Molecular Biology of the Cell Sign up for new MBC in Press e-TOCs!

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E04-10-0883 on March 9, 2005

Vol. 16, Issue 5, 2414-2423, May 2005

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Material
Right arrow All Versions of this Article:
E04-10-0883v1
16/5/2414    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Méry, A.
Right arrow Articles by Pucéat, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Méry, A.
Right arrow Articles by Pucéat, M.

Initiation of Embryonic Cardiac Pacemaker Activity by Inositol 1,4,5-Trisphosphate–dependent Calcium Signaling{boxd}{boxv}

Annabelle Méry *, Franck Aimond *, Claudine Ménard *, Katsuhiko Mikoshiba {dagger}, Marek Michalak {ddagger}, and Michel Pucéat *

* CRBM, Centre National de la Recherche Scientifique FRE2593, 34293 Montpellier, France; {dagger} RIKEN BSI, Saitama, IMSUT, University of Tokyo, Tokyo 108-8639, Japan; and {ddagger} Canadian Institutes for Health Research Membrane Protein Research Group and Department of Biochemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2H7

Submitted October 8, 2004; Revised February 28, 2005; Accepted March 1, 2005
Monitoring Editor: Guido Guidotti


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
In the adult, the heart rate is driven by spontaneous and repetitive depolarizations of pacemaker cells to generate a firing of action potentials propagating along the conduction system and spreading into the ventricles. In the early embryo before E9.5, the pacemaker ionic channel responsible for the spontaneous depolarization of cells is not yet functional. Thus the mechanisms that initiate early heart rhythm during cardiogenesis are puzzling. In the absence of a functional pacemaker ionic channel, the oscillatory nature of inositol 1,4,5-trisphosphate (InsP3)-induced intracellular Ca2+ signaling could provide an alternative pacemaking mechanism. To test this hypothesis, we have engineered pacemaker cells from embryonic stem (ES) cells, a model that faithfully recapitulates early stages of heart development. We show that InsP3-dependent shuttle of free Ca2+ in and out of the endoplasmic reticulum is essential for a proper generation of pacemaker activity during early cardiogenesis and fetal life.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The heart rate is initiated and driven by dominant pacemaker cells located in the sino-atrial node of adult myocardium. These cells feature at their membrane a functional pacemaker channel, namely the hyperpolarization-activated cyclic nucleotide (HCN)-gated cationic channel, generating the If current and setting the spontaneous and rhythmic action potentials of the heart (Accili et al., 2002Go; Clapham, 1998Go). The first cell contractions are observed in the murine embryo as early as E7.5 (Porter and Rivkees, 2001Go), despite the small amplitude of the If current recorded before E9.5 (Stieber et al., 2003Go). Interestingly, mice deficient for HCN4, the predominant HCN message in the sino-atrial node, live without cardiac arrhythmias till embryonic day 9.5–11.5 despite the absence of mature cAMP-regulated pacemaker cells in their heart (Stieber et al., 2003Go). This suggests that HCN-independent, not yet described mechanisms must be responsible for a pacemaker activity at the early stages of cardiac development. Such a mechanism is crucial because it would allow for contraction of the cardiac tube and of the fully developed embryonic heart to ensure viability of the embryo till midgestation.

The various roles of Ca2+ as an intracellular second messenger have been characterized extensively. This cation regulates such important biological processes as contraction, cell migration, secretion, growth and differentiation (Clapham, 1995Go; Rizzuto et al., 2002Go; Berridge et al., 2003Go; Webb and Miller, 2003Go). Importantly, the action of intracellular Ca2+ begins at very early stages of development affecting pathways involved in fertilization and embryogenesis (Berridge et al., 2000Go, 2003Go; Webb and Miller, 2003Go). Ca2+ is released from the endoplasmic reticulum (ER) by inositol 1,4,5-trisphosphate (InsP3) generated after phospholipase C activation, decoding the signal conveyed by extracellular growth factors, hormones, or neurotransmitters. In turn, Ca2+ depletion of the ER triggers a capacitative Ca2+ influx (CCI) across the plasma membrane to refill the stores (Putney et al., 2001Go; Venkatachalam et al., 2002Go). The oscillatory nature of the InsP3-induced intracellular Ca2+ signal has been long recognized (Hirose et al., 1999Go; Berridge et al., 2003Go). We hypothesize that InsP3-induced intracellular Ca2+ oscillations, generating rhythmic repetitions of events over time intervals, may provide a pacing mechanism in embryonic heart.

It is difficult to investigate the molecular basis of cardiac pacemaker activity in the murine embryo. Although knockout or targeted mutations of specific genes might provide valuable information to address this question, the dependence of the murine embryo upon blood flow and thus myocardial function makes this approach and interpretation of the results intricate because any defect in heart function may compromise the survival of the embryo. To overcome this problem, here we used differentiating embryonic stem (ES) cell–derived cardiomyocytes, which recapitulate in vitro the early stages of cardiogenesis (Leahy et al., 1999Go; Loebel et al., 2003Go). We engineered pacemaker cells with disrupted intracellular Ca2+ signaling by overexpression of calreticulin, an ER Ca2+-buffering protein or by knocking down expression of type I InsP3 receptor. These genetic approaches were combined with a pharmacological strategy together with cell biology technologies designed to specifically target InsP3 signaling. We demonstrate that intracellular Ca2+ oscillations supported by InsP3-sensitive stores constitute a pacemaking mechanism in early cardiac development. Furthermore, we uncovered that this intracellular Ca2+ network is also essential in mediating pacemaker activity in fetal heart.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
ES Cell Propagation and Differentiation
ES cells (CGR8) were propagated in BHK21 medium supplemented with sodium pyruvate, nonessential amino acids, mercaptoethanol, 7.5% fetal calf serum (FCS; Hyclone, Perbio, France) and leukemia inhibitory factor (LIF)-conditioned medium. Differentiation was carried out using the hanging drop method. Briefly, embryoid bodies (EB) were formed in hanging drops of differentiation medium (BHK21 medium supplemented with Na pyruvate, nonessential amino acids, selenium, {beta}-mercaptoethanol, and 20% FCS, without LIF) for 2 d (D0–2). Then, the embryoid bodies were incubated for 3 d in suspension (D3–5) and plated on gelatin-coated dishes at day 6.

Plasmid Construction, ES Cell Clones, and ES Cell Differentiation
A cDNA encoding rabbit calreticulin was subcloned downstream the {alpha}-MHC promoter (GenBank U71441 [GenBank] ; Nakamura et al., 2001Go). To generate an InsP3RI antisense cDNA, a region (420 base pairs, nucleotides 834-1254 from ATG) of the InsP3 binding domain of the InsP3RI was amplified by PCR from a brain cDNA library using two primers including an enzyme restriction site, taaagcccggggggaagtggaggta (XmaI) and gctgaaaattggtacctctcccct (KpnI). The PCR fragment was then subcloned in a vector in the antisense orientation downstream the {alpha}-MHC promoter. The linearized plasmids were electroporated into CGR8 ES cells according to standard protocol. The ES cell clones were selected for 10 d with G418 (250 µg/ml) and screened by PCR before differentiation using the hanging drop method (Meyer et al., 2000Go). Two separate ES cell clones from each clone were used in the study. To monitor the expression of the antisense mRNA, total RNA extracted from embryoid bodies was reverse-transcribed using the sense primer (taaagcccggggggaagtggaggta). The resulting products were then amplified by real-time quantitative PCR using the primers listed above and run on agarose gel.

Cell Microdissection and Combined Approaches
Beating areas of EBs featuring EYFP-expressing cells were dissected with a laser-assisted device (PALM Laser, Bernried, Germany) or a microscalpel and cells were enzymatically isolated using 1 mg/ml collagenase in ADS buffer without Ca2+ (containing 20 mM HEPES, 5 mM glucose, 117 mM NaCl, 5.7 mM KCl, 1.2 mM NaH2PO4, 4.4 mM NaHCO3, 1.7 mM MgCl2). Cells were then plated in differentiation medium on gelatin-coated dishes. Real time PCR was carried out on dissected EYFP-expressing cells after reverse transcription from RNA extracted using a RNA extraction kit (PALM Laser).

Electrophysiology
Electrophysiological recordings were made at room temperature (25 ± 2°C) using an Axopatch-200 patch clamp amplifier (Axon Instruments, Foster City, CA) and analyzed using the Clampfit 9 software (Axon Instruments). Monitoring of action potentials (AP) in ES cell–derived pacemaker cells was performed as early as 24 h after their isolation and no longer than 48 h after with no change in morphology, or electrical properties during the 2-d culture. AP were recorded with a 30–100 M{Omega} micropipette filled with 3 M KCl. EYFP-expressing cells were impaled with the microelectrode and electrode capacitance was nulled. Voltage-activated K+ currents were recorded in response to 1.5-s voltage steps to potentials between -140 and + 50 mV in 10 mV increments, from a holding potential of -70 mV. Recording pipettes contained (mmol/L): 135 KCl, 1 MgCl2, 10 EGTA, 10 HEPES, and 5 glucose; pH 7.2 (300–310 mosmol/L). The bath solution contained (mmol/L): 117 NaCl, 5.5 KCl, 1.8 CaCl2, 2 MgCl2, 10 HEPES, and 10 glucose. pH and osmolarity were adjusted to 7.4 and 295–305 mosmol/L, respectively.

Isolation of Embryonic Cardiomyocytes, Cell Transfection, and Microinjection
E9–9.5 murine embryos were dissected, kept in the yolk sac and put in culture medium (DMEM supplemented with 2% FCS) for 24 h before in situ whole heart experiments. Alternatively, the heart was removed from E14.5 mouse embryos. Atria were separated from ventricles and bathed in ADS buffer. Then cells were isolated with pancreatin and collagenase as previously described (Puceat et al., 1994Go). Cells were plated in the same medium as the one used for EBs. Monitoring of Ca2+ spikes in embryonic cardiomyocytes was performed as early as 24 h after their isolation and no longer than 48 h after. No change in cell morphology and Ca2+ homeostasis were observed during the 2-d culture. The day after their isolation, embryonic cardiomyocytes were transfected with Ds Red alone or Ds Red and a plasmid encoding the InsP3 phosphatase or a pcDNA3.1 plasmid encoding calreticulin, all under control of the CMV promoter. In other experiments, embryonic cardiomyocytes were transfected with the InsP3RI antisense construct (see above) together with a plasmid encoding myosin light chain 2v (MLC2v) fused to GFP under the control of the cardiac {alpha}-actin promoter, in order to track the transfected cells. Transfection was performed with Effectene (Qiagen, Chatsworth, CA) according to the manufacturer's instructions. Cell microinjection was performed as previously described (Bony et al., 2001Go; Jaconi et al., 2000Go). The pipettes contained 2.5 mM fluo-3 (K salt) and 500 µg/ml monoclonal 18A10 anti-InsP3RI antibody or mouse IgGs, or 2.5 mM fluo-3 (K salt) and 3 mg/ml JPW1114.

Imaging of Cytosolic Ca2+ Concentration and Membrane Potential
ES cell–derived embryoid bodies, embryonic cardiomyocytes, or whole E9–9.5 mouse embryos were loaded with 5 µM fluo-4/AM (Molecular Probes, Eugene, OR) for 10–15 min, transferred to the stage of a fast-acquisition epifluorescence confocal microscope and superfused with ADS buffer added with 2 mM Ca2+. The field was illuminated at 488 nm (Argon laser). Fluo-4 emission fluorescence was recorded through a dichroic mirror (cutoff 510 nm) and a long pass emission filter (cutoff 520 nm) set on a motorized filter wheel. The images were recorded each 30 or 50 ms using a confocal Perkin Elmer-Cetus Ultraview microscope (Norwalk, CT) coupled to a CCD camera (Coolsnap, Princeton Scientific Instruments, Monmouth Junction, NJ) and digitized on line by a computer (Metamorph software, Universal Imaging, West Chester, PA). To calculate the frequency and synchronization of Ca2+ spikes in embryoid bodies, regions of interest were selected in cells within a beating area and the average pixel intensity was plotted as a function of time. All experiments were performed at 35 ± 2°C and were repeated at least three times. To simultaneously record fluo-3 and JPW1114 fluorescence, cells were bathed in a culture dish set on the stage of a Meta LSM 510 Zeiss microscope (Thornwood, NY) warmed at 37°C. Cells were illuminated at 488 or 514 nm using the Argon laser, and fluorescence was recorded by the photomultipliers after crossing a HFT 488 and NFT 545 dichroic mirrors and two bandpass filters at 505–530 nm (fluo-3) or 620–670 nm (JPW114). Images were acquired each 50–70 ms by scanning a small region of interest within the cell.

To estimate the release of Ca2+ from the ER, 1 µM thapsigargin was superfused in the absence of Ca2+ to fluo-4–loaded spontaneously Ca2+ spiking E14 embryonic myocytes overexpressing calreticulin or to mock cells. The amplitude of the Ca2+ release was estimated when a plateau was reached. The maximal rate of increase in cytosolic Ca2+ concentration ([Ca2+]c) was fitted using a sigmoidal equation after normalization of values to the maximal value of fluorescence and was expressed as the t1/2 required to reach the plateau.

Immunocytochemistry
For immunostaining, embryoid bodies or cells were fixed with 3% paraformaldehyde, permeabilized with 0.1% Triton X-100, and labeled with a mouse antisarcomeric {alpha}-actinin antibody (Sigma, St. Louis, MO) or with an anti-{beta}MHC antibody and Alexa350–or Alexa546–conjugated anti-mouse IgG (Molecular Probes) or with an anticalreticulin or anti-InsP3RI antibody (Jaconi et al., 2000Go) and a secondary Alexa488–or Alexa546–conjugated anti-rabbit IgG (Molecular Probes). In situ immunostained sarcomeres were visualized in 0.3-µm optically z-sectioned embryoid bodies. To improve resolution and signal-to-noise ratio, images were restored using the Huygens software (Huygens 2.2.1, Scientific Volume Imaging, Hilversrum, The Netherlands) and visualized using Imaris (Bitplane, Zurich, Switzerland). Calculations were performed on Dell Precision 450 workstations (Round Rock, TX).

RNA Extraction, Reverse Transcription Reaction, and Real-time Quantitative PCR by SYBR Green Detection
Total RNA was isolated from embryoid bodies using an RNA extraction kit (RNeasy, Qiagen, France). One microgram of RNA was reverse-transcribed using the M-MLV reverse transcriptase (Invitrogen, Cergy, France) and used in real-time PCR.

The nucleotide sequences of the PCR primers used were as follows: MEF2C forward: 5'-AGATACCCACAACACACCACGCGCC-3' and reverse: 5'-ATCCTTCAGAGAGTCGCATGCGCTT-3'; Nkx2.5 forward: 5'-TGCAGAAGGCAGTGGAGCTGGACAAGCC-3' and reverse: 5'-TGCACTTGTAGCGACGGTTCTGGAACCAG-3'; {beta}-tubulin forward: 5'-CCGGACAGTGTGGCAACCAGATCGG-3' and reverse: 5'-TGGCCAAAAGGACCTGAGCGAACGG-3'; HCN1 forward: 5'-CAAGACAGCCAGAGCACTTCGT-3' and reverse: 5'-AGATACATACACCAGTGGGAAGAG-3'; HCN2 forward: 5'-TCGTCTTCAACGTGGTCTCG-3' and reverse: 5'-ACAACACGGAGATCATCCTGGAC-3' (Yasui et al., 2001Go); HCN4 forward: 5'-GGATTATCCACCCCTACAG-3' and reverse: 5'-GTCTCGCCAAGTCAATGAGGAAGAAT-3'; EYFP forward: 5-ACGTAAACGGCCACAAGTTC-3' and reverse: 5'-AAGTCGTGCTGCTTCATGTG-3'; MLC2a forward: 5'-TCTTCTAATGTCTTCTCAATGTTCG-3' and reverse: 5'-TCTACTCCTCTTTCTCATCC; CCGTG-3'; MLC2v forward: 5'-GCCAAGAAGCGGATAGAAGG-3' and reverse: 5'-CTGTGGTTCAGGGCTCAGTC-3'; {alpha}-MHC forward: 5'-CCAATGAGTACCGCGGTGAA-3' and reverse: 5'-ACAGTCATGCCGGGATGAT-3'; Cx45 forward: 5'-TGTGTGCAACACAGAGCAGC-3' and reverse: 5'-CCATCCTCTCGAATTCGTCG-3'. Real-time quantitative PCR was performed using a LightCycler rapid thermal cycler (Roche, Meylan, France). Amplification was carried out as recommended by the manufacturer. Twelve-microliter reaction mixture contained 10 µl of Light Cycler-DNA Master SYBR Green I mix (FAST Start KIT, containing TaqDNA polymerase, reaction buffer, deoxynucleoside trisphosphate mix, and SYBR Green I dye), added with 3 mM MgCl2, 0.5 µM of appropriate primer mix, and 2 µl of cDNA. Results were expressed as a function of the level of expression of the gene of interest in first stage of differentiating EBs using a previously described mathematical model (Pfaffl et al., 2002Go). The data were normalized by PCR analysis of {beta}-tubulin. The amplification program included the initial denaturation step at 95°C for 8 min, and 40 cycles of denaturation at 95°C for 3 s, annealing at 65°C for 10 s, and extension at 72°C for 10 s. The temperature transition rate was 20°C/s. Fluorescence was measured at the end of each extension step. After amplification, a melting curve was acquired by heating the product at 20°C/s to 95°C, cooling it at 20°C/s to 70°C, keeping it at 70°C for 20 s, and then slowly heating it at 0.1°C/s to 95°C. Fluorescence was measured through the slow heating phase. Melting curves were used to determine the specificity of PCR products, which was confirmed using conventional gel electrophoresis.

The Student's t test was used to analyze statistical significance. All p values corresponded to two-tailed test, and p < 0.05 was considered statistically significant.

Western Blotting
For Western blotting, embryoid bodies were lysed using RIPA buffer (20 mM Tris-HCl, pH 7.8, 150 mM NaCl, 1% Triton X-100, 1% deoxycholic acid, 1 mM EDTA, 0.05% SDS) supplemented with phenylmethylsulfonyl fluoride. Protein concentrations were determined by Bio-Rad protein assay (Bio-Rad, Richmond, CA). Proteins (50 µg) were fractionated by SDS-PAGE, electroblotted onto a nitrocellulose transfer membrane, and probed with an anti-calreticulin antibody. Antibodies were visualized by addition of goat HRP-conjugated anti-rabbit IgGs and enhanced chemiluminescence reagents (ECL reagent, Amersham Pharmacia Biotech Europe, Freiburg, Germany).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Engineering of Pacemaker Cells from ES Cells
When cultured in high serum medium, ES cells aggregate within an EB, a three-dimensional cell formation that includes the three embryonic layers, and then spontaneously differentiate into myocytes featuring all cardiac phenotypes (i.e., ventricular and atrial cells including sino-atrial cells; Maltsev et al., 1994Go). To locate pacemaker cells among myocytes differentiating within embryoid bodies (Meyer et al., 2000Go), we engineered an ES cell clone expressing the EYFP. Expression of EYFP was driven by the cardiac-specific {alpha} isoform of myosin heavy-chain ({alpha}-MHC) promoter, functional in E7 embryos, and early developing embryonic atria, where differentiation of pacemaker cells originates (Lyons et al., 1990Go; Moorman and Lamers, 1999Go; Morkin, 2000Go; Figure 1A). EYFP-expressing cells were small and displayed mostly a round or elongated shape (Figure 1B, inset). They were dispersed in the embryoid bodies within large fields of cardiomyocytes (Figure 1B). In comparison, ES cells in which the expression of EYFP was driven by the broadly functional cardiac {alpha}-actin promoter (Behfar et al., 2002Go) produced clusters of large myocytes (Figure 1C). This suggests that the activity of the {alpha}-MHC promoter is significantly restricted among differentiating cardiac cells at early stages of development of embryoid bodies. Cardiac sarcomeres in the EBs were visualized at high magnification by immunofluorescence, using an antibody against sarcomeric actinin. Figure 1D shows that cells expressing EYFP under the transcriptional control of the {alpha}-MHC promoter featured a poor myofibril network. Furthermore, cells expressing EYFP under the transcriptional control of {alpha}-MHC did not express the {beta} isoform of myosin heavy chain ({beta}-MHC) while surrounded by contractile {beta}-MHC–positive cells (Figure 1E). Videomicroscopy showed that they were not beating (Supplementary Video) while driving contractions of the neighbor myocytes, suggesting that they might be pacemaker cells. To obtain further insight into the phenotype of EYFP-expressing cells, they were microdissected out of the EBs using a laser-assisted device or a microscalpel followed by real-time RT-PCR analysis as well as electrophysiological recordings. Figure 1F shows that these cells contained a high level of mRNAs encoding connexin 45, as well as HCN4, two well-known markers of mouse sinoatrial cells (Moosmang et al., 2001Go; Verheijck et al., 2001Go). No expression of mRNA encoding HCN1 or HCN2 was found in these cells (unpublished data). ES cell–derived EYFP-expressing cells displayed spontaneous action potentials (APD90 = 176 ± 4 ms at 25°C, n = 6) starting with a slow diastolic depolarization, typical of sino-atrial cells (Figure 1G). Patch-clamp technique was used to test the presence or absence of functional If channels in ES cell–derived EYFP-expressing cardiomyocytes dissected out of EBs at days 9 and 11 of differentiation. Hyperpolarizing pulses from -30 to -140 mV were applied to EYFP-expressing cells, from a holding potential of -70 mV (see inset Figure 1H). At day 9 of differentiation, the presence of a small inward depolarizing K+ current with electrophysiological properties similar to native If current recorded in sino-atrial node cells of adult mouse hearts (Mangoni and Nargeot, 2001Go) was observed in only two of the eight cells analyzed, albeit of small amplitude. The other six cells only expressed an inward background K+ conductance with small density (Figure 1H). On the contrary, in cells isolated from day 11 EBs, If current was recorded in all EYFP-positive cells. Density and activation time constants of If current were 24.9 ± 7.5 pA/pF and 503 ± 63 ms at -140 mV (n = 6), respectively. Interestingly, the current/voltage relationships of total inward and outward voltage-gated K+ currents, obtained at days 9 and 11 of differentiation (Figure 1H), demonstrated no difference in the current density of outward voltage-gated K+ currents.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Cells expressing EYFP under control of the {alpha}-MHC promoter are true pacemaker cells. (A) {alpha}-MHC expression was measured by real-time quantitative PCR after reverse transcription of mRNA extracted from embryonic ventricles and atria at different stages of development (E7, E9, E14.5, E17.5) or after birth in neonatal mice (Neo). Data are normalized to {beta}-tubulin expression and expressed as fold increase in expression compared with E7 embryonic heart {alpha}-MHC mRNA content. CGR8 ES cell clones expressing EYFP under control of the {alpha}-MHC promoter (B) or of the cardiac {alpha}-actin promoter (C) were allowed to differentiate into cardiomyocytes within embryoid bodies (EBs). EYFP was visualized by confocal microscopy at 10x (BC) and 63x magnification (inset B). (D) Sarcomeric units of differentiating myocytes including some expressing EYFP under control of the {alpha}-MHC promoter were immunostained within EBs with an anti-actinin antibody and anti-mouse secondary antibody coupled to Alexa350 and visualized by confocal microscopy (63x magnification). (E) Cardiomyocytes including {alpha}-MHC-EYFP–expressing cells were immunostained with an anti-{beta}-MHC antibody and an anti-mouse secondary antibody coupled to Alexa546 and imaged by confocal microscopy (63x magnification). (F) Myocytes expressing EYFP under control of the {alpha}-MHC promoter were microdissected out of day 8–10 EBs. RNA was extracted from the cells; EYFP, Cx45, and HCN4 were amplified by real-time quantitative PCR. Profiles of melting curves obtained at the end of the PCR run are illustrated; the amplified fragments were further separated on agarose gel to identify the products (inset). (G) Other EYFP-expressing cells were enzymatically dissociated using collagenase and cultured for 24–48 h. Action potentials (G) and the If current (H) were recorded in these cells under microelectrode or voltage-clamp configuration, respectively. The figure is representative of 6–8 experiments. *Significantly different from D9 (p ≤ 0.05)

 

Combined, our findings demonstrate that cells expressing EYFP under the transcriptional control of the {alpha}-MHC promoter display all essential hallmarks of pacemaker cells. We have thus established a cell model which recapitulates in vitro the formation of pacemaker cells.

Voltage-sensitive Ionic Conductances Do Not Underlie Automaticity of ES Cell–derived Pacemaker Cells
In excitable muscle cells, spontaneous electrical activity is translated into spontaneous Ca2+ spiking. Thus, the latter phenomenon can be used as a read-out of pacemaker activity. To further test the involvement of a voltage-sensitive ionic current in pacemaker activity of day 9 whole embryoid bodies, 140 mM KCl was applied to spontaneously Ca2+-spiking cells, within fluo-4–loaded embryoid bodies to abolish membrane potential. A sudden and sustained increase in basal Ca2+ was observed upon depolarization of cells. More interestingly, despite the annihilation of the membrane potential, rhythmic Ca2+ oscillations were still observed when basal Ca2+ reached a plateau (Figure 2A). To more specifically establish a participation, if any, of the If current in spontaneously Ca2+-spiking cells, ivabradine or zeneca (ZD7288), two inhibitors of If conductance (BoSmith et al., 1993Go; Bucchi et al., 2002Go), were applied to day 9 fluo-4–loaded embryoid bodies. Both drugs had no effect on spontaneous Ca2+ spiking activity of ES cell–derived cardiomyocytes (Figure 2B) as expected from the lack of functional If current in ES cell–derived pacemaker cells in day 9 embryoid bodies (Figure 1H). Similarly, when tested on E9.5 embryonic hearts in situ, both ivabradine and zeneca (ZD7288) had no effect on their spontaneous Ca2+-spiking activity (Supplementary Figure S1). This indicates that at early stages of cardiogenesis, the If current does not play any role in pacemaker activity. In contrast, 2 d later, in day 11 embryoid bodies, a stage at which a functional If current was recorded in ES cell-derived pacemaker cells (Figure 1H), both If current inhibitors slowed down the rate of spontaneously spiking ES cell–derived cardiac cells and changed the decay of the Ca2+ transient (Figure 2C). In line with this result, depolarization of the cells with 140 mM KCl increased basal Ca2+ and stopped Ca2+ oscillations recorded within embryoid bodies (Figure 2D). We conclude that the If current is functional only at day 11 of differentiation of ES cells. Thus, another voltage-insensitive pacemaking mechanism must account for cardiac automaticity during heart formation at early embryonic stages.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Pacemaker activity of day 9 embryoid bodies (EBs) does not depend upon a voltage-sensitive ionic conductance. Fluo-4–loaded day 9 EBs were challenged with 140 mM KCl (KCl replaced NaCl) (A) or with 10 µM ivabradine or 1 µM zeneca (B). Fluo-4–loaded day 11 EBs were challenged with 10 µM ivabradine or 1 µM zeneca (C) or with 140 mM KCl (D). Recordings show Ca2+ spikes within selected regions of interest (ROI) and are expressed as {Delta}F/Fo, where Fo is the lowest basal fluorescence recorded at the beginning of the experiment. The figure is representative of at least five experiments.

 

Overexpression of Calreticulin in Pacemaker Cells Impairs Their Spontaneous Activity
Intracellular Ca2+ signaling is disrupted by increased levels of calreticulin in the ER (Krause and Michalak, 1997Go). Elevated expression of calreticulin leads to increased concentrations of Ca2+ in the lumen of the ER in nonexcitable cells (Mery et al., 1996Go) and to a concomitant inhibition of capacitative Ca2+ influx (Mery et al., 1996Go; Fasolato et al., 1998Go) as well as inhibition of SERCA (John et al., 1998Go). This limits Ca2+ entry into the ER, and in turn impairs Ca2+ efflux from the ER (Xu et al., 2000Go). Besides, buffering ER luminal Ca2+ revealed that the filling state of the ER regulates the extent of InsP3-triggered Ca2+ release through a mechanism independent from cytosolic Ca2+ or refilling by the sarco-ER Ca2+ ATPase (SERCA; Caroppo et al., 2003Go). Overexpression of calreticulin may thus decrease free intraluminal Ca2+ and reduce InsP3-triggered Ca2+ release beyond what can be expected from a simple reduction of ER free Ca2+ content. We also observed that calreticulin overexpressed in E14 spontaneously Ca2+ spiking embryonic cardiomyocytes tended to slow down thapsigargin-induced Ca2+ release from the ER (t1/2 of increase in cytosolic Ca2+: median [range]: 67.5 s [38.7134.5], n = 6) in control cells and 41.6 s [21.1;82.5], n = 6, in CRT-overexpressing cells) and significantly decreased the total amount of released Ca2+: in arbitrary units, 0.82 [0.36;1.22] in control cells and 0.35 [0.1;0.65] in CRT-overexpressing cells. These results and the documented effects of calreticulin on intracellular Ca2+ signaling prompted us to manipulate its intracellular expression in ES cell–derived pacemaker cells to investigate the role of InsP3–sensitive Ca2+ stores in triggering embryonic cardiac excitability. We generated an ES cell line in which calreticulin is expressed under the transcriptional control of the {alpha}-MHC promoter (designed as {alpha}-MHC-CRT). As described above, this effectively targets overexpression of calreticulin to pacemaker cells. {alpha}-MHC-CRT ES cells were allowed to differentiate within EBs into cardiomyocytes including pacemaker cells (inset in Figure 3). Figure 3 shows that the embryoid bodies derived from {alpha}-MHC-CRT ES cells exhibited a dramatic reduction in the beating activity of cardiomyocytes differentiating within the mesoderm. Wild-type CGR8 ES cells differentiated into cardiomyocytes within 9–12 d, as shown by a high percentage (67 ± 16%) of spontaneously contracting EBs. In contrast, in a population of EBs containing pacemaker cells that overexpressed calreticulin, only 23 ± 4% were beating at day 12 (Figure 3A). However, buffering Ca2+ by calreticulin in the ER of pacemaker cells did not affect expression of mRNAs encoding cardiac-specific transcription factors (i.e., Nkx2.5 and Mef2C; Supplementary Figure S2). Similarly, myofibrillogenesis as assessed by anti-{alpha}-actinin immunostaining was normal in EBs containing pacemaker cells that overexpressed calreticulin. Furthermore, both atrial and ventricular myosin light chains were expressed normally in EBs that overexpressed calreticulin (Supplementary Figure S3).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Overexpression of calreticulin in ES cell–derived pacemaker cells impairs excitability and contractility of embryoid bodies (EBs). (A) Wild-type CGR8 ES cells or cells expressing calreticulin under control of the {alpha}-MHC promoter were allowed to differentiate within EBs and beating activity of EBs was monitored daily from day 7. The figure is a mean of three separate differentiation experiments. The inset shows an anti-calreticulin Western blot of proteins extracted from wild-type CGR8 or {alpha}-MHC-calreticulin EBs. Wild-type CGR8 or {alpha}-MHC-calreticulin EBs were loaded with fluo-4 and Ca2+ transients were monitored in ES cell–derived cardiomyocytes using fast acquisition confocal microscopy (B). Recordings show Ca2+ spikes within selected regions of interest (ROI) and are expressed as {Delta}F/Fo, where Fo is the lowest basal fluorescence recorded at the beginning of the experiment. The figure is representative of at least five experiments.

 

To further delineate the phenotype of pacemaker cells overexpressing calreticulin, Ca2+-spiking activity was imaged in day 8–10 fluo-4–loaded EBs, before appearance of a functional If current (Figure 2). Cardiomyocytes in the wild-type EBs showed synchronous and vigorous Ca2+ spikes, with a rate (1 Hz at 35°C) similar to the one of the action potentials of ES cell–derived pacemaker cells (0.8 Hz at 25°C, Figure 1), whereas those in the EBs with pacemaker cells that overexpressed calreticulin displayed weak and asynchronous Ca2+ transients (Figure 3B). Thus, buffering intraluminal ER Ca2+ and limiting capacitative Ca2+ influx by high expression of calreticulin in pacemaker cells have an inhibitory effect indicating that homeostasis of ER Ca2+ stores plays a crucial role in generation of early pacemaker activity in developing embryoid bodies.

InsP3-induced Ca2+ Release Is Required for Pacemaker Activity
Because the excitability of cardiomyocytes in EBs was severely compromised when the pacemaker cells overexpressed calreticulin, we hypothesized that repetitive InsP3-induced Ca2+ release from the ER plays an essential role in early cardiac automaticity. To get more insight into the role of the InsP3-dependent pathway in mediating pacemaker activity, we tested an alternative genetic approach to disrupt Ca2+ cycling within the pacemaker cell. An ES cell line was generated to express specifically in the pacemaker cells an InsP3 receptor antisense cDNA under the transcriptional control of the {alpha}-MHC promoter (Figure 4), an approach previously reported as successful to disrupt InsP3 signaling in T-cells (Jayaraman et al., 1995Go). The antisense dramatically decreased the number of type I InsP3 receptors, the major InsP3 receptor isoform expressed in these cells (unpublished data) as shown by immunostaining embryonic cardiac cells expressing the antisense with a specific anti-type I InsP3 receptors antibody (Figure 4A). Differentiation of the genetically modified ES cells (InsP3R antisense) within embryoid bodies recapitulated the phenotype of the embryoid bodies with pacemaker cells overexpressing calreticulin. Beating activity was severely impaired (Figure 4B). In line with the weak contractility, spontaneous Ca2+ spiking within embryoid bodies in which pacemaker cells expressed the InsP3RI antisense was weak and an infrequent event (Figure 4C). Differentiation per se of ES cells into cardiomyocytes was not affected as revealed by the presence of abundant actinin-positive cardiac cells within the embryoid bodies (Supplementary Figure S4).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 4. InsP3RIs are required to initiate pacemaker activity in embryoid bodies (EBs). (A) Two clones of ES cells, IP3Ras13 and IP3Ras14, were selected for their level of expression of the InsP3RI antisense cDNA. Left panel, an agarose gel electrophoresis of real time quantitative PCR products amplified after reverse transcription of the antisense mRNA from total RNA of day 12 EB. Wild-type CGR8 d 12 EBs (CGR8) and no DNA in PCR reaction (-) served as negative controls. The {alpha}-MHC-InsP3RI antisense plasmid (+) served as a positive control. Right panel, two embryonic cardiomyocytes cotransfected with a plasmid ({alpha}-MHC-InsP3RI) encoding the InsP3RI antisense together with a plasmid encoding a fusion protein myosin light chain 2v-GFP (MLC2vGFP) to track the transfected cells and their neighbor nontransfected cardiomyocyte. Cells were stained 72 h after transfection with an anti-InsP3RI antibody. The white arrows show the absence of InsP3RIs in the nuclear area of the antisense-transfected cells (n = 2 experiments, 55 scored cells), whereas the yellow arrow shows the InsP3RIs located in the nuclear envelope and emanating ER of the nontransfected cell. (B) ES cells expressing the InsP3RI antisense cDNA under control of the {alpha}-MHC promoter were allowed to differentiate within EBs and beating activity of EBs was monitored daily from day 7. The figure is a mean of two separate differentiation experiments. (C) Day 9–10 CGR8 or IP3Ras EBs were loaded with fluo-4 and Ca2+ transients were monitored in ES cell–derived cardiomyocytes using fast acquisition confocal microscopy. (D) Xestospongin (5 µM) was applied to wild-type fluo-4–loaded EBs. Right panel, Ca2+ spiking was recorded after 2-min exposure to the inhibitor; in the same running experiments, Ca2+ spikes were fully abolished after 5 min superfusion of the drug. Recordings show Ca2+ spikes within selected regions of interest (ROIs) and are expressed as {Delta}F/Fo, where Fo is the lowest basal fluorescence recorded at the beginning of the experiment. The figure is representative of 3–5 separate experiments. (E) Xestospongin (5 µM) was applied to E9–9.5 mouse embryonic heart loaded with fluo-4 and observed at 10x magnification. Ca2+ spiking was recorded after 2-min exposure to the inhibitor; in the same running experiments, Ca2+ spikes were fully abolished after 5-min superfusion of the drug. Recordings show Ca2+ spikes within selected regions of interest (ROIs) located in the atrium (a) or ventricle (v) of the heart tube and are expressed as {Delta}F/Fo, where Fo is the lowest basal fluorescence recorded at the beginning of the experiment. The figure is representative of three separate experiments.

 

To further address the role of InsP3 receptors, we used xestospongin C, the most specific InsP3 receptor antagonist (Gafni et al., 1997Go). In the presence of xestospongin C at a low concentration (5 µM), which does not affect Ca2+ reuptake by the ER (De Smet et al., 1999Go), spontaneous Ca2+ transients recorded within day 8–10 EBs were stopped within 5 min (Figure 4D). Similarly, applied to whole E9.5 mouse embryos, the InsP3RI antagonist desynchronized and abolished Ca2+ spiking in both the atrial and ventricular primordia of embryonic heart. Washing the drug out allowed a slow recovery of fast Ca2+ transients (Figure 4E).

InsP3 Regulates Pacemaker Activity of E14.5 Embryonic Pacemaker Cells
Embryonic (E14.5) atrial cells in which {alpha}-MHC is transiently expressed (Figure 1A) include a population of pacemaker cells. We wanted to address whether InsP3-induced Ca2+ cycling also underlies pacemaker activity of these cells at a stage of differentiation far more advanced than ES cell–derived pacemaker cells in D8–10 EBs. To induce a fast hydrolysis of InsP3, we used InsP3 phosphatase expressed in atrial cells isolated from E14.5 embryonic hearts and plated at low density. Spontaneous Ca2+ spiking in isolated cells was used as a criterion to track pacemaker cells among the atrial cells. Such pacemaker cells represented a population of 6% of E14.5 atrial cells and featured a developed ER as shown by the presence of high levels of calreticulin and InsP3RIs (Figure 5A). Automatic activity (i.e., Ca2+ spiking) was scored in InsP3 phosphatase- and Ds Red-coexpressing cells versus cells expressing only Ds Red. Figure 5B shows that hydrolysis of InsP3 by the phosphatase prevented automaticity in 77% of pacemaker atrial cells.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. InsP3-induced Ca2+ mobilization regulates pacemaker activity of E14.5 embryonic pacemaker atrial cells. (A) Cells were isolated from atria of E14.5 embryos and cultured for 24–48 h. ER of embryonic cardiomyocytes was immunostained with anticalreticulin and anti-InsP3RI antibodies and visualized by confocal microscopy. Scale bar, 10 µm. (B) Cells were transfected with a vector encoding Ds Red alone or with both Ds Red and a pcDNA vector encoding InsP3 phosphatase. After loading with fluo-4, Ca2+ transients were recorded in isolated cells. The figure is a mean of three separate experiments including 507 cells expressing Ds Red only and 511 cells expressing both Ds Red and the InsP3 phosphatase. (C) Cells were microinjected with micropipettes containing 2.5 mM fluo-3 and 500 µg/ml 18A10 monoclonal anti-InsP3RI antibody or mouse IgGs. Ca2+ transients were recorded in 37 isolated cells microinjected with control IgGs and 47 isolated cells microinjected with the 18A10 antibody. (D) Cells were microinjected with micropipettes containing 2.5 mM fluo-3 and 3 mg/ml JPW1114. Ca2+ transients, and action potential were simultaneously recorded in isolated cells before and after 2 or 5 min of xestospongin application (5 µM). The figure is representative of six experiments.

 

Next, we used a specific anti-InsP3RI antibody (clone 18A10) to block receptor function (Nakade et al., 1991Go). The antibody or mouse IgGs as a control were microinjected into atrial embryonic pacemaker cells together with fluo-3. The antibody prevented Ca2+ spiking in 65% of atrial pacemaker cells (Figure 5C). In line with the previous findings, xestospongin C blunted both spontaneous Ca2+-spiking and firing of action potential simultaneously monitored in fluo-3 and JPW1114 injected atrial pacemaker cells (Figure 5D). Altogether, these findings demonstrate that InsP3 must be a key messenger to mediate pacemaker activity in embryonic hearts.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The molecular and subcellular keystones of pacemaker activity in early stages of cardiogenesis, before appearance of the If pacemaker current, have not been understood at the subcellular level. Here, we uncovered that intracellular Ca2+ signaling emanating from the ER in embryonic pacemaker cells is essential for cardiac cell automaticity. We demonstrate that depolarization of pacemaker cells in early embryonic pacemaker cells is triggered by InsP3-sensitive intracellular Ca2+ stores. Furthermore, this early pacemaker mechanism is preserved throughout murine development and works together with the If current–based mechanism in fetal pacemaker cells.

Engineering of ES Cell–derived Pacemaker Cells
Using the {alpha}-MHC promoter to drive expression of EYFP in CGR8 ES cells, we established a model of early cardiac pacemaker cells. The ES cell–derived pacemaker cells featured a poor myofibrillar network and did not beat while driving contraction of surrounding cells. This suggests that the cells generated and propagated an electrical signal. Indeed, the membrane potential of the pacemaker cells was unstable, triggering spontaneous and rhythmic firing of action potentials. The depolarizing phase of the action potential was composed of a slow and then a very fast upstroke, a time course typical of pacemaker cells of the sino-atrial node (Mangoni and Nargeot, 2001Go). These cells also expressed connexin 45, a specific isoform of connexin whose expression is restricted to nodal cells (Verheijck et al., 2001Go) and HCN4, although not yet functional at early stages of cell differentiation but becoming operative in later stages.

Impaired InsP3-dependent Ca2+ Signaling Prevents Pacemaker Activity But Not Cardiac Cell Differentiation in Early Cardiogenesis
We disrupted the intracellular Ca2+ signaling network by buffering ER Ca2+ and preventing ER refilling by calreticulin or altered expression of InsP3RIs by using an antisense cDNA. In both cases, the expression of the transgene was driven by the {alpha}-MHC promoter to target the Ca2+ binding protein or the InsP3RI antisense cDNA to CGR8 ES cell-derived pacemaker cells. Ca2+ spiking activity and in turn contractility of cardiomyocytes within EBs were severely impaired. Buffering ER Ca2+ and limiting ER refilling by calreticulin or inhibiting Ca2+ release by an InsP3RI antisense in pacemaker cells did not, however, prevent differentiation per se, because the cardiomyocytes showed normal expression of cardiac-specific transcription factors (i.e., Nkx2.5 and Mef2C) and normal myofibrillogenesis. Although a role of calreticulin has been suggested in the retinoic acid receptor signaling pathway (Shago et al., 1997Go), a key pathway in cardiac cell specification (Xavier-Neto et al., 1999Go; Harvey, 2002Go), both atrial and ventricular myosin light chains were expressed normally in EBs that overexpressed calreticulin. This demonstrates that atrio-ventricular specification did occur. This was expected from the fact that calreticulin overexpression was restricted to noncontractile pacemaker cells. We conclude that pacing is not required for cardiogenesis from ES cells as previously observed (Yang et al., 2002Go). However, the excitability of cardiomyocytes was severely compromised in EBs that contained pacemaker cells overexpressing calreticulin or featuring an altered InsP3RI expression.

The phenotype of pacemaker cells with disrupted InsP3-dependent Ca2+ signaling contrasts with the one of ryanodine-deficient ES cell–derived cardiomyocytes that show no inhibition of beating activity or amplitude of the Ca2+ transients, but only modifications in their beating frequency (Yang et al., 2002Go). This demonstrates that Ca2+ release via InsP3 receptors, and not via ryanodine receptors, plays a key role in the excitability of early pacemaker cells. This might have been expected from a negligible expression of calsequestrin and a not yet developed T-tubule system in ES cell–derived cardiomyocytes within day 9–12 EBs, as assessed by PCR and immunofluorescence (unpublished data).

Early Pacemaker Activity Is Triggered by Ca2+ Cycling In and Out of the ER through InsP3Rs
During early cardiac cell differentiation of ES cells, spontaneous action potentials do not depend on membrane potential but rather on intracellular Ca2+ stores. It has been suggested that intracellular Ca2+ oscillations activate a Ca2+-dependent voltage-insensitive nonspecific cationic conductance and/or of Na+/Ca2+ exchange, generating depolarizing currents and in turn action potentials (Viatchenko-Karpinski et al., 1999Go). Although the molecular and subcellular components of this mechanism remain unclear, it applies to pacemaker cells of the gastrointestinal tract (Ward et al., 2000Go) and is functional in the E9 mouse embryonic heart (Koushik et al., 2001Go) before the pacemaker If current becomes predominant (Yasui et al., 2001Go; Stieber et al., 2003Go).

We focused our investigation on the intracellular signaling components that could periodically generate cytosolic Ca2+ increase to activate the depolarizing voltage-independent conductances. We now report that shuttle of Ca2+ in and out of the ER provides an oscillatory membrane-depolarizing mechanism, which triggers the pacemaker activity. Indeed, overexpression of calreticulin in nonexcitable cells has been shown to limit Ca2+ entry into the cell (Mery et al., 1996Go; Fasolato et al., 1998Go) and in turn to impair Ca2+ mobilization from the ER (Xu et al., 2000Go). Calreticulin also features a chaperoning function (Michalak et al., 1999Go) and its overexpression may affect the processing and/or folding of other membrane-associated proteins involved in excitation of a cardiomyocyte. Although such an effect cannot be excluded, we found that calreticulin overexpression in excitable spontaneously spiking embryonic cardiomyocytes slows down thapsigargin-induced Ca2+-release. It further dampens down the total amount of free Ca2+ released by the SERCA inhibitor, possibly after inhibition of the capacitative Ca2+ influx on a spike to spike basis and/or inhibition of SERCA (John et al., 1998Go). Therefore, both a Ca2+ buffering effect in the ER and a limited pool of releasable Ca2+ might contribute to decrease the rate of Ca2+ oscillations. Although the exact mechanism by which calreticulin inhibits Ca2+ efflux from the ER requires further investigation in excitable cells, overexpression of the protein prevents Ca2+-dependent generation of depolarizing currents in ES cell–derived cardiac pacemaker cells. Similarly, disturbed expression of InsP3RIs in ES cell–derived pacemaker cells by the antisense cDNA limits Ca2+ release from the stores and thus activation of the Ca2+-sensitive depolarizing membrane conductance. Altogether, the results obtained using the genetically modified ES cells (calreticulin overexpressing- and InsP3RI antisense-expressing pacemaker cells) point to a key role of Ca2+ cycling in and out of the ER for the initiation of pacemaker activity in early cardiogenesis (Figure 6). Indeed, a Ca2+ spike and in turn rhythmic oscillations of Ca2+ and membrane potential can be initiated only if the cell Ca2+ load including free ER Ca2+, buffered Ca2+ and cytosolic Ca2+ is above a threshold. If the Ca2+ load drops below threshold because of disrupted InsP3 signaling (inhibition by xestospongin C, InsP3RI antisense) or impaired CCI or SERCA activity (calreticulin overexpression), leading to a limitation of free ER Ca2+ to provide sufficient driving force for efflux from the ER, the cell is unable to trigger a Ca2+ spike (Sneyd et al., 2004Go). As a result, there can be no activation of the Ca2+-sensitive depolarizing conductance responsible for spontaneous action potentials firing, as further shown by inhibition of the later phenomenon by xestospongin C (Figure 5D).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 6. Model of InsP3-induced spontaneous activity in embryonic pacemaker cells. Ca2+ released upon InsP3 binding to its receptor activates a depolarizing conductance (Na+/Ca2+ exchanger and/or a nonspecific cationic and depolarizing conductance) and thus triggers action potential firing. CCI allows for refilling the ER. This Ca2+ cycling acting in a rhythmic and perpetual manner is a predominant pacemaking mechanism in early cardiogenesis and regulates or is required together with the If current as a basis of fetal pacemaking mechanism.

 

The InsP3-based pacemaking mechanism is conserved throughout murine development. In E14.5 embryonic atrial cells, accelerating the hydrolysis of InsP3 by overexpressing InsP3 phosphatase (Jaconi et al., 2000Go) or directly blocking the InsP3 receptor by microinjection of a specific antibody (Nakade et al., 1991Go; Miyazaki et al., 1992Go) dramatically impaired spontaneous Ca2+-spiking activity of isolated pacemaker cells. Xestospongin C also blunted spontaneous Ca2+-spiking activity in E9.5 embryonic heart. Thus, the intracellular Ca2+ signaling network conserved the ability to regulate the cardiac pacemaker throughout development. Besides ionic conductance (i.e., If, Ca2+ currents), our findings reveal in the fetal life a second cardiac pacemaking mechanism mediated by intracellular Ca2+ cycling. Whether this Ca2+-dependent mechanism is a regulator or is required together with the If current–dependent pacemaking activity and maintained in the adulthood, a stage at which InsP3RIs are confined to the conduction system (Gorza et al., 1993Go), remains to be elucidated.

In this study, we provide direct evidence that ER-mediated Ca2+ dynamics are important in excitable cells at both embryonic and fetal stages. Movement of Ca2+ in and out of the ER plays a crucial role in the excitability of embryonic cardiomyocytes. Overstimulation of the InsP3-dependent pathway (Jaconi et al., 2000Go) or perturbation of Ca2+ homeostasis in pacemaker cells during cardiac development may then be at the origin of rhythm-related cardiac diseases at the adult stage. Indeed, taking into account the refractory period of the conductive cells, a change in pulse frequency and/or rhythm after alteration of ER Ca2+ cycling in pacemaker cells is likely to lead to a conduction block, as observed in mice overexpressing calreticulin in the heart (Nakamura et al., 2001Go).


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Dr. P. Travo (Centre National de la Recherche Scientifique [CNRS], Montpellier) for skillful help in cell imaging, Dr. P. Charnet (CNRS, Montpellier) for help in electrophysiology and Dr. A. Terzic (Mayo Foundation, Rochester, MN) for critical reading of the manuscript. We are also grateful to Prof. M. Berridge for his encouraging advice in this study and to Dr. M. D. Bootman for fruitful discussions. We thank Dr. C. Erneux (Brussels, Belgium) for the gift of the InsP3 phosphatase cDNA, Dr. Matteo Mangoni (IGH, CNRS, Montpellier) for advices in monitoring If current in cells and critical review of the manuscript, and the Institut deRecherches Servier (Surennes, France) for generously providing ivabradine. We thank Chantal Jacquet and Eric Jouffre in the animal house of the IGMM for breeding the mice (CNRS, Montpellier). This study was funded by the Association Française contre les Myopathies (AFM grant No. 8524 to M.P.). A.M. is a fellow from the Ministère de la Recherche et de la Technologie. F.A. is a fellow from the Fondation de la Recherche Médicale. C.M. was a fellow from the Groupement de Réflexion sur la Recherche Cardiovasculaire. M.M. is a Canadian Institutes for Health Research Senior Investigator and AHFMR Scientist. M.P. is an INSERM established investigator.


    Footnotes
 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E04-10-0883) on March 9, 2005.

{boxd}{boxv} The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). Back

Address correspondence to: M. Pucéat (michel.puceat{at}crbm.cnrs.fr).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Accili, E. A., Proenza, C., Baruscotti, M., and DiFrancesco, D. ((2002). ). From funny current to HCN channels: 20 years of excitation. News Physiol. Sci. 17, , 32-37.[Abstract/Free Full Text]

Behfar, A., Zingman, L., Hodgson, D., Rauzier, J., Kane, G., Terzic, A., and Pucéat, M. ((2002). ). Stem cell differentiation requires a paracrine pathway in the heart. FASEB J. 16, , 1558-1566.[Abstract/Free Full Text]

Berridge, M. J., Bootman, M. D., and Roderick, H. L. ((2003). ). Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell. Biol. 4, , 517-529.[CrossRef][Medline]

Berridge, M. J., Lipp, P., and Bootman, M. D. ((2000). ). The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell. Biol. 1, , 11-21.[CrossRef][Medline]

Bony, C., Roche, S., Sasaki, T., Crackowe, M., Penninger, J., Mano, H., and Pucéat, M. ((2001). ). A specific role of phosphatidylinositol 3-kinase {gamma}: a regulation of autonomic Ca2+ oscillations in cardiac cells. J. Cell Biol. 152, , 717-728.[Abstract/Free Full Text]

BoSmith, R. E., Briggs, I., and Sturgess, N. C. ((1993). ). Inhibitory actions of ZENECA ZD7288 on whole-cell hyperpolarization activated inward current (If) in guinea-pig dissociated sinoatrial node cells. Br. J. Pharmacol. 110, , 343-349.[Medline]

Bucchi, A., Baruscotti, M., and DiFrancesco, D. ((2002). ). Current-dependent block of rabbit sino-atrial node I(f) channels by ivabradine. J. Gen. Physiol. 120, , 1-13.

Caroppo, R., Colella, M., Colasuonno, A., DeLuisi, A., Debellis, L., Curci, S., and Hofer, A. M. ((2003). ). A reassessment of the effects of luminal [Ca2+] on inositol 1,4,5-trisphosphate-induced Ca2+ release from internal stores. J. Biol. Chem. 278, , 39503-39508.[Abstract/Free Full Text]

Clapham, D. E. ((1995). ). Calcium signaling. Cell 80, , 259-268.[CrossRef][Medline]

Clapham, D. E. ((1998). ). Not so funny anymore: pacing channels are cloned. Neuron 21, , 5-7.[CrossRef][Medline]

De Smet, P., Parys, J. B., Callewaert, G., Weidema, A. F., Hill, E., De Smedt, H., Erneux, C., Sorrentino, V., and Missiaen, L. ((1999). ). Xestospongin C is an equally potent inhibitor of the inositol 1,4,5-trisphosphate receptor and the endoplasmic-reticulum Ca(2+) pumps. Cell Calcium 26, , 9-13.[CrossRef][Medline]

Fasolato, C., Pizzo, P., and Pozzan, T. ((1998). ). Delayed activation of the store-operated calcium current induced by calreticulin overexpression in RBL-1 cells. Mol. Biol. Cell 9, , 1513-1522.[Abstract/Free Full Text]

Gafni, J., Munsch, J. A., Lam, T. H., Catlin, M. C., Costa, L. G., Molinski, T. F., and Pessah, I. N. ((1997). ). Xestospongins: potent membrane permeable blockers of the inositol 1,4,5-trisphosphate receptor. Neuron 19, , 723-733.[CrossRef][Medline]

Gorza, L., Schiaffino, S., and Volpe, P. ((1993). ). Inositol 1,4,5-trisphosphate receptor in heart: evidence for its concentration in Purkinje myocytes of the conduction system. J. Cell Biol. 121, , 345-353.[Abstract/Free Full Text]

Harvey, R. P. ((2002). ). Patterning the vertebrate heart. Nat. Rev. Genet. 3, , 544-556.[CrossRef][Medline]

Hirose, K., Kadowaki, S., Tanabe, M., Takeshima, H., and Iino, M. ((1999). ). Spatiotemporal dynamics of inositol 1,4,5-trisphosphate that underlies complex Ca2+ mobilization patterns. Science 284, , 1527-1530.[Abstract/Free Full Text]

Jaconi, M., Bony, C., Richards, S. M., Terzic, A., Arnaudeau, S., Vassort, G., and Puceat, M. ((2000). ). Inositol 1,4,5-trisphosphate directs Ca(2+) flow between mitochondria and the endoplasmic/sarcoplasmic reticulum: a role in regulating cardiac autonomic Ca(2+) spiking. Mol. Biol. Cell 11, , 1845-1858.[Abstract/Free Full Text]

Jayaraman, T., Ondriasova, E., Ondrias, K., Harnick, D. J., and Marks, A. R. ((1995). ). The inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor signaling. Proc. Natl. Acad. Sci. USA 92, , 6007-6011.[Abstract/Free Full Text]

John, L. M., Lechleiter, J. D., and Camacho, P. ((1998). ). Differential modulation of SERCA2 isoforms by calreticulin. J. Cell Biol. 142, , 963-973.[Abstract/Free Full Text]

Koushik, S. V., Wang, J., Rogers, R., Moskophidis, D., Lambert, N. A., Creazzo, T. L., and Conway, S. J. ((2001). ). Targeted inactivation of the sodium-calcium exchanger (Ncx1) results in the lack of a heartbeat and abnormal myofibrillar organization. FASEB J. 15, , 1209-1211.[Free Full Text]

Krause, K. H., and Michalak, M. ((1997). ). Calreticulin. Cell 88, , 439-443.

Leahy, A., Xiong, J. W., Kuhnert, F., and Stuhlmann, H. ((1999). ). Use of developmental marker genes to define temporal and spatial patterns of differentiation during embryoid body formation. J. Exp. Zool. 284, , 67-81.[CrossRef][Medline]

Loebel, D. A., Watson, C. M., De Young, R. A., and Tam, P. P. ((2003). ). Lineage choice and differentiation in mouse embryos and embryonic stem cells. Dev. Biol. 264, , 1-14.[CrossRef][Medline]

Lyons, G. E., Schiaffino, S., Sassoon, D., Barton, P., and Buckingham, M. ((1990). ). Developmental regulation of myosin gene expression in mouse cardiac muscle. J. Cell Biol. 111, , 2427-2436.[Abstract/Free Full Text]

Maltsev, V. A., Wobus, A. M., Rohwedel, J., Bader, M., and Hescheler, J. ((1994). ). Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ. Res. 75, , 233-244.[Abstract/Free Full Text]

Mangoni, M. E., and Nargeot, J. ((2001). ). Properties of the hyperpolarization-activated current (I(f)) in isolated mouse sino-atrial cells. Cardiovasc. Res. 52, , 51-64.[Abstract/Free Full Text]

Mery, L., Mesaeli, N., Michalak, M., Opas, M., Lew, D. P., and Krause, K. H. ((1996). ). Overexpression of calreticulin increases intracellular Ca2+ storage and decreases store-operated Ca2+ influx. J. Biol. Chem. 271, , 9332-9339.[Abstract/Free Full Text]

Meyer, N., Jaconi, M., Ladopoulou, A., Fort, P., and Puceat, M. ((2000). ). A fluorescent reporter gene as a marker for ventricular specification in ES-derived cardiac cells. FEBS Lett. 478, , 151-158.[CrossRef][Medline]

Michalak, M., Corbett, E. F., Mesaeli, N., Nakamura, K., and Opas, M. ((1999). ). Calreticulin: one protein, one gene, many functions. Biochem. J. 344, (Pt 2), 281–292.

Miyazaki, S., Shirakawa, H., Nakada, K., Honda, Y., Yuzaki, M., Nakade, S., and Mikoshiba, K. ((1992). ). Antibody to the inositol trisphosphate receptor blocks thimerosal-enhanced Ca(2+)-induced Ca2+ release and Ca2+ oscillations in hamster eggs. FEBS Lett. 309, , 180-184.[CrossRef][Medline]

Moorman, A. F., and Lamers, W. H. ((1999). ). Development of the conduction system of the vertebrate heart. In: Heart Development, ed. R. P. Harvey, N. Rosenthal, New York: Academic Press, 195-207.

Moosmang, S., Stieber, J., Zong, X., Biel, M., Hofmann, F., and Ludwig, A. ((2001). ). Cellular expression and functional characterization of four hyperpolarization-activated pacemaker channels in cardiac and neuronal tissues. Eur. J. Biochem. 268, , 1646-1652.[Medline]

Morkin, E. ((2000). ). Control of cardiac myosin heavy chain gene expression. Microsc. Res. Tech. 50, , 522-531.[CrossRef][Medline]

Nakade, S., Maeda, N., and Mikoshiba, K. ((1991). ). Involvement of the C-terminus of the inositol 1,4,5-trisphosphate receptor in Ca2+ release analysed using region-specific monoclonal antibodies. Biochem. J. 277, , 125-131.

Nakamura, K., Robertson, M., Liu, G., Dickie, P., Guo, J. Q., Duff, H. J., Opas, M., Kavanagh, K., and Michalak, M. ((2001). ). Complete heart block and sudden death in mice overexpressing calreticulin. J. Clin. Invest. 107, , 1245-1253.[Medline]

Pfaffl, M. W., Horgan, G. W., and Dempfle, L. ((2002). ). Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, , e36.[Abstract/Free Full Text]

Porter, G. A., Jr., and Rivkees, S. A. ((2001). ). Ontogeny of humoral heart rate regulation in the embryonic mouse. Am. J. Physiol. Regul. Integr. Comp. Physiol. 281, , R401-R407.[Abstract/Free Full Text]

Puceat, M., Hilal-Dandan, R., Strulovici, B., Brunton, L. L., and Brown, J. H. ((1994). ). Differential regulation of protein kinase C isoforms in isolated neonatal and adult rat cardiomyocytes. J. Biol. Chem. 269, , 16938-16944.[Abstract/Free Full Text]

Putney, J. W., Jr., Broad, L. M., Braun, F. J., Lievremont, J. P., and Bird, G. S. ((2001). ). Mechanisms of capacitative calcium entry. J. Cell Sci. 114, , 2223-2229.

Rizzuto, R., Pozzan, T., and Carafoli, E. ((2002). ). Ca2+ on the move: ways and means to translate a multifarious signal. Trends Pharmacol. Sci. 23, , 348-350.[CrossRef][Medline]

Shago, M., Flock, G., Leung Hagesteijn, C. Y., Woodside, M., Grinstein, S., Giguere, V., and Dedhar, S. ((1997). ). Modulation of the retinoic acid and retinoid X receptor signaling pathways in P19 embryonal carcinoma cells by calreticulin. Exp. Cell Res. 230, , 50-60.[CrossRef][Medline]

Sneyd, J., Tsaneva-Atanasova, K., Yule, D. I., Thompson, J. L., and Shuttleworth, T. J. ((2004). ). Control of calcium oscillations by membrane fluxes. Proc. Natl. Acad. Sci. USA 101, , 1392-1396.[Abstract/Free Full Text]

Stieber, J., Herrmann, S., Feil, S., Loster, J., Feil, R., and Biel, M. ((2003). ). The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart. Proc.