-11780.[Abstract/Free Full Text]

Thomas, J. H. ((1990). ). Genetic analysis of defecation in Caenorhabditis elegans. Genetics 124, , 855-872.[Abstract]

Thomas, J. H., Birnby, D. A., and Vowels, J. J. ((1993). ). Evidence for parallel processing of sensory information controlling dauer formation in Caenorhabditis elegans. Genetics 134, , 1105-1117.[Abstract]

Wang, Y., Xu, H.-P., Riggs, M., Rodgers, L., and Wigler, M. ((1991). ). byr2, a Schizosaccharomyces pombe gene encoding a protein kinase capable of partial suppression of the ras1 mutant phenotype. Mol. Cell. Biol. 11, , 3554-3563.[Abstract/Free Full Text]

Waring, J. D., Haq, R., Tamai, K., Sabourin, L. A., Ikeda, J. E., and Korneluk, R. G. ((1996). ). Investigation of myotonic dystrophy kinase isoform translocation and membrane association. J. Biol. Chem. 271, , 15187-15193.[Abstract/Free Full Text]

Weitzman, E. D. ((1981). ). Sleep and its disorders. Annu. Rev. Neurosci. 4, , 381-417.[CrossRef][Medline]

Williams, B. D., Schrank, B., Huynh, C., Shownkeen, R., and Waterston, R. H. ((1992). ). A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131, , 609-624.[Abstract]

Young, M. W., and Kay, S. A. ((2001). ). Time zones: a comparative genetics of circadian clocks. Nat. Rev. Genet. 2, , 702-715.[CrossRef][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E04-04-0273v1
16/3/1355    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Take-uchi, M.
Right arrow Articles by Katsura, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Take-uchi, M.
Right arrow Articles by Katsura, I.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2005 by The American Society for Cell Biology. Terms of copyright protection, warranties, and disclaimers.