|
|
|
|
Vol. 16, Issue 6, 2719-2733, June 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Tubulin Complex Proteins on Microtubule Nucleation and Catastrophe in Fission YeastDepartment of Microbiology, Columbia University College of Physicians and Surgeons, New York, NY 10032
Submitted August 6, 2004;
Revised March 2, 2005;
Accepted March 5, 2005
Monitoring Editor: David Drubin
| ABSTRACT |
|---|
|
|
|---|
-tubulin complexes (
-TuCs) are known as microtubule (MT) nucleators, their function in vivo is still poorly defined. Mto1p (also known as mbo1p or mod20p) is a
-TuCassociated protein that recruits
-TuCs specifically to cytoplasmic MT organizing centers (MTOCs) and interphase MTs. Here, we investigated
-TuC function by analyzing MT behavior in mto1
and alp4 (GCP2 homologue) mutants. These cells have free, extra-long interphase MTs that exhibit abnormal behaviors such as cycles of growth and breakage, MT sliding, treadmilling, and hyperstability. The plus ends of interphase and spindle MTs grow continuously, exhibiting catastrophe defects that are dependent on the CLIP170 tip1p. The minus ends of interphase MTs exhibit shrinkage and pauses. As mto1
mutants lack cytoplasmic MTOCs, cytoplasmic MTs arise from spindle or other intranuclear MTs that exit the nucleus. Our findings show that mto1p and
-TuCs affect multiple properties of MTs including nucleation, nuclear attachment, plus-end catastrophe, and minus-end shrinkage. | INTRODUCTION |
|---|
|
|
|---|
-tubulin complex (
-TuC). In many organisms,
-tubulin is found in large ring-shaped complexes (
-TuRCs; Zheng et al., 1995
-TuSCs) and at least five other proteins. These complexes are embedded in the centrosomal matrix, where they anchor MT minus ends. In vitro,
-TuRCs template new MT assembly and cap MT minus ends (Moritz and Agard, 2001
The in vivo functions of
-TuRCs, however, remain largely unexplored. Conditional mutants in
-TuC components in yeast and fungi have defects in mitosis, suggestive of roles in SPB function and in a mitotic spindle checkpoint (Sobel and Snyder, 1995
; Marschall et al., 1996
; Spang et al., 1996
; Paluh et al., 2000
; Vardy and Toda, 2000
; Hendrickson et al., 2001
; Jung et al., 2001
; Prigozhina et al., 2001
; Vardy et al., 2002
; Prigozhina et al., 2004
). RNAi depletion of
-tubulin in Caenorhabditis elegans leads to defects in MT nucleation primarily during interphase (Strome et al., 2001
; Hannak et al., 2002
). Paradoxically, the most striking defects seen in yeast cells are in the regulation of MT length, suggestive of a function in modulating MT plus ends (Paluh et al., 2000
; Vardy and Toda, 2000
; Vogel et al., 2001
).
The fission yeast Schizosaccharomyces pombe has at least three types of MTOCs throughout its cell cycle (Hagan, 1998
). During mitosis, the spindle pole body (SPB) organizes intranuclear spindle MTs from its nuclear face and astral microtubules from its cytoplasmic face. During midanaphase, the SPB is extruded from the nuclear envelope and is established in the cytoplasm adjacent to the nucleus, where it remains through interphase (Ding et al., 1997
). During interphase, 35 cytoplasmic MT bundles are organized from the outer nuclear envelope. One of these is associated with the SPB, whereas the others are organized from interphase MTOCs (iMTOCs; Tran et al., 2001
). These MTs are arranged along the long axis of the cell and form antiparallel bundles in which MT minus ends are stable within an MT overlap zone near the nucleus, and dynamic MT plus ends grow toward the cell tips (Drummond and Cross, 2000
; Tran et al., 2001
). After contact with cell tips, MTs undergo catastrophe and shrink back to the nucleus. These MTs position the nucleus at the cell middle (Tran et al., 2001
). The equatorial MTOC (eMTOC) forms at the contractile ring and nucleates MTs into both daughter cells during cytokinesis (Heitz et al., 2001
). S. pombe
-TuC components include gtb1p (
-tubulin), alp4p (homologue of Saccharomyces cerevisiae spc97/human GCP2), and alp6p (homologue of S. cerevisiae spc98/human GCP3), which all localize to all three types of MTOCs and are essential for viability and mitosis (Horio et al., 1991
; Paluh et al., 2000
; Vardy and Toda, 2000
; Hendrickson et al., 2001
; Fujita et al., 2002
; Zimmerman et al., 2004b
). These
-TuC components are also distributed in satellites that move bidirectionally along interphase microtubules and are even present at MT plus ends (Sawin et al., 2004
; Zimmerman et al., 2004b
). Mutants in these proteins have abnormally long MTs, but the role of
-TuCs in regulating MT dynamics has not been well characterized.
Mto1p (also known as mbo1p or mod20p) is a
-TuCassociated protein that mediates
-TuC recruitment specifically to cytoplasmic MTOCs (Sawin et al., 2004
; Venkatram et al., 2004
). Mto1p is predicted to be composed predominantly of coiled-coils and shares significant homology along its length with the Aspergillus nidulans nuclear positioning gene ApsB (Suelmann et al., 1998
) and with regions of S. pombe pcp1p and Drosophila centrosomin at its N-terminus (Sawin et al., 2004
). mto1
mutants are unable to localize other
-TuC components to cytoplasmic MTOCs and have severe defects in the organization of cytoplasmic interphase MTs (Sawin et al., 2004
; Venkatram et al., 2004
). However, they still target
-TuCs to the SPBs and are able to form mitotic spindles and divide. The viability of mto1
mutants therefore makes them more amenable for phenotypic analyses of nonessential processes than conditional lethal
-TuC mutants.
Here, we characterize highly unusual MT behaviors in mutants defective in
-TuC function, mto1
and alp4. We find that cytoplasmic MTs in mto1
mutants do not originate from cytoplasmic MTOCs, but from intranuclear MTs that exit the nucleus through the nuclear envelope. Quantitative analysis of MT dynamics showed persistent growth without catastrophe at MT plus ends and MT treadmilling. Similar phenotypes are also seen in the
-TuC mutant, alp4, indicating that these phenotypes reflect a loss of
-TuC function. Thus, these studies provide new insights into multiple cellular functions of
-TuCs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, mto1-GFP, and mto1-CFP strains were constructed using a PCR-directed method for site-directed recombination (Bahler et al., 1998
, primers 5'-TCGCTCCTTTGAAATTGTTACAAGAGTCAATGCCTACTGCTTTGGATTTGCTTATGTCGAAGTTCGTTTTCTAATCAATTCGGATCCCCGGGTTAATTAA-3' and 5'-TGTCAATTAAATTCTCCAACTAAGTAGATATGTACTGGTGATTAAGAAAAGCTATATACTTCAACCGCAAACTATCCAGAGAATTCGAGCTCGTTTAAAC-3' were used to amplify kanMX6 from pFA6a-kanMX6. pDQ105 (Ding et al., 1998
|
Cytoskeletal Analysis
Rhodamine phalloidin staining was performed on formaldehyde-fixed cells as described (Pelham and Chang, 2001
). Cells expressing integrated fusions from endogenous promoters, such as mto1p-GFP and tip1p-YFP, were grown in exponential phase overnight in 23-ml liquid cultures with shaking at 30°C. For imaging microtubules in living cells, cells carrying pDQ105 (Ding et al., 1998
) were grown as described (Zimmerman and Chang, 2004), except those used for measurements, which were grown to exponential phase overnight in 23 ml liquid cultures with shaking at 30°C. mto1
tip1
and alp4-1891 tip1
double mutants were likewise grown overnight. For MT regrowth experiments, cells were kept on ice for 20 min and then either imaged immediately on a cold agar pad (Tran et al., 2001
) or allowed to recover for incremental periods of time at 25°C before imaging. Cells were imaged on agar pads for time-lapse acquisition over long time periods or under a coverslip in 1 µl of liquid media and sealed with VALAP (Tran et al., 2004
). Methyl-benzidazole-carbamate (MBC; Aldrich, Milwaukee, WI) was used at 25 µg/ml final concentration (Tran et al., 2001
).
Generally, MT imaging was carried out in multiple focal planes 0.40.5 µm apart using a spinning disk confocal microscope. MT dynamics and mto1p-GFP movements were measured in cells grown overnight at 30°C (mto1
, tip1
, mto1
tip1
, mto1p-GFP, wild type) or in 58 h cultures at 30°C or 36°C (alp4-1891). Images were recorded in 3.5-s (to measure growth and shrinkage rates), 5.5-s (to measure dwell times), or 13-s (mto1p-GFP) intervals at 25°C (except alp4-1891 was imaged at 30 or 36°C). Kymographs were created using NIH ImageJ 1.30. Fluorescent speckle microscopy measurements were done using a single focal plane. Measurements of MT growth, shrinkage rates, and dwell times were carried out relative to MT speckles in kymographs. Speckles present in MTs were imaged in cells grown to exponential phase overnight in 23-ml liquid cultures with shaking at 30°C.
Fluorescence intensity of tip1p-YFP was measured by recording the maximum intensity of single dots in single focal planes using Openlab 3 (Improvision, Lexington, MA).
Spindle orientation and elongation were measured in mto1
and wild-type cells by spinning disk confocal microscopy at 29°C in 45-s intervals. Measurements of spindle length and angle were obtained using NIH ImageJ 1.30.
Microscopy
Microscopy was carried out using a wide-field microscope station (for DIC and mto1p-GFP imaging) or a spinning disk confocal imaging station (Perkin Elmer-Cetus Wallac, Norwalk, CT), using 100x NA 1.4 and 60x NA 1.4 objectives and with acquisition and analysis using Openlab 3 (Improvision) and NIH Image J software (Pelham and Chang, 2001
). FRAP experiments were performed using a separate wide-field imaging system described by Khodjakov et al. (2004
).
| RESULTS |
|---|
|
|
|---|
Mutants Have Defects in Microtubule Organization
As shown previously (Sawin et al., 2004
; Venkatram et al., 2004
), mto1
cells were viable and exhibited near normal growth rates, but many cells were bent (31% showed >10° bend relative to the long axis of the cell vs. 2% wt, n = 200) and often divided asymmetrically (Figure 1), suggestive of microtubule defects (Toda et al., 1983
). 3D time-lapse confocal microscopy and GFP markers revealed strikingly abnormal MT organization (Supplementary Movies 14). mto1
cells typically possess fewer interphase MT bundles than wild-type cells (Figure 1, BF). Although most wild-type cells (76%; n = 319) have three or more MT bundles, 91% of mto1
cells had 2 or fewer MT bundles. MTs were absent in 20% of cells, although diffuse GFP-tubulin fluorescence was observed (Figure 1C; n = 467). The interphase MTs in mto1
cells were often abnormally long and continued to grow and curve upon reaching a cell tip, rather than undergoing catastrophe (Figure 1, B and F). Occasionally, these curved MTs broke, and the resulting fragments either continued to grow or shrank away (Figure 1F, Supplementary Movie 3). No clear instances of cytoplasmic MT nucleation were detected in 45 cells imaged >30 min each. Instead, MTs appeared to regenerate continually from preexisting MTs through multiple cycles of breakage and fragment elongation. We also noted that many MTs formed thick dynamic bundles, in which MTs often moved along each other and sometimes were observed to merge or slide apart (Figure 1E).
|
mutants had a strong defect in the attachment of MTs to the nuclear envelope. mto1
MTs were often dissociated from the nucleus and the SPB (Figure 1, D and F). Although the SPB was always associated with one MT bundle in wild-type cells (98%, n = 177), in mto1
cells, the SPB was often not associated with any cytoplasmic MTs (71% of cells with MTs, n = 161). In addition, mto1
MTs did not originate from or shrink back toward the nucleus (Figure 1F), showing that they were not organized from the nucleus. Consistent with a defect in MT attachment, the nucleus was mispositioned in most mto1
cells, (69% vs. 4% wt, n = 300; Figure 1, B, E, and F). Thus, mto1p is required for iMTOC function at the nuclear envelope.
mto1
Cells Show Abnormal Dynamics at Both MT Plus and Minus Ends
Next, we measured the dynamic parameters of these interphase MTs in mto1
mutants. Quantitative measurements of MT dynamics in
-TuC mutants have not been reported previously, potentially because of problems of MT bundling and sliding. We sought to analyze individual MTs by using GFP-
-tubulin speckles as fiduciary marks (fluorescent speckle microscopy) to consider the movement of the MT lattice (Tran et al., 2001
; Waterman-Storer and Danuser, 2002
). In wild-type cells, we measured an MT plus-end growth rate of 3.6 ± 0.86 µm/min (n = 25) and an MT plus-end shrinkage rate of 12.2 ± 1.7 µm/min (n = 15), consistent with previous data (Drummond and Cross, 2000
; Feierbach and Chang, 2001
; Tran et al., 2001
; Figure 2A). MT minus ends were generally nondynamic and were embedded in iMTOCs and the SPB (Tran et al., 2001
). In mto1
cells, we analyzed MTs with clear speckle patterns, which were more likely to be individual MTs. In these MTs, we observed a strikingly consistent pattern: one end grew, whereas the other end did not (100% cells, n = 17).
|
cells were slightly higher than those of wild-type MT plus ends (4.4 ± 0.85 µm/min; n = 24; Figure 2A). We confirmed that these were MT plus ends by localizing MT plus-end binding proteins (tea1p and the CLIP170 homologue tip1p) to the growing MT tip (see below). Significantly, we found that the MT plus ends had a profound defect in MT catastrophe. In our analysis of speckled MTs, we noted no instances of MT plus-end shrinkage within the time frames of the movies (25 min). These ends did not shrink upon hitting the cell tip, but instead continued to grow and curved around the cell tips (n = 15). MT plus ends labeled with the MT plus-end protein tea1p-YFP showed a similar behavior (Figure 2E). A reduction in MT catastrophe events was apparent in other time lapse images of interphase MTs, but the polarity of the MTs in many of these cases was less clear.
Rates of MT shrinkage were more heterogeneous and could be sorted into at least two distinct groups (Figure 2A, right, blue). In one group, shrinkage rates of 35 µm/min were measured at predicted MT minus ends. Because this shrinkage rate was similar to the rate of MT plus-end growth, striking examples of treadmilling were observed, in which the length of the MT remained constant but the movement of GFP-tubulin fluorescent speckles showed continuous flux (Figure 2, A and B, Supplementary Movie 5). A second group of MT shrinkage rates (>8 µm/min) occurred at both predicted MT minus and plus ends. Plus end shrinkage often occurred at a newly generated plus-end after an MT break, indicating that these do not exhibit the same stability as an established growing plus end. This rapid shrinkage rate often led to the loss of the entire MT. The reason for these two classes of MT minus-end shrinkage rates is not clear.
We also detected many examples of paused MT ends. In most cases, pauses occurred at predicted MT minus ends and did not necessarily occur near the cell surface. Figure 2C shows an example of an MT minus end that transitions from a shrinking to a pausing state.
To analyze the behavior of MTs within bundles in mto1
cells, we made photobleach marks on GFP-tubulinlabeled MT bundles. These photobleach marks on interphase MT bundles could be maintained for at least 20 min (Figure 2D), whereas similar marks in wild-type MT bundles were maintained for less than 5 min (unpublished data). Thus, mto1
cells possess hyperstable MTs.
In summary, mto1
cells exhibit significant abnormalities at MT minus ends and plus ends. These properties lead to novel MT behaviors, such as treadmilling and hyperstability.
Mto1p Affects eMTOC and Astral MT Formation and Spindle Dynamics in Mitosis
Although mto1
cells were competent to assemble mitotic spindles, they did exhibit a number of defects during mitosis. Time-lapse measurements of individual spindles labeled with GFP-tubulin showed that all three phases of mitosis (Phase 1, Prophase and Spindle Assembly; Phase 2, Metaphase-Anaphase A; Phase 3, Anaphase B spindle elongation; Nabeshima et al., 1998
; Mallavarapu et al., 1999
) generally occurred with normal kinetics in mto1
cells (Figure 3). In contrast to Venkatram et al. (2004
) but in agreement with the less direct measurements of Sawin et al. (2004
), we observed no defects in the rate of spindle elongation in Anaphase B (0.92 ± 0.17 µm/min for mto1
;n = 13 vs. 0.97 ± 0.11 µm/min for wt; n = 15; Figure 3C, Supplementary Movie 6).
|
mto1
mitotic spindles lacked cytoplasmic astral MTs (Phase 3; 100% cells, n = 50; Figure 3, A and B). This may reflect a loss of
-TuC activity from the cytoplasmic face of the SPB. The normal spindle elongation rate indicates that cytoplasmic astral MTs are not required for spindle elongation. This finding supports conclusions from recent laser ablation studies that physically cut astral MTs or SPBs (Khodjakov et al., 2004
; Tolic-Norrelykke et al., 2004
).
Intranuclear MTs (astral-like MTs in Phase 2) were present normally in mto1
cells (Figure 3B, Phase 2, see arrows; Sagolla et al., 2003
; Zimmerman et al., 2004a
). As also reported by Venkatram et al. (2004
), mto1
cells possessed more misoriented spindles at the onset of metaphase than did wild-type spindles (33% of spindles >30° off, n = 18, vs. 8% of wild-type spindles, n = 25). However, mto1
Phase 2 spindles still rotated and corrected the spindle angle to a similar extent as wild-type cells (for spindles that were 1530° offset, avg. rotation = 9.8° in mto1
, n = 7, vs. 9.2° in wt, n = 8; Figure 3D). Thus, mto1
cells did not have a defect in spindle rotation; rather the apparent spindle misorientation in Phase 2 in mto1
cells may arise from abnormal SPB positions before mitosis, which could be secondary to defects in interphase MT attachment.
mto1
cells also lacked eMTOC function. MTs did not grow out from the future cell division site during anaphase and after anaphase (Figure 3B). However, cells were able to septate and divide without obvious cytokinesis defects, suggesting that the eMTOC is not required for cell division and contractile ring function (our unpublished data). The eMTOC has been proposed to maintain the position of the contractile ring in a septation mutant (Pardo and Nurse, 2003
), but we did not detect significant problems in ring stability in mto1
(our unpublished observations).
At the end of mitosis, mto1
cells exhibited a defect in spindle breakdown (Figure 3, C and E). Instead of disassembling when the nuclei reached the cell tips, spindles continued to grow (Figure 3, B, C, and E) and bent into S-shaped structures (Figure 3B, 28'09''-29'07''). To determine the cause of this overelongation, we generated photobleach marks in GFP-tubulin labeled spindles. In wild-type cells, photobleach marks made in the middle of the spindle during early anaphase initially disappeared, reflecting plus-end polymerization of spindle MTs. Later in anaphase, two photobleach marks reappeared near the ends of the spindle and then moved apart with the poles (Mallavarapu et al., 1999
; Khodjakov et al., 2004
). This behavior shows that MT minus ends at the SPB are nondynamic and do not undergo minus-end directed flux. Photobleach marks in mto1
cells behaved similarly (n = 13; Figure 3F). Notably, the distance between the poles and the photobleach marks did not change over time (final distance/initial distance = 0.97 ± 0.14; n = 13; Figure 3F), showing that in contrast to the minus ends of cytoplasmic MTs, MT minus ends were not dynamic in these spindles. The behavior of the photobleach marks also showed that no additional abnormal MTs were nucleated from the SPBs during anaphase. Therefore, spindle overelongation may result from a defect in stopping plus-end elongation of spindle MTs at the end of anaphase.
mto1
Cells Nucleate MTs Only from Inside the Nucleus
The apparent absence of cytoplasmic MTOCs poses the question: how do cytoplasmic MTs form in these cells? To further characterize MT nucleation activity, we examined MT regrowth after cytoplasmic MTs were depolymerized by cold shock for 20 min (Mata and Nurse, 1997
; Chen et al., 1999
; Tran et al., 2001
; Figure 4, A, left, and B, left). Within 1 min of shifting to 25°C, wild-type cells began to renucleate MTs and restored a normal MT array by 5 min. In contrast, most mto1
cells either slowly formed short MTs or nucleated no MTs at all (as was also seen in Sawin et al., 2004
). Short MTs were found in 61% of cells within 5 min (n = 50) and in 74% after a 15-min shift at 25°C (n = 76; Figure 4C). Z-section images of cells coexpressing a nuclear envelope marker confirmed that these MT bundles were intranuclear (Figure 4E). Generally, one end of these MTs was in close proximity with the SPB (unpublished data). Most of these MTs grew and shrank within the nuclear envelope, whereas some were more stable (Figure 4D, Supplementary Movie 7). Many MT bundles projected outside the body of the nucleus (Figure 4E). Consistent with this, we observed that the nuclear envelope formed thin protrusions that grew and shrank (Figure 4, G and H, Supplementary Movie 8). Such intranuclear MTs and nuclear envelope distortions were not observed in wild-type cells. Several criteria confirmed that these cells with intranuclear MTs were in interphase and not in mitosis: these cells did not exhibit cytokinetic actin rings or separated SPBs and were often shorter than mitotic cells (Figure 4, B and H; our unpublished observations).
|
cells (Figure 4D, 1 h 30' to 1 h 34', Supplementary Movie 7). We tested whether the abrupt change in MT behavior could represent the entry of the intranuclear MT into the cytoplasm by puncturing the nuclear envelope. We assayed for breaks in nuclear envelope integrity using a soluble nuclear GFP marker, NLS-GFP-
gal (Yoshida and Sazer, 2004
gal fluorescence, which were sometimes accompanied by abrupt retractions in the nuclear envelope (Figure 4F, Supplementary Movie 9). These breakthroughs were observed in 12% of cells imaged for 1 h after cold shock (as assayed by changes in MT dynamics; n = 48; Figure 4D, unpublished data). Thus, interphase intranuclear MTs that pierce the nuclear envelope contribute to the formation of a significant fraction of the cytoplasmic MTs, but there are probably additional sources as well.
Additional observations revealed that the majority of cytoplasmic MTs originated from mitotic spindles. After mitosis, some spindle MTs in mto1
cells recovering from cold shock were released into the cytoplasm (unpublished data). Consistent with this, 67 ± 8% of newly divided cells possessed cytoplasmic MTs, irrespective of the recovery time after cold shock (n
25 for samples treated without cold shock and 30', 60', 120', and 180' after cold shock). In addition, after 3 h (about a cell cycle period), cytoplasmic MTs were reestablished in 70% of cells (n = 102).
We next tested whether persistent spindle MTs also contribute to the establishment of interphase cytoplasmic MTs in noncold-shocked mto1
cells. Time-lapse images showed that after anaphase, persistent spindle MTs frequently grew past the nucleus, split from the main spindle, and curved around cell tips. These MTs then typically broke into fragments that continued to propagate within the cytoplasm (Figure 3B, 28'0'' to 42'47''; see also Sawin et al., 2004
). Images of the nuclear envelope and the NLS-GFP-
gal marker suggested that these spindle MTs do not puncture the nuclear envelope as during interphase, but rather enter the cytoplasm when the nuclear envelope fissions at the spindle midzone at the end of anaphase (our unpublished data). Time-lapse images showed that most cytoplasmic MTs originated in this manner. Short intranuclear MTs were also present in postmitotic cells (Figure 3B, 31'03'' to 38'53''; see also Figure 4I, arrow) and occasionally seeded the formation of cytoplasmic MTs. However, most of these intranuclear MTs did not persist later in interphase (12% of cells exhibited both interphase intranuclear MTs and cytoplasmic MTs; n = 85). In summary, these findings in mto1
mutant cells document an unusual mechanism of generating cytoplasmic MTs from intranuclear MTs.
alp4 Mutants Have Similar Phenotypes
We next examined if mto1p functions primarily through its effects on
-TuCs. Consistent with previous findings (Sawin et al., 2004
; Venkatram et al., 2004
), in mto1
cells, alp4p-GFP was present only at the SPB and was absent from MT satellites, iMTOCs, and the eMTOC (Figure 5, A and B). Thus, mto1p is required to localize
-TuC components to cytoplasmic MTOCs.
|
-TuCs, we predicted that other
-TuC mutants would share common phenotypes.
-TuC mutants (gtb1, alp4-1891, alp6-719, and alp16
) have abnormally long interphase and spindle MTs, similar to those seen in mto1
(Paluh et al., 2000
mutants, including MT growth around cell tips, MT breakage, MT disassociation from the nucleus, MT treadmilling, and pausing (Figure 5, CF, Supplementary Movie 10). The eMTOC was either nonfunctional or very weak, nucleating just one or two MTs at a time (Supplementary Movie 11). Astral MTs (Phase 3) were also absent, weak, or unstable (Supplementary Movie 11). After anaphase, intranuclear MTs were occasionally present. Thus, the properties of the partial loss-of-function mutant alp4-1891 were similar to, but less severe than, the mto1
mutant, indicating that these mto1
phenotypes are likely to be caused by a loss of
-TuC function.
Mto1p Localizes to MTOCs and Motile MT Satellites
We reexamined the localization of mto1p, using live cell imaging of functional GFP and CFP fusions expressed under the endogenous mto1 promoter (see also Sawin et al., 2004
; Venkatram et al., 2004
). Mto1p-CFP colocalized with alp4p-YFP at all cellular MTOCs: the SPB throughout the cell cycle, the eMTOC during septation, iMTOCs and satellites during interphase (Figure 6, A and D). Mto1p colocalized precisely with alp4p in satellites (Figure 6D, top panel). In contrast to the perinuclear staining seen in fixed cells (Sawin et al., 2004
), live cell imaging showed that mto1p-GFP localized, like alp4p and rsp1p, to 24 discrete perinuclear iMTOC dots in MBC-treated cells (Zimmerman et al., 2004b
).
|
-TuC components also localize to satellites, which exhibit complex patterns of movement on MTs (Zimmerman et al., 2004b
-TuCs on microtubules.
Role of the CLIP170 tip1p in Regulating MT Catastrophe
An apparent paradox is why
-TuCs are needed for MT catastrophe at the plus end. We present a number of possible models in the discussion. One attractive possibility is that
-TuCs affect the loading, function, or dynamics of MT plus-end factors that regulate MT catastrophe. The CLIP170-like protein tip1p is an MT plus-end protein that prevents premature MT catastrophe. In tip1
mutants, MTs grow at normal rates, but catastrophe upon hitting the side or tip of the cell and have a decreased dwell time at the cell surface before catastrophe (Brunner and Nurse, 2000
).
We found that the strong MT catastrophe defect in
-TuC mutants was dependent on tip1p. Instead of long, curved MTs, mto1
tip1
double mutant cells exhibited a single straight MT bundle that did not curve around cell tips (Figure 7, DF, Supplementary Movies 12 and 13). MTs within a bundle grew to the cell tips and shrank back repeatedly to the MT bundle. The dwell time in these cells was comparable to that of tip1
(32 ± 11 s for tip1
mto1
vs. 23 ± 9 s for tip1
and 113 ± 44 s for wt; n = 16, 18, and 12, respectively; Figure 7C). In other MT bundles, the ends grew very slowly or not at all (Supplementary Movie 13: bottom right cell, top bundle, also top cell), similar to intranuclear MTs in mto1
mutants. Similar types of bundles were seen in alp4-1891 tip1
mutants (at 30°C; unpublished data). Thus, the ability to undergo catastrophe is restored in these
-TuC mutants by deleting tip1.
|
Consistent with this phenotype, tip1p-YFP often accumulated in large dots at the ends of MTs in mto1
mutants (Figure 7A, see arrows). Fluorescence intensity measurements of tip1p-YFP showed a significant increase in the amount of tip1p at MT plus ends (19.8 ± 6 arbitrary fluorescence units in mto1
, compared with 11.2 ± 2.9 in wild-type; n = 39 and 43, respectively; Figure 7B). Immunoblots showed no clear change (<2-fold) in tip1p protein levels in mto1 mutant extracts (our unpublished observations). Because excess tip1p could be imagined to stabilize MTs and prevent catastrophe, these accumulations of tip1p provide a potential explanation for MT plus-end stabilization.
Another difference between mto1
tip1
and mto1
cells was that most of the MT bundles appeared to be attached to the nucleus. 3D confocal microscopy of cells expressing markers for the nuclear envelope and microtubules showed that a part of each MT bundle resided inside the nucleus in at least 65% of interphase cells (n = 335). Portions of the MT bundles projecting from the nuclear envelope were partially or entirely covered with nuclear pores, indicating that many of the projected MTs were encased within the nuclear envelope (Figure 7E, see arrows; Supplementary Movie 13). Images of nuclear pore-GFP alone confirmed that most cells contained projections of the nuclear envelope (unpublished observations). Dynamic portions of the MT bundles were free of nuclear pores, while nondynamic bundles were often decorated with them (Supplementary Movie 13). Thus a single MT bundle may have portions inside and outside the nucleus: the MTs outside the nuclear envelope were dynamic, whereas the MTs entirely inside were less dynamic.
Time-lapse images showed that many of these MT bundles were derived from persistent spindle MTs. In some cells, the spindle did not break down entirely after anaphase, but persisted through interphase as a single straight MT bundle (Figure 7F, top cell, Supplementary Movie 13). In other cells, the spindle shrank back to the newly divided nucleus after anaphase, and a new intranuclear MT grew into an MT bundle projecting from the nucleus (Figure 7F, bottom cell). There were only rare free MT bundles in mto1
tip1
cells. These free MTs, which were apparently derived from these intranuclear MTs, formed antiparallel bundles and exhibited catastrophe at cell tips like the nuclear-attached bundles. Thus, many of the unusual interphase MT bundles in mto1
tip1
cells represent persistent mitotic spindle MTs or other intranuclear MTs that are unable to dissociate from the nucleus.
In summary, the CLIP170-like protein tip1p modulates the MT plus-end behavior of mto1 and alp4 mutants. The catastrophe defects were dependent on tip1p, and tip1p itself accumulates at higher levels on the MT plus ends. One possibility is that
-TuC directly or indirectly regulates the dissociation of tip1p from MT plus ends, a step that may contribute to MT catastrophe.
Localization of Other MT Plus-end Factors
We also examined two other factors that affect MT catastrophe: the kelch repeat protein tea1p and the kinesin klp5p (Mata and Nurse, 1997
; West et al., 2001
; Behrens and Nurse, 2002
; Garcia et al., 2002
). Both tea1p and klp5p were localized properly on MTs in mto1
mutants and unlike tip1p, did not accumulate at higher levels (Figure 2E, Supplementary Figure 1A, unpublished data).
However, we noted some abnormal distributions of tea1p at other locations that may explain other aspects of mto1 mutants. Tea1p regulates cell polarity and is deposited by MTs at cell tips (Mata and Nurse, 1997
; Behrens and Nurse, 2002
; Feierbach et al., 2004
). In mto1
cells, tea1p was often present on the sides of cells and was either not concentrated at the cell tips or was unevenly distributed between them (Supplementary Figure 1B; unpublished data). We observed that a growing MT plus end appeared to deposit tea1p dots along the side of the cell (Figure 2E, arrows in merge), suggesting that MT catastrophe is not required for tea1p deposition. The abnormal distribution of tea1p at the cortex may explain the altered cell shapes seen in mto1
mutants. In addition, we also observed tea1p-YFP on the mitotic spindle in mto1
cells, which was never seen in wild-type cells (Supplementary Figure 1, C and D). Tea1p localized along the length of short spindles (47% of short spindles; n = 18), and localized either diffusely or on the poles of long spindles (Supplementary Figure 1D, unpublished data). In contrast, tip1p was not detected on the spindle (unpublished data). This is the first observed example of tea1p in the nucleus and provides a potential explanation for the altered spindle dynamics and mild chromosomal segregation defects seen in mto1
cells (Sawin et al., 2004
).
| DISCUSSION |
|---|
|
|
|---|
-Tubulin Complex
-TuCs, we have studied a number of novel abnormal MT behaviors in cells defective for
-TuC function. We used mto1
mutants as a way to study the effects of
-TuCs on cytoplasmic MTs in otherwise viable cells. As mto1p is required to anchor
-TuCs specifically at cytoplasmic MTOCs and MTs, the mto1
phenotype may be equivalent to a loss-of-function of
-TuCs at these sites. Similar MT behaviors were also found in an alp4 mutant. Our results largely agree with the previous reports on this gene product (also known as mbo1p or mod20p; Sawin et al., 2004
-TuC proteins (Vardy and Toda, 2000
-TuC mutants in any organism, which reveal a striking defect on MT plus catastrophe. Second, we demonstrate several novel MT behaviors such as treadmilling, pausing, and exit of MTs from the nucleus. Third, we find a possible role for the CLIP170 homologue, tip1p, in the regulation of MT catastrophe by
-TuCs. Thus, our studies provide new insights into the in vivo functions of
-TuCs in MT dynamics and organization at both ends of the microtubule.
Nuclear Origin of Cytoplasmic Microtubules
Two clear functions of mto1p and
-TuCs are in MT nucleation and MT attachment to the nucleus. Mto1p is required for MT nucleation from all cytoplasmic MTOCs (the cytoplasmic face of the SPB, iMTOCs, and the eMTOC). During interphase, mto1
cells lack iMTOCs and possess either no MTs or small numbers of free, abnormal MTs. Notably, mto1
mutants are among the first mutants identified with a strong defect in MT-nuclear attachment and support a model that iMTOCs and
-TuCs are required for MT attachment.
In trying to understand the origin of cytoplasmic MTs in mto1
cells lacking cytoplasmic nucleating sites, we found that most, if not all, cytoplasmic MTs are originally nucleated inside the nucleus, either as spindle MTs or as interphase intranuclear MTs. The interphase intranuclear MTs, which are not normally seen in wild-type cells, may arise from
-TuC activity inside the nucleus, or possibly even from
-TuC-independent nucleation activity, for instance from the kinetochores (Khodjakov et al., 2003
). Spindle MTs exit the nucleus at the end of anaphase, as the nuclear envelope is broken. Intranuclear MTs can also exit the nucleus by directly puncturing the nuclear envelope during interphase and producing a break in the nuclear envelope that is then rapidly repaired. Once in the cytoplasm, these MTs grow into the cytoplasm and become free MTs that regenerate via repeated cycles of MT fragment breakage and growth or stabilization. The mto1
tip1
double mutant gives strong support to the intranuclear origin of these MTs. In this double mutant, the spindle or intranuclear MTs also project out of the nucleus, but remain bundled with the nuclear MTs, creating an unusual situation where the MT bundle skewers the nuclear envelope. The difference between mto1
and mto1
tip1
mutants suggests that continued growth of the projected MTs is required for generation of free cytoplasmic MTs. These behaviors document unusual and novel mechanisms of cytoplasmic MT formation and propagation.
Regulation of MT Plus-end Catastrophe
Our quantitative analysis of MT dynamics reveals effects of
-TuCs at both MT plus and minus ends. We found strong defects in MT plus-end catastrophe: MT plus ends continued to grow even after hitting cell ends, leading to overly long, curled MTs. We also found that free MT minus ends exhibited shrinkage (in at least two classes of rates) and also pauses, but no growth, consistent with MTs in other cell types (Dammermann et al., 2003
). The phases of pause and shrinkage may reflect inherent properties of the MT minus end, as such behaviors are observed in vitro (Desai and Mitchison, 1997
). Although treadmilling MTs and hyperstable MTs have been noted previously in other cell types (Rodionov and Borisy, 1997
; Margolis and Wilson, 1998
; Rodionov et al., 1999
; Dammermann et al., 2003
; Shaw et al., 2003
; Gundersen et al., 2004
), this is the first report (to our knowledge) of such behaviors in yeast cells.
mto1
mitotic spindle MTs have normal nondynamic MT minus ends and abnormal MT plus ends that continue to grow at the end of anaphase. Although this may reflect a possible checkpoint defect at the end of mitosis (Prigozhina et al., 2004
), we suggest that this spindle defect is caused by the same MT plus-end catastrophe defect seen in interphase. Importantly, this spindle phenotype suggests that the defects at MT plus ends are separable from nucleation defects at MT minus ends.
We can imagine several models to explain how
-TuCs may influence MT plus ends: First, mto1
mutants generally have fewer MTs than wild-type cells and therefore probably have an increased concentration of tubulin dimers in the soluble pool. This difference in dimer concentration could explain the slight increase in MT plus-end polymerization rate and perhaps some of the variability in MT minus-end depolymerization rates. An increased dimer pool could also potentially inhibit MT catastrophe. However, we found that another mutant, rsp1
, also has reduced number of MT bundles, but still shows normal MT catastrophe (Zimmerman et al., 2004b
; our unpublished data). Preliminary measurements of GFP-tubulin fluorescence levels suggest that at least some of these rsp1
cells have less total MT polymer than some mto1
cells. Therefore, an increase in soluble tubulin levels alone may not be sufficient to account for the MT catastrophe defect in
-TuC mutant cells.
Second,
-TuCs could affect the loading or unloading of MT regulatory factors. We provide evidence that
-TuCs affect the CLIP170 homologue tip1p, as mto1
cells have increased amounts of tip1p at MT plus ends, which may contribute to MT stabilization. The MT catastrophe defect in mto1
cells is dependent on tip1p, as mto1
tip1
double mutants exhibited MT catastrophe. Thus, one function of
-TuCs may be to remove tip1p from the MT plus end for MT catastrophe at the cell end. Alternatively, the increased amounts of tip1p at MT ends may reflect the prolonged growth phase of the MT plus end. Whether the effects of
-TuCs on tip1p are direct or indirect remains to be tested.
-TuC satellites localize to MT plus ends and thus could potentially regulate tip1p at MT plus ends in a direct manner. However, one hint that satellites may not be strictly necessary for regulating MT plus ends lies in the fact that rsp1 mutants, which have no or reduced satellites, exhibit normal MT plus-end dynamics (Zimmerman et al., 2004b
).
-TuCs could also affect the loading of MT regulatory factors from MTOCs. For instance, in budding yeast, properties at the SPB regulate the specific loading of factors onto astral MTs (Liakopoulos et al., 2003
; Maekawa et al., 2003
; Usui et al., 2003
). However, we note that tip1p, as well other MT regulatory proteins tea1p and klp5p, are all loaded properly on mto1
MTs.
Third,
-TuCs affect MT anchorage to the nucleus, which may be necessary to generate MT compression forces that can contribute to MT catastrophe. Elegant in vitro studies show that isolated MTs attached to a substrate will catastrophe after hitting a barrier because of MT compression forces (Janson et al., 2003
). In mto1
mutants, MT minus ends are not anchored, and thus there may be less compressive force on plus ends when they contact the cell tip. However, we have observed that in alp4 mutant cells, occasional MTs that are still attached to the nucleus can also exhibit catastrophe defects (unpublished data). Further, the free MTs that are sometimes seen in normal cells, exhibit normal catastrophe patterns.
Fourth,
-TuCs could affect the MT lattice structure.
-TuCs may template the normal 13 protofilaments of MTs, and MTs formed in the absence of
-TuCs generally have abnormal numbers of protofilaments (often 14; Chretien et al., 1992
; Chretien and Fuller, 2000
). Although the effects of abnormal protofilaments have not been characterized in vivo, these differences could possibly alter MT flexibility or interactions with MT associated proteins, such as the CLIP170 homologue, tip1p. However, this template model does not account for the catastrophe defects in mto1
spindle MTs, which are presumably still nucleated from
-TuCs on the nuclear face of the SPB.
In summary, the reasons for MT catastrophe defects in mto1
are still not clear, and multiple mechanisms may be contributory. Further testing of these models will provide general insights into the molecular mechanism of MT catastrophe. These studies illustrate that there is still much to learn about the functions of
-TuCs, and their continued study promises to illuminate molecular and functional aspects of regulation on both ends of the microtubule.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used:
-TuCs, gamma tubulin complexes;
-TuRCs, gamma ring complexes; SPB, spindle pole body; MT, microtubule; MTOC, microtubule organizing centers; iMTOC, interphase MTOC; eMTOC, equatorial MTOC.
![]()
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Fred Chang (fc99{at}columbia.edu).
| REFERENCES |
|---|
|
|
|---|
Behrens, R., and Nurse, P. ((2002). ). Roles of fission yeast tea1p in the localization of polarity factors and in organizing the microtubular cytoskeleton. J. Cell Biol. 157, , 783793.
Brunner, D., and Nurse, P. ((2000). ). CLIP170-like tip1p spatially organizes microtubular dynamics in fission yeast. Cell 102, , 695704.[CrossRef][Medline]
Chen, C. R., Li, Y. C., Chen, J., Hou, M. C., Papadaki, P., and Chang, E. C. ((1999). ). Moe1, a conserved protein in Schizosaccharomyces pombe, interacts with a Ras effector, Scd1, to affect proper spindle formation. Proc. Natl. Acad. Sci. USA 96, , 517522.