![]() |
|
|
Vol. 16, Issue 4, 1629-1639, April 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





* Organelle Signaling Laboratory, Department of Surgery, McGill University, Montreal, Quebec, Canada H3A 1A1;
Montreal Proteomics Network, McGill University, Montreal, Quebec, Canada H3A 1A1;
HyperOmics Farma, Inc., Montreal, Quebec, Canada H9H 4K8;
Biology Department, McGill University, Montreal, Quebec, Canada H3A 1B1;
|| Center for Cancer Systems Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, and Department of Genetics, Harvard Medical School, Boston, MA 02115; and
# Perkin-Elmer-Biosignal, Montreal, Quebec, Canada H3J 1R4
Submitted August 31, 2004;
Accepted January 11, 2005
Monitoring Editor: Martin A. Schwartz
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The prototype members of the Rho GTPase family, namely RhoA, Rac1, and Cdc42, have been extensively studied for their role in actin cytoskeleton remodeling (Ridley, 2001
). Indeed, in mouse fibroblasts, the activation of RhoA, Rac1, and Cdc42 promote formation of stress fibers, lamellipodia, and filopodia, respectively (Hall, 1998
), resulting in the alteration of cell shape and movement. Consequently, Rho GTPases have been implicated in a wide range of biological functions requiring remodeling of actin structures such as cytokinesis, cell polarization, adhesion and migration, axon guidance, host-pathogen interactions, and intracellular membrane trafficking. Independently of their role on cell morphogenesis, Rho GTPases have also been shown to regulate cell cycle progression and gene expression (Etienne-Manneville and Hall, 2002
).
Rho GTPases are highly conserved throughout evolution at both structural and functional levels (Wherlock and Mellor, 2002
). In C. elegans, the Rho family of proteins can be subdivided in three sequence-related groups, namely Rac1-related proteins (CED-10, RAC-2, MIG-2), Cdc42-related proteins (CDC-42), and RhoA-related proteins (RHO-1). Similar to their respective mammalian orthologues, CDC-42 plays a major role in cell polarization (Gotta et al., 2001
; Kay and Hunter, 2001
), whereas CED-10 together with RAC-2 and MIG-2 control axon guidance and cell corpse phagocytosis (Zipkin et al., 1997
; Reddien and Horvitz, 2000
; Lundquist et al., 2001
; Wu et al., 2002
) and CED-10, MIG-2, and RHO-1 participate in cell migration events (Zipkin et al., 1997
; Reddien and Horvitz, 2000
; Lundquist et al., 2001
; Spencer et al., 2001
; Wu et al., 2002
).
The sequence of complete genomes allowed the identification of novel Rho GTPase domain encoding genes such as RhoBTBs and Miros (Rivero et al., 2001
; Fransson et al., 2003
). Similarly, we identified, in the C. elegans genome, a gene potentially encoding a novel Rho GTPase, and related to CDC-42. We report here the functional characterization of this protein, named CDC-42related protein-1 (CRP-1). We show that CRP-1 is an atypical small GTP-binding protein unable to hydrolyze GTP and to promote actin cytoskeleton remodeling when expressed in mouse fibroblasts. Consistent with the exclusive epithelial expression pattern of CRP-1 and its localization at the trans-Golgi network and recycling endosomes, phenotypic characterization of crp-1 mutant and crp-1(RNAi) animals revealed a role for CRP-1 in membrane trafficking in epithelial cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Constructs
Gateway compatible open reading frames (ORFs) coding for CRP-1 (Y32F6B.3), CDC-42 (R07G3.1), and RGA-1 (Rho GTPase-activating protein 1, W02B12.8) in pDONR201 vectors were retrieved from the C. elegans ORFeome collection version 1.1 (Reboul et al., 2003
). Endogenous crp-1 and cdc-42 STOP codons, converted to sens codon in the ORFeome clones (pDONRcrp-1(F-), pDONRcdc-42(F-)) were restored in pDONRcrp-1 and pDONRcdc-42 by PCR using specific primers (5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGAGAACAAATTGAAATTGGTAG/5'-GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAAGTATTGTACAACAAGGATTTGG and 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCAGACGATCAAGTGCG/5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGCTAGAGAATATTGCACTTCTTCTTCTT, respectively) and pDONRcrp-1(F-), pDONRcdc-42(F-) as templates. Resulting PCR products were inserted in pDONR201 by BP recombination. CRP-1(GAV) mutant was generated by PCR according to the overlap extension method (Horton et al., 1989
) using pDONRcrp-1 as template, mutagenic overlapping oligonucleotides (5'-GGATGGCGCCGTCGGTAAAACAAGTCTTC/5'-TGTTTTACCGACGGCGCCATCCCCCACGACTACC), and pDONR-specific oligonucleotides (5'-GATCTCGGGCCCCAAATAAT/5'-GGCTCATAACACCCCTTGTA). The resulting PCR products as well as the ORFs were transferred from pDON-Rcrp-1(F-), pDONRCdc-42(F-), pDONRcrp-1, and pDONRcdc-42 by LR recombination in Gateway compatible pGex2TK and pRK5Myc destination vectors. RGA-1 GAP domain was amplified from the pDONRW02B12.8 ORFeome clone using 5'CGGGATCCGCGGAAACACCACCAGC and 5'CCGGAATTCCTCAATGATCAAATACTG as specific primers. The resulting PCR fragment was then digested by BamHI and EcoRI restriction enzymes and ligated in pTrcHisA (Invitrogen). DNA constructs generated by PCR were systematically sequence verified.
Cell Culture, Transfection, and Immunostaining
NIH3T3 cells were cultured in DMEM supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) and antibiotics and maintained at an atmosphere of 5% CO2. For transfection, cells were plated on ionized glass coverslips and transfected using Lipofectamine (Invitrogen) following the manufacturer's instructions. Forty-eight hours after transfection, cells were fixed in 3.7% formaldehyde and processed for indirect immunofluorescence as described previously (Jenna et al., 2002
). C. elegans animal were fixed and stained as described by Finney and Ruvkun (1990
).
Expression and Purification of Recombinant Proteins
Recombinant CRP-1, CRP-1(GAV), and CDC-42 were produced in E. coli (DH5
) as GST fusion proteins and purified on glutathione-Sepharose beads as described previously (Self and Hall, 1995
). GST and GST-fusion proteins were eluted from the beads using 20 mM reduced glutathione in 20 mM Tris, pH 7.5, 25 mM NaCl, 0.1 mM dithiothreitol (DTT). RGA-1 GAP domain was produced in DH5
as a hexahistidine (His6)-fusion protein and purified on Ni-NTA Agarose beads (QIAGEN, Chatsworth, CA) according to the manufacturer's instructions. His6-tagged proteins were eluted from nickel chelate agarose beads using 300 mM imidazole in 20 mM Tris, pH 7.5, and 0.1 mM DTT. Protein concentration was determined using Bradford reagent (Bio-Rad, Richmond, CA) and the quality of purified proteins was assessed by analysis of Coomassie Blue-stained SDS-polyacrylamide gels.
In Vitro GTPase Enzymatic Assays
These assays were similar to previously published procedures (Hussain et al., 2001
; Jenna et al., 2002
) except that they were adapted to a 96-well format. For nucleotide-exchange activity, 0.2 µM purified, GDP-loaded CRP-1, CRP-1(GAV), and CDC-42 were incubated with 5 µM GTP
S and 0.167 µM of GTP
[35S] (0.25 mCi.mmol1) in assay buffer (10 mM Tris, pH 7.5, 50 mM NaCl, 500 ng/µl bovine serum albumin [BSA], 2.5 mM MgCl2). After 0-, 5-, 10-, 15-, 20-, and 25-min incubation at 37°C, the reaction mix containing 0.1 pmol of GTPase was filtered through nitrocellulose membrane in a 96-well manifold (Bio-Rad) and washed extensively. Radioactivity trapped on the filters was then quantified using a Cyclone phosphorimager (Packard, Meriden, CT). For GTP hydrolysis and dissociation measures, the concentration of active GTPase, corresponding to the amount of GTPase able to bind to GTP, was estimated as described previously (Lamarche-Vane and Hall, 1998
). One hundred picomolar active GTPase was loaded with either GTP
[32P] or GTP
[35S] and incubated in the presence of 1 mM GTP and 2 mM MgCl2 for up to 15 min at either 37°C or at 25°C in the presence of 1, 100, or 1000 nM of RGA-1 GAP-His6 domain. At the indicated time, one-sixth of the reaction mix was filtered and washed, and the radioactivity trapped on the filter quantified as described above.
Strains and Genetic Analyses
C. elegans animals were maintained at 23°C under standard conditions (Brenner, 1974
). Bristol N2 was used as the reference strain. The allele crp-1(ok685) (also named called Y32F6B.3(ok685)V) was provided by the C. elegans Knockout Consortium. This mutant was identified after ultraviolet and trimethyl-psoralen mutagenesis by nested PCR using primers located 2.1-kbp apart within crp-1. This allele was outcrossed three times with N2. To position deletion breakpoints in crp-1(ok685) mutant, genomic DNA (gDNA) was purified from crp-1(ok685) animal using DNAzol reagent (Invitrogen) according to the manufacturer's instructions and cDNA was synthesized using thermoscript RT-PCR system (Invitrogen) after purification of total crp-1(ok685) RNA using RNAzol (Invitrogen). crp-1 coding sequence was then PCR amplified from both crp-1(ok685) gDNA and cDNA using specific primers (5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGAGAACAAATTGAAATTGGTAG/5'-GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAAGTATTGTACAACAAGGATTTGG), inserted into pDONR201 by BP recombination and sequenced.
Generation of CRP-1 Transgenic Animals
The translational GFP fusion of CRP-1 was constructed by amplifying a 4300-base pair DNA fragment from N2 genomic DNA using specific primers (5'-GCTCTAGAGCATGTCACCTTCATTCAATACGG and 5'-CGGGGTACCGTACAACAAGGATTTGGGGTT). The resulting DNA fragment, starting 2264 base pairs upstream of crp-1 ATG initiation codon and ending one base pair upstream of its stop codon was digested with XbaI and KpnI and ligated in pPD117.01 upstream of the GFP(S65C) reporter sequence. The resulting pPD117.01crp-1::GFP construct was then coinjected into young adult N2 hermaphrodites at 40 ng/µl together with 160 ng/µl pRF4 vector containing the rol-6(su1006) marker as described elsewhere (Mello et al., 1991
). Five independent rol-6(su1006) lines were examined by fluorescence microscopy. crp-1(ok685) Ex[che-14::GFP rol-6(su1006)] and crp-1(ok685) Ex[crp-1::GFP rol6(su1006)] animals were isolated by mating Ex[che-14::GFP rol-6(su1006)] (kindly provided by Dr Michel Labouesse, Institut deGénétique et deBiologie Moléculaire, Illkirch, France) and Ex[crp-1::GFP rol-6(su1006)] L4 hermaphrodites with crp-1(ok685) males. F2 Rol animals homozygous for crp-1(ok685) were identified by nested PCR using crp-1specific primers (5'-GAAGACAACGCCTCTGGAAG/5'-AGGAAAATGGGTGAGCAATG).
RNA Interference
CRP-1 coding sequence was inserted in the Gateway-compatible pL4440 vector and transformed in HT115(DE3) bacteria. Isolated transformant clones were grown in Luria-Bertani (LB) medium supplemented by 100 µg/ml ampicillin for 8 h at 37°C and plated on NGM plates containing 1 mM IPTG and 100 µg/ml ampicillin. Plates were incubated 16 h at room temperature and inoculated either with Ex[che-14::GFP rol-6(su1006)] or Ex[crp-1::GFP rol-6(su1006)] embryos prepared using the hypochlorite method. Worms were then allowed to develop to L4 stage at 18°C. Rol L4 animals were then transferred to fresh ampicillin-IPTG plates seeded with pL4440Crp-1 HT1115(DE3) clones and allowed to lay eggs for 2 days, after which the progeny were allowed to develop until adulthood. Efficiency of crp-1(RNAi) gene silencing was controlled by direct observation of CRP-1::GFP fusion protein in crp-1(RNAi) Ex[crp-1::GFP rol-6(su1006)].
Che-14::GFP and C6-NBD-ceramide Trafficking, Image Capture, and Analysis
To quantify the percentage of C6-NBD-ceramide at the apical surface of intestinal cells, C. elegans animal were incubated 2 h at room temperature in M9 containing 10 µM of C6-NBD-ceramide/bovine serum albumin complex prepared as described previously (Martin and Pagano, 1994
). They were then washed three times with M9 and incubated for 2 h in M9. For morphological observations, living worms were mounted on agarose pads in M9 buffer containing 1 mM Levamisol (Sigma). Fluorescence emission from transfected cells and living worms was observed using AxioVert-135, or Axiovert-200, or confocal microscopes (Zeiss, Thornwood, NY) equipped with Zeiss 63x 1.4 oil immersion or 40x 0.75 objectives. Images were recorded using a Retiga 1300 or axiocam MRM digital cameras (QIMAGING, Zeiss) and analyzed using Northern Eclipse V6.0 (Empix Imaging, Mississauga, Ontario, Canada), LSM or AxioVision (Zeiss) softwares. To quantify the percentage of CHE-14::GFP and C6-NBD-ceramide at the apical plasma membrane of epithelia in C. elegans, we used the MetaMorph software (Universal Imaging, West Chester, PA). We isolated a region of interest in digitalized images and fluorescence intensity in this area was expressed as a percentage of the total cellular fluorescence.
| RESULTS |
|---|
|
|
|---|
|
CRP-1 Is Not Essential for C. elegans Embryonic Development and Survival
To investigate the biological function(s) of CRP-1, we used a reverse genetic approach leading to loss of crp-1 function(s). A crp-1 deletion (crp-1(ok685)) was obtained from the C. elegans Knockout Consortium. PCR amplification and sequencing of both genomic (gDNA) and complementary (cDNA) DNAs coding for the mutant CRP-1 revealed that the ok685 mutation consisted of a 658-base pair deletion in gDNA and 129 base pairs in cDNA (Figure 2B) that caused a frame shift in exon 3 and generated a premature STOP codon 81 nucleotides downstream of the ATG in the cDNA sequence (Figure 2A). This mutation resulted in the expression of a truncated CRP-1 protein containing only 28 amino acids, including 9 missense residues. Given that this deletion led to the removal of all the protein domains required for GTPase function, crp-1(ok685) was therefore considered as a null allele.
|
The anatomical observation of crp-1(ok685) embryos, larvae, and adults using DIC microscopy did not reveal any obvious morphological abnormality. As previously reported for animals subjected to crp-1(RNAi) (Jantsch-Plunger et al., 2000
; Kamath and Ahringer, 2003
), neither embryonic nor larval lethality was observed upon crp-1 gene silencing and animals presented normal life span and egg laying efficiency (unpublished data). Unlike other Rho GTPases, for which loss of function mutations resulted in obvious morphological and/or behavioral phenotypes because of their critical function in cell and organ morphogenesis, the apparent wild-type phenotype of crp-1(ok685) animals suggested that crp-1 could be either functionally redundant with other proteins or implicated in subtle cellular mechanisms not observable using standard DIC microscopy.
Therefore, to assess the biological function(s) of CRP-1 in C. elegans, we further investigated the characteristics of CRP-1 recombinant protein through the integration of in vitro, ex vivo, and in vivo data.
CRP-1 Is an Enzymatically Atypical Small G Protein
The ORFs encoding CRP-1 and CDC-42 were obtained from the C. elegans ORFeome (Reboul et al., 2003
) and transferred to prokaryotic and eukaryotic expression vectors. CRP-1 and CDC-42 GST-fusion proteins were expressed in E. coli and purified as described in Materials and Methods. CRP-1 and CDC-42 nucleotide-exchange and GTP hydrolysis activities were measured in vitro using 96-well adapted filtration assays. Nucleotide-exchange activities were measured by following the time-dependent binding of GTP
[35S] to GDP-preloaded GTPases, whereas GTP hydrolysis activities were measured by following the time-dependent hydrolysis of the 32
phosphate by the GTPases preloaded with GTP-
[32P] (Hussain et al., 2001
; Jenna et al., 2002
). In comparison to CDC-42, CRP-1 showed a very weak nucleotide-exchange activity as well as a reduced dissociation of radioisotope from GTP
[32P]loaded GTPase over time (Figure 3, A and B). To investigate whether the radioisotope release resulted from GTP
[32P] hydrolysis or from nucleotide dissociation from the protein, similar assays were carried out using the nonhydrolysable GTP
[35S]. This revealed that whereas GTP
[35S] formed a very stable complex with CDC-42, it dissociated rapidly from CRP-1 (Figure 3C). Hence, the unstable complex between GTP
[32P] and CRP-1 is caused by GTP dissociation from the protein rather than elevated hydrolysis activity.
|
GTPase-activating proteins (GAPs) are known to regulate Rho GTPases by enhancing their intrinsic GTP hydrolysis activity (Jenna and Lamarche-Vane, 2003
). To test whether incubation of CRP-1 with a GAP protein would enhance an existing but undetectable GTP hydrolysis activity, we retrieved the cDNA encoding RGA-1 from the C. elegans ORFeome. This protein is the ortholog of the Cdc42- and RhoA-specific mammalian GAP, p50-RhoGAP. We amplified RGA-1 GAP domain and generated a RGA1-GAP domain fused to His6-tag. The percentage of GTP
[32P] bound on CDC-42 or CRP-1 after a 5-min incubation at 25°C in the presence of increasing concentration of RGA-1 GAP domain was then measured using the filtration assay described above. We demonstrated that, as expected, RGA-1 increased CDC-42 hydrolysis activity (Figure 3D), but no obvious effect was observed on CRP-1 (Figure 3D).
The fact that CRP-1 did not show any significant GTP hydrolysis activity was consistent with its nonconventional P-loop sequence. Indeed, the CDC-42 highly conserved glycine-12 was replaced by a threonine residue in CRP-1 sequence (Figure 1C). Interestingly, conservation of this residue has been shown to be critical for GTPase-dependent GTP hydrolysis activity of all members of the Ras superfamily of small G protein (Sprang, 1997
). To investigate whether the restoration of a CDC-42-like P-loop could partially reverse CRP-1 deficiency, the TYT residues (1214) (Figure 1C, circled) in CRP-1 amino acid sequence were replaced by GAV (CDC-42 sequence). The enzymatic characterization of the resulting CRP-1(GAV) mutant revealed a nucleotide-exchange activity (Figure 3A) and instability of GTP
[35S]/GTPase complex (Figure 3C) similar to those observed for CRP-1. However, as predicted, the hydrolysis activity of CRP-1(GAV) was significantly increased compared with CRP-1 (Figure 3B). These data indicate that CRP-1 is an atypical small G protein, which displays a very low affinity for GTP and is deficient for GTP hydrolysis in vitro.
CRP-1 Does Not Reorganize the Actin Cytoskeleton in NIH3T3 Cells
To investigate whether CRP-1, like most Rho GTPases, could be targeted to cellular membranes and regulate actin cytoskeleton remodeling, nonprenylated mutants of CRP-1 and CDC-42 were generated (CRP-1(F-) and CDC-42(F-), respectively) by fusion of nine C-terminal extraamino-acids residues. N-terminal Myc-tagged fusions of CDC-42, CDC-42(F-), CRP-1, CRP-1(F-), and CRP-1(GAV) were then expressed in NIH3T3 cells. Twenty-four hours after transfection, cells were fixed and stained for filamentous actin using TRITC-conjugated phalloidin. CDC-42 and CRP-1 were detected by indirect immunofluorescence using anti-Myc antibodies. Consistent with the data obtained for its mammalian ortholog, CDC-42 expressed in mouse fibroblasts is properly targeted to cellular membranes and induces robust filopodia formation (Gibson and Wilson-Delfosse, 2001
), whereas a nonfarnesylated CDC-42 mutant, CDC-42(F-), is not (Figure 4). In contrast, neither wild-type CRP-1, nonfarnesylated CRP-1(F-) nor CRP-1(GAV) induced any significant remodeling of the actin cytoskeleton (Figure 4). This indicates that sequence homology between CRP-1 and CDC-42 is not sufficient for CRP-1 to achieve CDC-42 function on actin cytoskeleton remodeling when ectopically expressed in NIH3T3 cells. In addition, these data also suggest that CRP-1 inability to induce formation of actin structures is independent of CRP-1 GTP-hydrolysis deficiency.
|
CRP-1 Localizes in trans-Golgi Network and Recycling Endosomes in NIH3T3 Cells
When expressed in NIH3T3 cells CRP-1 localized mainly in perinuclear punctuated structures. This subcellular localization was independent of CRP-1 GTP hydrolysis activity because identical staining was observed with CRP-1(GAV) (Figure 4). However, it was dependent on CRP-1 prenylation because cellular localization of CRP-1(F-) mutant was mainly cytosolic (Figure 4). In addition, cell fractionation studies carried out with CRP-1expressing NIH3T3 cells revealed that CRP-1 partitioned with cellular membranes (unpublished data). This indicates that CRP-1 is likely to be anchored to intracellular membrane compartments through its prenyl group.
The subcellular localization of Myc-tagged CRP-1 was then assessed either by coexpression with GFP-tagged compartment specific markers or by staining CRP-1expressing cells using compartment marker specific antibodies. Colocalization of CRP-1 with these markers was analyzed using confocal microscopy (Figure 5). CRP-1 did not significantly colocalize with BiP (Figure 5, A, F, and K), ERGICp58 (Figure 5, B, G, and L), or
-mannosidase II (Figure 5, C, H, and M) used, respectively, as markers for the endoplasmic reticulum, the ER-Golgi intermediate compartment or the Golgi apparatus. However, a subtle perinuclear colocalization of CRP-1 was observed with clathrin (Figure 5, D, I, and N), as well as a very clear colocalization with transferrin receptors (Figure 5, E, J, and O). These data indicate that CRP-1 most likely localizes to transferrin receptorenriched recycling endosomes and, to a lesser extent, to the trans-Golgi network (TGN) when expressed in NIH3T3 cells.
|
CRP-1 Is Expressed in a Subset of Epithelial-like Cells in C. elegans
The spatio-temporal regulation of CRP-1 expression in C. elegans was then investigated by generating transgenic animals that expressed a CRP-1::GFP translational fusion under the control of the endogenous crp-1 promoter. CRP-1 expression pattern was observed by epifluorescence microscopy on living animals. CRP-1::GFP fusion protein was first expressed in pharyngeal cells at the early comma stage of embryogenesis (Figure 6A). At the twofold stage, CRP-1 was also detected in the rectum (unpublished data) and later, at the threefold stage throughout the entire digestive tract (Figure 6B). After hatching, CRP-1 expression was extended to the head and tail support cells and to the excretory cell (Figure 6C). This expression pattern was maintained throughout larval stages (unpublished data) except in dauer larvae where CRP-1 expression was restricted to the excretory system (Figure 6D). In young adult, CRP-1::GFP expression decreased in the pharynx and appeared in the vulval epithelium (Figure 6H). CRP-1 expression in intestinal and rectal valve (Figure 6, C and J), in intestinal cells (Figure 6J), in head and tail support cells (Figure 6, EG), in excretory cell (Figure 6I), and in vulval and rectal epithelia (Figure 6, H, J, and K) was then maintained throughout adulthood in both males and hermaphrodites.
|
These data demonstrate that crp-1 expression is tightly regulated during C. elegans development both spatially and temporally. Interestingly, CRP-1 was expressed exclusively in a subset of epithelial cells and myoepithelial cells (pharyngal muscles), suggesting that this protein may have some epithelial cell specific function(s). In addition, CRP-1 expression was detectable after epithelial morphogenesis, except in the pharynx muscle where its expression was detectable at very early stage of pharynx development.
CRP-1 Regulates the Apical Trafficking of CHE-14 and C6-NBD-ceramide in a Subset of Epithelial Cells
The localization of CRP-1 in TGN and recycling endosomes as observed in NIH3T3 cells as well as its restricted expression in a subset of epithelial-like cells in animal suggested that CRP-1 may play a role in polarized membrane trafficking events. To address this possibility, we analyzed the effect of the crp-1(ok685) deletion on the trafficking of two transmembrane proteins, CHE-14 and myotactin shown to be both expressed in a subset of epithelial cells in C. elegans and to be respectively targeted to the apical and the basolateral membranes (Hresko et al., 1999
; Michaux et al., 2000
). Although some differences in total fluorescence intensity, due to variability in staining procedures, were detected from one animal to another, no significant difference in the basolateral distribution of myotactin in pharyngeal cells was observed in crp-1(ok685) when compared with wild-type (WT) animals (Figure 7, E and F). In contrast, the distribution of CHE-14::GFP was altered in vulval and rectal epithelia in crp-1(ok685) animals as it distributed mainly in intracellular punctuated structures (Figure 7, AD). The efficiency of CHE-14 trafficking was measured by calculating the percentage of CHE-14::GFP detected at the apical membrane in vulval and rectal epithelia for 613 crp-1(ok685) and wild-type animals (Figure 7G). CHE-14 trafficking appeared to be altered significantly in crp-1(ok685) animals in both vulval (p = 5.48E-04) and rectal (p = 9.7E-05) epithelia when compared with wild-type animals. To confirm that the trafficking alteration observed in crp-1(ok685) animals was due to the disruption of CRP-1 expression, we subjected CHE-14::GFPexpressing wild-type animals to crp-1(RNAi) using a feeding procedure. As described above, the alteration of CHE-14 trafficking was also significantly observed in both vulval (p = 0.0050) and rectal (p = 0.0379) epithelia of crp-1(RNAi) animals when compared with wild-type but demonstrated a reduced penetrance when compared with crp-1(ok685), probably due to residual CRP-1 activity after RNAi.
|
We also investigated the subcellular distribution of cytosolic apical markers of intestinal cells, namely the intermediate filament IFB-2 and the adherent junction component AJM-1. IFB-2 and AJM-1 distribution was assessed by immunostaining on fixed animals. No obvious difference in IFB-2 and AJM-1 distribution was observed in crp-1(ok685) when compared with wild-type animals (Figure 8, AD).
|
To investigate whether the role of CRP-1 in the trafficking of apical membrane proteins may also affect lipid distribution, we assessed the localization exogenous C6-NBD-ceramide, a fluorescently labeled sphingolipid, in intestinal cells. The cellular distribution of C6-NBD-ceramide was observed by direct fluorescence microscopy after ingestion of exogenous C6-NBD-ceramide/bovine serum albumin complex by young adults for 2 h, followed by a 2-h washing with M9 buffer. The distribution of exogenous C6-NBD-ceramide was then studied in the intestinal epithelial cells of wild-type and crp-1(ok685) animals. In mutant animals, a significant alteration (p = 3.40E-07) of the distribution of C6-NBD-ceramide and/or its potential byproducts was observed, as reflected by the accumulation the fluorescent probe(s) at the apical membrane of intestinal cells (Figure 8, EG).
Together these data indicate that CRP-1 expression is required for an efficient apical trafficking of CHE-14::GFP and uptake/trafficking of C6-NBD-ceramide (and/or its downstream by-products) in a subset of epithelial cells. In addition, the alteration of CRP-1 expression did not appear to be detrimental for myotactin basolateral trafficking in pharyngeal cells and for apical targeting of IFB-2 and AJM-1 in intestine, thus indicating that CRP-1 function would be restricted to apical membrane trafficking events.
| DISCUSSION |
|---|
|
|
|---|
In this study, we have characterized a novel C. elegans CDC-42-related GTP-binding protein CRP-1. This protein shows atypical enzymatic characteristics, is exclusively expressed in terminally polarized epithelial-like cells in C. elegans, and localizes to the trans-Golgi network (TGN) and recycling endosomes when ectopically expressed in mouse fibroblasts. The integration of these functional characteristics allowed us to hypothesize a function for CRP-1 in polarized membrane trafficking in epithelial cells. Consistent with this hypothesis, crp-1 null mutant animals revealed an altered apical trafficking of CHE-14 in vulval and rectal epithelial cells and of C6-NBD-ceramide in intestinal cells while displaying an efficient basolateral trafficking of myotactin in the pharynx and an efficient apical targeting of soluble IFB-2 and AJM-1 in intestinal cells. Our data suggest therefore a function for CRP-1 in apical membrane trafficking in a subset of epithelial cells. However, we cannot yet exclude an epithelial cell-typespecific role of CRP-1 which would lead to the regulation of CHE-14 trafficking in vulval and rectal cells and the nonalteration of myotactin trafficking in pharyngeal cells.
CRP-1 Is Implicated in Apical Membrane Trafficking in Epithelial Cells
Polarized membrane trafficking in epithelial cells consists of either a direct sorting of biosynthetic proteins and sphingolipids to the apical or basolateral membranes, or an indirect routing of membrane components by endocytic/recycling or transcytic processes (Van IJzendoorn and Hoekstra, 1998
; Ait Slimane and Hoekstra, 2002
; Maier and Hoekstra, 2003
; Mostov et al., 2003
). These sorting routes are organized, respectively, from the TGN and the subapical compartment (SAC), the epithelial equivalent of recycling endosomes (Van IJzendoorn et al., 2000
; Ait Slimane and Hoekstra, 2002
). CRP-1 localization to the TGN and recycling endosomes in fibroblasts as well as its exclusive expression in C. elegans epithelial and myoepithelial cells strongly suggested the involvement of this protein in polarized membrane trafficking. This hypothesis was confirmed by gene deletion and/or silencing of crp-1, which resulted in the alteration of CHE-14 trafficking and C6-NBD-ceramides uptake and/or trafficking at the apical membrane of vulval/rectal epithelial and intestinal cells, respectively. Interestingly, the trafficking of myotactin, a basolateral transmembrane protein, was not altered in crp-1(ok685) mutant, indicating that CRP-1 may be specific of apical membrane trafficking. In addition, the proper apical targeting of IFB-2 and AJM-1 in crp-1(ok685) intestinal cells suggests that CRP-1 function would be restricted to integral membrane components.
The role of Rho GTPases in membrane trafficking is thought to be mainly mediated through actin cytoskeleton remodeling (Symons and Rusk, 2003
). However, some examples have shown that Rho GTPases could also control membrane trafficking through actin-independent manners by modulating phosphatidylinositol lipid metabolism (Ren and Schwartz, 1998
; Malecz et al., 2000
) or regulating clathrin-coat assembly (Yang et al., 2001
; Symons and Rusk, 2003
). Because ectopic expression of CRP-1 in mouse fibroblasts did not induce any significant remodeling of the filamentous actin structures, we postulated that CRP-1 may regulate membrane trafficking events in such manners. In addition, CRP-1 inability to reorganize the actin cytoskeleton in fibroblast, suggested that it may not play a critical role in cell morphogenesis. This hypothesis is consistent with the normal anatomy of crp-1(ok685) animals as observed by DIC microscopy and unaltered immunolocalization of adherent junction (AJM-1) and subapical cytoskeleton markers (IFB-2) in epithelial cells.
Potential Role of CRP-1 in the Maintenance of Epithelial Functions in Postdevelopmental Stages
Sphingolipids have been clearly established to play a major role in the control of apical trafficking and transcytosis of proteins in mammalian polarized epithelial cells (Ait Slimane and Hoekstra, 2002
). In addition, it has been clearly established that small GTP-binding proteins regulated the trafficking of these lipids (Choudhury et al., 2002
). Although such a function has not yet been confirmed in C. elegans, we believe that in crp-1(ok685) animals, C6-NBD-ceramides may not be properly up-taken or may not follow their normal trafficking routes. In addition, neuronal abnormalities caused by mutations in human and C. elegans homologues of the Niemann-pick type C1 disease protein, a protein whose function is critical for the intracellular distribution of cholesterol and sphingolipids (Li et al., 2004
), indicate that those trafficking events may be conserved from worm to mammals. The potential consequences of an alteration of the apical uptake and/or trafficking of sphingolipids and CHE-14, which regulates the exocytosis of lipid modified proteins at the apical surface of C. elegans epithelial cells (Michaux et al., 2000
), would suggest broadened consequences of crp-1 knockout than those observed in our study. Che-14 loss of function mutants and mutant altering cholesterol and presumably sphingolipids trafficking such as the C. elegans Niemann-pick type C1 disease proteins, NCR-1 and NCR-2 and the gp330/megalin-related proteins, LRP-1, show obvious morphological phenotypes such as protruding vulva (Puv) or rectum and excretory system malformation (Yochem et al., 1999
; Michaux et al., 2000
; Li et al., 2004
). In contrast, crp-1(ok685) mutants did not display any visible morphological differences when compared with wild-type animals. This observation suggests that the alteration of CHE-14 apical trafficking and sphingolipids uptake and/or trafficking induced by crp-1 deletion did not result in any significant modification of CHE-14 function and membrane composition at critical development stages. This hypothesis correlates well with the occurrence of CRP-1 expression in vulval, rectal, and intestinal epithelial cells after epithelium morphogenesis. The integration of CRP-1 expression patterns and crp-1 null-phenotypes suggests therefore a role for CRP-1 in epithelial function rather than in cell morphogenesis. This model is also supported by CRP-1 expression pattern in dauer larvae. Indeed, at this stage many tissues and organs such as the intestinal track and sensory apparatus have their morphology modified in response to dauer signals, thus resulting in interruption or alteration of their function(s) (Popham and Webster, 1979
; Albert and Riddle, 1983
). Interestingly, from all epithelial cells expressing CRP-1, only the excretory cell maintains its proper morphology and function in dauer larvae (Nelson et al., 1983
) and is shown in our study to continuously express CRP-1::GFP at detectable levels (Figure 6D).
However, the fact that alteration of CRP-1 expression did not result in any obvious anatomical change or life span reduction may indicate that CRP-1 expression is not required for epithelial function in normal culture conditions. We cannot exclude, however, the possibility that crp-1 null animals could display specific phenotypes under stress conditions because of the modification of epithelial membrane protein and lipid composition. This is consistent with the established function of sphingolipids in cellular response to environmental stresses in mammals (Cutler and Mattson, 2001
; Hannun and Obeid, 2002
; Jenkins, 2003
).
In conclusion, our study demonstrates that CRP-1 is a very specialized small G protein involved in membrane trafficking in C. elegans epithelial cells. Its restrictive epithelial expression in C. elegans and subcellular localization together with its unique enzymatic activity and inability to reorganize the actin cytoskeleton in fibroblasts, constitute a large panel of differences to other members of the Rho GTPase family. These functional differences are also consistent with the analysis of the predicted CRP-1 protein structure, which shows as much homology for Rab as for Rho GTPases (unpublished data). CRP-1 may therefore represent a nematode specific evolutional functional link between Rho and Rab GTPases.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
¶ Present address: INSERM, Unité 119, Institut Paoli Calmettes, 13009 Marseille, France. ![]()
Address correspondence to: E. Chevet (eric.chevet{at}mcgill.ca) or S. Jenna (sarah.jenna{at}mcgill.ca).
| REFERENCES |
|---|
|
|
|---|
Albert, P. S., and Riddle, D. L. ((1983). ). Developmental alterations in sensory neuroanatomy of the Caenorhabditis elegans dauer larva. J. Comp. Neurol. 219, , 461481.[CrossRef][Medline]
Brenner, S. ((1974). ). The genetics of Caenorhabditis elegans. Genetics 77, , 7194.
Choudhury, A., Dominguez, M., Puri, V., Sharma, D. K., Narita, K., Wheatley, C. L., Marks, D. L., and Pagano, R. E. ((2002). ). Rab proteins mediate Golgi transport of caveola-internalized glycosphingolipids and correct lipid trafficking in Niemann-Pick C. cells. J. Clin. Invest. 109, , 15411550.[CrossRef][Medline]
Cutler, R. G., and Mattson, M. P. ((2001). ). Sphingomyelin and ceramide as regulators of development and lifespan. Mech. Ageing Dev. 122, , 895908.[CrossRef][Medline]
Etienne-Manneville, S., and Hall, A. ((2002). ). Rho GTPases in cell biology. Nature 420, , 629635.[CrossRef][Medline]
Finney, M., and Ruvkun, G. ((1990). ). The unc-86 gene product couples cell lineage and cell identity in C. elegans. Cell 63, , 895905.[CrossRef][Medline]
Fransson, A., Ruusala, A., and Aspenstrom, P. ((2003). ). Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J. Biol. Chem. 278, , 64956502.
Gibson, R. M., and Wilson-Delfosse, A. L. ((2001). ). RhoGDI-binding-defective mutant of Cdc42Hs targets to membranes and activates filopodia formation but does not cycle with the cytosol of mammalian cells. Biochem. J. 359, , 285294.[CrossRef][Medline]
Gotta, M., Abraham, M. C., and Ahringer, J. ((2001). ). CDC-42 controls early cell polarity and spindle orientation in C. elegans. Curr. Biol. 11, , 482488.[CrossRef][Medline]
Hall, A. ((1998). ). Rho GTPases and the actin cytoskeleton. Science 279, , 509514.
Hannun, Y. A., and Obeid, L. M. ((2002). ). The Ceramide-centric universe of lipid-mediated cell regulation: stress encounters of the lipid kind. J. Biol. Chem. 277, , 2584725850.
Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., and Pease, L. R. ((1989). ). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, , 6168.[CrossRef][Medline]
Hresko, M. C., Schriefer, L. A., Shrimankar, P., and Waterston, R. H. ((1999). ). myotactin, a novel hypodermal protein involved in muscle-cell adhesion in Caenorhabditis elegans. J. Cell Biol. 146, , 659672.
Hussain, N. K. et al. ((2001). ). Endocytic protein intersectin-l regulates actin assembly via Cdc42 and N-WASP. Nat. Cell Biol. 3, , 927932.[CrossRef][Medline]
Jantsch-Plunger, V., Gonczy, P., Romano, A., Schnabel, H., Hamill, D., Schnabel, R., Hyman, A. A., and Glotzer, M. ((2000). ). CYK-4, A Rho family gtpase activating protein (GAP) required for central spindle formation and cytokinesis. J. Cell Biol. 149, , 13911404.
Jenkins, G. M. ((2003). ). The emerging role for sphingolipids in the eukaryotic heat shock response. Cell Mol. Life Sci. 60, , 701710.[CrossRef][Medline]
Jenna, S., Hussain, N. K., Danek, E. I., Triki, I., Wasiak, S., McPherson, P. S., and Lamarche-Vane, N. ((2002). ). The activity of the GTPase-activating protein CdGAP is regulated by the endocytic protein intersectin. J. Biol. Chem. 277, , 63666373.
Jenna, S., and Lamarche-Vane, N. ((2003). ). The superfamily of Rho GTPase-activating proteins. In: Rho GTPases. ed. M. Symons, New York: Kluwer Academic, 6895.
Kamath, R. S., and Ahringer, J. ((2003). ). Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30, , 313321.[CrossRef][Medline]
Kay, A. J., and Hunter, C. P. ((2001). ). CDC-42 regulates PAR protein localization and function to control cellular and embryonic polarity in C. elegans. Curr. Biol. 11, , 474481.[CrossRef][Medline]
Lamarche-Vane, N., and Hall, A. ((1998). ). CdGAP, a novel proline-rich GTPase-activating protein for Cdc42 and Rac. J. Biol. Chem. 273, , 2917229177.
Li, J., Brown, G., Ailion, M., Lee, S., and Thomas, J. H. ((2004). ). NCR-1 and NCR-2, the C. elegans homologs of the human Niemann-Pick type C1 disease protein, function upstream of DAF-9 in the dauer formation pathways. Development 131, , 57415752.
Lundquist, E. A., Reddien, P. W., Hartwieg, E., Horvitz, H. R., and Bargmann, C. I. ((2001). ). Three C. elegans Rac proteins and several alternative Rac regulators control axon guidance, cell migration and apoptotic cell phagocytosis. Development 128, , 44754488.
Maier, O., and Hoekstra, D. ((2003). ). Trans-Golgi network and subapical compartment of HepG2 cells display different properties in sorting and exiting of sphingolipids. J. Biol. Chem. 278, , 164173.
Malecz, N., McCabe, P. C., Spaargaren, C., Qiu, R., Chuang, Y., and Symons, M. ((2000). ). Synaptojanin 2, a novel Rac1 effector that regulates clathrin-mediated endocytosis. Curr. Biol. 10, , 13831386.[CrossRef][Medline]
Martin, O. C., and Pagano, R. E. ((1994). ). Internalization and sorting of a fluorescent analogue of glucosylceramide to the Golgi apparatus of human skin fibroblasts: utilization of endocytic and nonendocytic transport mechanisms. J. Cell Biol. 125, , 769781.
Mello, C. C., Kramer, J. M., Stinchcomb, D., and Ambros, V. ((1991). ). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, , 39593970.[Medline]
Michaux, G., Gansmuller, A., Hindelang, C., and Labouesse, M. ((2000). ). CHE-14, a protein with a sterol-sensing domain, is required for apical sorting in C. elegans ectodermal epithelial cells. Curr. Biol. 10, , 10981107.[CrossRef][Medline]
Mostov, K., Su, T., and ter Beest, M. ((2003). ). Polarized epithelial membrane traffic: conservation and plasticity. Nat. Cell Biol. 5, , 287293.[CrossRef][Medline]
Nelson, F. K., Albert, P. S., and Riddle, D. L. ((1983). ). Fine structure of the Caenorhabditis elegans secretory-excretory system. J. Ultrastruct. Res. 82, , 156171.[CrossRef][Medline]
Popham, J. D., and Webster, J. M. ((1979). ). Aspect of the fine structure of the basal zone of the dauer larva of the nematode Caenorhabditis elegans. Can. J. Zool. 57, , 794800.
Reboul, J. et al. ((2003). ). C. elegans ORFeome version 1.1, experimental verification of the genome annotation and resource for proteome-scale protein expression. Nat. Genet. 34, , 3541.[CrossRef][Medline]
Reddien, P. W., and Horvitz, H. R. ((2000). ). CED-2/CrkII and CED-10/Rac control phagocytosis and cell migration in Caenorhabditis elegans. Nat. Cell Biol. 2, , 131136.[CrossRef][Medline]
Ren, X. D., and Schwartz, M. A. ((1998). ). Regulation of inositol lipid kinases by Rho and Rac. Curr. Opin. Genet. Dev. 8, , 6367.[CrossRef][Medline]
Ridley, A. J. ((2001). ). Rho family proteins: coordinating cell responses. Trends Cell Biol. 11, , 471477.[CrossRef][Medline]
Rivero, F., Dislich, H., Glockner, G., and Noegel, A. A. ((2001). ). The Dictyostelium discoideum family of Rho-related proteins. Nucleic Acids Res. 29, , 10681079.
Self, A. J., and Hall, A. ((1995). ). Purification of recombinant Rho/Rac/G25K from Escherichia coli. Methods Enzymol. 256, , 310.[Medline]
Spencer, A. G., Orita, S., Malone, C. J., and Han, M. ((2001). ). A RHO GTPase-mediated pathway is required during P cell migration in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 98, , 1313213137.
Sprang, S. R. ((1997). ). G protein mechanisms: insights from structural analysis. Annu. Rev. Biochem. 66, , 639678.[CrossRef][Medline]
Symons, M., and Rusk, N. ((2003). ). Control of vesicular trafficking by rho GTPases. Curr. Biol. 13, , R409R418.[CrossRef][Medline]
Van IJzendoorn, S. C., and Hoekstra, D. ((1998). ). (Glyco)sphingolipids are sorted in sub-apical compartments in HepG2 cells: a role for non-Golgi-related intracellular sites in the polarized distribution of (glyco)sphingolipids. J. Cell Biol. 142, , 683696.
Van IJzendoorn, S. C., Maier, O., Van Der Wouden, J. M., and Hoekstra, D. ((2000). ). The subapical compartment and its role in intracellular trafficking and cell polarity. J. Cell. Physiol. 184, , 151160.[CrossRef][Medline]
Wennerberg, K., and Der, C. J. ((2004). ). Rho-family GTPases: it's not only Rac and Rho (and I like it). J. Cell Sci. 117, , 13011312.
Wherlock, M., and Mellor, H. ((2002). ). The Rho GTPase family: a Racs to Wrchs story. J. Cell Sci. 115, , 239240.
Wu, Y. C., Cheng, T. W., Lee, M. C., and Weng, N. Y. ((2002). ). Distinct rac activation pathways control Caenorhabditis elegans cell migration and axon outgrowth. Dev. Biol. 250, , 145155.[CrossRef][Medline]
Yang, W., Lin, Q., Zhao, J., Guan, J. L., and Cerione, R. A. ((2001). ). The nonreceptor tyrosine kinase ACK2, a specific target for Cdc42 and a negative regulator of cell growth and focal adhesion complexes. J. Biol. Chem. 276, , 4398743993.
Yochem, J., Tuck, S., Greenwald, I., and Han, M. ((1999). ). A gp330/megalin-related protein is required in the major epidermis of Caenorhabditis elegans for completion of molting. Development 126, , 597606.[Abstract]
Zipkin, I. D., Kindt, R. M., and Kenyon, C. J. ((1997). ). Role of a new Rho family member in cell migration and axon guidance in C. elegans. Cell 90, , 883894.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M.-E. Caruso, S. Jenna, M. Bouchecareilh, D. L. Baillie, D. Boismenu, D. Halawani, M. Latterich, and E. Chevet GTPase-Mediated Regulation of the Unfolded Protein Response in Caenorhabditis elegans Is Dependent on the AAA+ ATPase CDC-48 Mol. Cell. Biol., July 1, 2008; 28(13): 4261 - 4274. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schmutz, J. Stevens, and A. Spang Functions of the novel RhoGAP proteins RGA-3 and RGA-4 in the germ line and in the early embryo of C. elegans Development, October 1, 2007; 134(19): 3495 - 3505. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Emadali, B. Muscatelli-Groux, F. Delom, S. Jenna, D. Boismenu, D. B. Sacks, P. P. Metrakos, and E. Chevet Proteomic Analysis of Ischemia-Reperfusion Injury upon Human Liver Transplantation Reveals the Protective Role of IQGAP1 Mol. Cell. Proteomics, July 1, 2006; 5(7): 1300 - 1313. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||