![]() |
|
|
Vol. 16, Issue 6, 2759-2771, June 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A.-Butenandt-Institut/Zellbiologie, Ludwig-Maximilians-Universität München, D-80336 München, Germany
Submitted January 25, 2005;
Revised March 7, 2005;
Accepted March 23, 2005
Monitoring Editor: Erika Holzbaur
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
45 kDa and is characterized by seven WD40-repeats, which are thought to form a
-propeller fold as in structurally similar
-subunits of heterotrimeric G-proteins. Indeed, LIS1 could be identified as a subunit of a brain-specific isoform of the G-protein-like platelet-activating factor acetylhydrolase. Yet, the first clues for the molecular function of LIS1 in neuronal migration came from a filamentous fungus. The Aspergillus nidulans LIS1 homologue, NUDF, was identified in a screen for nuclear distribution mutants (Xiang et al., 1995
protects NUDEL from dephosphorylation by PP2A (Toyo-Oka et al., 2003
The essential role of LIS1 for neuronal migration appears to be mediated not only through its interaction with dynein. Recently Kholmanskikh and coworkers showed that LIS1 haploinsufficiency resulted in a reduced F-actin content at the leading edge of migrating cerebellar granule cells (Kholmanskikh et al., 2003
). Interestingly, this effect was accompanied by altered activity of small GTPases regulating cortical actin dynamics. Although Rac1 and Cdc42 activities were down-regulated, the antagonizing GTPase RhoA was up-regulated under these conditions. However, no binding of LIS1 to one of these GTPases or their regulators could be shown. Thus, the relationship between cellular LIS1 levels and GTPase activities remained unclear.
In addition to its role in actin dynamics and dynein function at the cell cortex, LIS1 is also a regulator of microtubule dynamics. LIS1 binds to microtubules in vivo and in vitro and promotes microtubule elongation by reducing the catastrophe rate (Sapir et al., 1997
). Recently we have shown in Dictyostelium amoebae that DdCP224, a member of the ubiquitous XMAP215-family of microtubule-associated proteins (Ohkura et al., 2001
), is also involved both in dynein-dependent microtubule interactions with the cell cortex and in the promotion of microtubule growth (Gräf et al., 2003
; Hestermann and Gräf, 2004
). Because of the similarity of LIS1 protein function in mammalian and fungal cells and the roles of DdCP224 in Dictyostelium cells, we suspected a functional relationship between LIS1 and XMAP215-family proteins and performed a functional analysis of DdLIS1, the Dictyostelium LIS1 homologue. We show that DdLIS1 is a microtubule-associated protein that also constitutes an integral component of the centrosome. Disruption of DdLIS1 function affects microtubule tip interactions with the cell cortex, cell morphology, and actin dynamics. Furthermore, we demonstrate for the first time an association of a LIS1 protein with a member of the XMAP215-family of microtubule-associated proteins and direct binding to an actin-regulating small GTPase. The elucidation of these interactions may help to explain the central role of DdLIS1 in the dynamics of both the microtubule and actin cytoskeleton.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ZAP (Gräf et al., 2000b
-vector and an NsiI site located within the DdLIS1 coding sequence. These restriction sites were used to construct a complete DdLIS1 cDNA clone in SLE307 (EMBL database accession no. AJ512794
[GenBank]
).
Vector Construction, Protein Expression, and Antibodies
To express DdLIS1 as a maltose-binding fusion protein in Escherichia coli, a PCR-fragment including the complete DdLIS coding sequence flanked by EcoRI and XbaI restriction sites was cloned into pMALc2. The fusion protein was expressed and purified by amylose affinity chromatography as described by the manufacturer (New England Biolabs, Frankfurt, Germany) and used for the custom immunization of a rabbit (Dr. J. Pineda Antikörperservice, Berlin, Germany).
Likewise, a His-DdLIS1 vector based on pQE30 (Qiagen, Hilden, Germany) was constructed using the PCR product obtained after amplification of the DdLIS1 coding sequence with an upstream BamHI linker primer and a downstream SalI linker primer. His-DdLIS1 was expressed and purified by NiNTA affinity chromatography as described by the manufacturer (Qiagen).
For expression of MBP-DdLIS1 in Dictyostelium, the MBP-DdLIS1/pMALc2 vector was used as a template to amplify the sequence encoding the fusion protein with a suitable upstream MBP-KpnI linker primer and a downstream DdLIS1-BamHI linker primer. The obtained MBP-DdLIS1 PCR fragment was subsequently cloned into p1ABsr8 (Gräf et al., 2000b
) and transformed into Dictyostelium cells.
The gene replacement vector for generation of the DdLIS1-D327H point mutant was based on pLPBLP (Faix et al., 2004
). The final plasmid contained the 5' untranslated sequence and the complete coding sequence including the point mutation upstream from the blasticidin S resistance cassette and 887 base pairs of 3' untranslated sequence of the gene downstream from the resistance cassette. A genomic DdLIS-fragment containing the point mutation was generated by PCR in a two-step approach using two mutagenesis primers that were used to introduce a new SalI site, resulting in the desired single amino acid exchange. Thus, two PCR fragments with 1466 and 1261 base pairs, respectively, were generated using genomic DNA as a template. For the first fragment, an upstream BamHI linker primer binding to the 3' untranslated region of the gene and a downstream mutagenesis primer GTCGACTACCAGTAGCTAAATAACCACATT were used, and for the second fragment an upstream mutagenesis primer GTCGACATAAAACTATTAAAATTTGGG and a downstream PstI linker primer binding to the 5' end of the coding sequence. Both PCR fragments were cleaved with BamHI/SalI and SalI/PstI, respectively, and were both cloned into pLPBLP in a single step using the BamHI and PstI sites of the vector. The resulting plasmid was cleaved with HindIII and KpnI and used to clone 887 base pairs of 3' untranslated region of the gene, which was generated by PCR using genomic DNA as a template and an upstream HindIII linker primer directed to the beginning of the 3' untranslated region and a downstream primer (named LIS114) binding immediately downstream from the endogenous KpnI site. Before transformation of Dictyostelium cells, the final gene replacement vector was linearized by cleavage with BamHI and KpnI, and the desired DdLIS1/blasticidin cassette was isolated from an agarose gel. After blasticidin selection, genomic DNA was isolated using the HighPure PCR template preparation kit (Roche, Mannheim, Germany) and positive clones were identified by a genotyping PCR using the LIS114 downstream primer and a GTGGTTATTTAGCTACTGGTAGTC upstream primer. The latter primer is specific for the point mutation because its last four bases fit only to the mutated but not to the original genomic sequence and the binding site for LIS114 is not located within the linearized transformation construct. Therefore amplification of a specific 2.6-kb PCR fragment from genomic DNA is only possible in clones, where gene replacement of endogenous DdLIS1 by the artificial construct through homologous recombination has occurred and which carry the D327H point mutation.
The vector for DIC
C overexpression corresponds to the DIC
C construct published previously (Ma et al., 1999
). In brief the coding sequence encoding the N-terminal fragment of the Dictyostelium dynein IC (DIC; 279 amino acids) was amplified by PCR using linker primers and cDNA as a template. The PCR product was cloned into a derivative of pA15GFPSSEB2 using NheI and BamHI. This cloning vector is identical to pDiscGFPSSEB2 (Daunderer and Gräf, 2002
) except that the discoidin promoter is replaced by the actin15 promoter.
Light Microscopy
Light microscopy was essentially performed as described previously (Gräf et al., 1998
). All images and movies were acquired on a Zeiss Axiovert 200M/510META laser scanning system (Oberkochen, Germany) equipped with a 63x/1.4 lens. Live cells were viewed in glass bottom dishes (MatTek, Ashland, MA) either in phosphate buffer or under agar overlay (Fukui et al., 1987
) at low laser intensity. GFP-actin cell lines were cultivated overnight in coculture with Klebsiella aerogenes in 17 mM Na-K-phosphate buffer (pH 6.0) in order to increase their resistance to phototoxic effects. For reflection interference contrast microscopy (RICM) a 633-nm HeNe-laser was used and the reflection image was recorded without any filter. In case of 4D live cell imaging, three to five z-slices per time point were acquired at a frame rate of two per second and a resolution of up to 512 x 512 pixels. Z-stacks were projected onto one plane using a brightest point algorithm and ImageJ software (National Institutes of Health, Bethesda, MD). All images from fixed cells were processed through the Huygens Essential Deconvolution software (SVI, Hilversum, Netherlands) using the maximum likelihood estimation method.
Estimation of the Actin Content
Cells cultivated overnight in shaking culture (density approx. 3 x 106/ml) were spread onto 5-cm Petri dishes to
50% confluency and allowed to settle for 10 min. Subsequently, medium was exchanged for phosphate buffer with or without 0.2 µM latrunculin A (Sigma, Deisenhofen, Germany) and cells were incubated for 1 h at room temperature. Cells lysis occurred on ice by rinsing the attached cells with 2 ml of ice cold lysis buffer (80 mM Na-PIPES, pH 6.8, 5 mM EGTA, 5 mM MgCl2, 1 mM dithiothreitol, 1% Triton X-100, 25% glycerol, protease inhibitors; Gräf et al., 1998
). Two hundred fifty microliters of the lysate were ultracentrifuged with 80.000 rpm for 40 min at 4°C using a Beckman TLA100 rotor (Krefeld, Germany). The pellet containing the F-actin fraction was resuspended in 250 µl of lysis buffer. Both F- and G-actin (supernatant) fractions were supplemented with SDS-gel loading buffer and separated by SDS gel electrophoresis and Western blotting. The blot was stained using antiDictyostelium-actin antibodies. Actin bands were visualized using an enhanced chemiluminescence kit (Applichem, Darmstadt, Germany).
Other Methods
Dictyostelium cells (strain AX2) were cultivated and transformed as reported earlier (Gräf et al., 1998
, 2000b
). SDS gel electrophoresis and Western blotting were carried out according to Gräf et al. (1998
). Centrosomes were isolated as described previously (Gräf, 2001a
). Preparation of cell extracts of Dictyostelium cells was reported by Daunderer and Gräf (2002
). Immunoprecipitation was performed according to Hestermann and Gräf (2004
) and GST pull-down assays were carried out as described by Faix et al. (1998
).
|
-tubulin YL1/2 (Chemicon, Hofheim, Germany), mouse monoclonal anticomitin (Weiner et al., 1993Secondary antibodies were from Dianova (Hamburg, Germany; all cy3 and peroxidase conjugates), Sigma (alkaline phosphatase conjugates); and Molecular Probes (Hilversum, Netherlands; all AlexaFluor 488 conjugates).
| RESULTS |
|---|
|
|
|---|
DdLIS1 Is a Microtubule-associated Protein and an Integral Centrosomal Component together with Dynein
The subcellular localization of DdLIS1 was investigated using polyclonal antibodies raised against the recombinant protein expressed in E. coli (Figure 2A). DdLIS1 was localized along microtubules and at the centrosome throughout the entire cell cycle (Figure 2, BD). In contrast to human LIS1 (Faulkner et al., 2000
), microtubule labeling by anti-DdLIS1 antibodies was not biased toward the microtubule plus ends either at the peripheral microtubule tips in interphase or at kinetochores during mitosis. To test whether the centrosomal localization of DdLIS1 is microtubule-dependent, we analyzed the presence of DdLIS1 at isolated centrosomes. This assay was used because treatment with microtubule-depolymerizing drugs such as thiabendazole or nocodazole is rather ineffective in Dictyostelium and leads to only partial depolymerization of microtubules (Kitanishi et al., 1984
), whereas isolated Dictyostelium centrosomes are completely devoid of microtubules (Gräf et al., 1998
). The Dictyostelium centrosome is a cytosolic, nucleus-associated body that lacks centrioles. Instead it consists of a three-layered core structure surrounded by the corona, which is the functional equivalent of the pericentriolar matrix of centriole-containing centrosomes (Euteneuer et al., 1998
; Gräf et al., 2000a
). Confocal images of isolated centrosomes labeled with anti-DdLIS1 antibodies clearly revealed that DdLIS1 is part of the centrosomal corona (Figure 2D). When labeled with antibodies against known components such as DdCP224 or
-tubulin (Gräf et al., 2000b
), the corona displays a ring-like appearance in confocal images. In deconvolved confocal images, the diameter of the anti-DdCP224-labeled ring was always larger than that observed upon labeling with anti-DdLIS1 antibodies, suggesting that DdLIS is localized closer to the unlabeled centrosomal core structure than DdCP224 (Figure 2D). Therefore, DdLIS1 is a genuine centrosomal component. This was unexpected, because centrosomal LIS1 localization was thought to be mediated through its binding to the dynein heavy chain (Sasaki et al., 2000
), which one would expect to require microtubules to localize it to the centrosome through its microtubule minus end-directed motor activity. However, our confocal analysis of isolated centrosomes revealed that the dynein heavy chain, which precisely colocalizes with DdCP224 at the centrosomal corona, is an integral component of the Dictyostelium centrosome as well (Figure 2E).
|
-tubulin revealed an extraordinary motility of these microtubule arrays (Figure 3, C and D; see supplementary videos 1 and 2). The centrosome circulated rapidly and continuously, often close to the cell cortex, with most of the microtubules dragged behind like a comet tail (Figure 3D'). In GFP-
-tubulinexpressing control cells, the centrosome always stayed close to the cell center and moved only over short distances (Figure 3C'). Compared with GFP-
-tubulin cells where the centrosome moved with an average speed of 0.054 µm/s (n = 5; SD = 0.007) and a maximal speed of 0.15 µm/s, centrosomes in DdLIS1-D327H cells moved three times faster with an average speed of 0.142 µm/s (n = 21; SD = 0.022) and a maximum of even 0.5 µm/s (Figure 3E). Within 7 min, the area encircled by the moving centrosomes was 15-fold larger in DdLIS1-D327H cells than in GFP-
-tubulin cells (110 µm2 vs. 7.2 µm2; Figure 3E). This microtubule/centrosome phenotype was strikingly similar to Dictyostelium cells overexpressing the motor domain of the dynein heavy chain (Koonce and Samso, 1996
|
|
|
A further phenotype frequently observed in DdLIS1-D327H cells was an unusually large distance between the centrosome and the nucleus. In control cells, the centrosome was always tightly linked to the nucleus, with a distance to the nucleus rarely exceeding its own diameter (Figure 6A). However, in DdLIS1-D327H cells the centrosome was often located more than 2 µm away from the nucleus (Figure 6B), which, interestingly, can also be weakly labeled with antidynein heavy chain antibodies (Figure 7).
|
|
Taken together, the cellular defects observed in DdLIS1-D327H cells suggest that DdLIS1 is required for Golgi integrity, nucleus/centrosome association, and dynein/dynactin-mediated interactions of microtubule tips with the cell cortex.
DdLIS1 Interacts with Dynein and DdCP224
The similarity of the DdLIS1-D327H phenotype and the dynein and DdCP224 mutants mentioned above raised the question whether DdLIS1 could interact not only with dynein but also with DdCP224. Thus, we performed coimmunoprecipitations of these proteins from cytosolic Dictyostelium extracts using specific polyclonal antibodies and protein Gcoated beads. Because the similar size of DdLIS1 and antibody heavy chains complicated the identification of DdLIS1 in Western blots of immunoprecipitates, we have overexpressed DdLIS1 as a fusion protein with the E. coli maltose-binding protein (MBP) in Dictyostelium (Gräf, 2001b
). MBP-DdLIS1 was overexpressed
10-fold as judged from Western blots stained with anti-DdLIS1 antibodies. Using cytosolic extracts from these cells, the
90-kDa MBP-DdLIS1 fusion protein clearly coprecipitated with DdCP224 using anti-DdCP224 antibodies (Figure 8). Conversely, DdCP224 was coprecipitated with DdLIS1 when anti-DdLIS1 antibodies were used for coimmunoprecipitation (Figure 8). As expected for a LIS1-family protein, DdLIS1 also coprecipitated with the dynein heavy chain (Figure 8).
|
We wondered whether disruption of DdLIS1 function affects subcellular localization of Dynein and DdCP224; however, we observed no displacement of the dynein heavy chain or DdCP224 in DdLIS1-D327H mutants, either at the cell cortex nor at isolated centrosomes or, in case of the dynein heavy chain, at the nucleus (Figure 7). Nevertheless, the coimmunoprecipitation of these proteins from cytosolic extracts, their colocalization and the similarity of phenotypes in corresponding mutants indicate that dynein, DdLIS1 and DdCP224 act together in the cortical attachment of microtubules.
DdLIS1-D327H cells and MBP-DdLIS1 Overexpressors Exhibit Altered Cell Shape
Overexpression of MBP-DdLIS1 frequently disrupted radial microtubule arrays in a similar manner as described for DdLIS1-D327H cells, suggesting a dominant-negative effect of MBP-DdLIS1 overexpression (Figure 9). However, the microtubule disruption phenotype upon MBP-DdLIS1 overexpression was less frequent (
25% of cells in freshly transformed cultures) and tended to disappear in older cultures with reduced MBP-DdLIS1 expression.
|
Because impaired LIS1 function strongly affects the motile behavior of neuronal precursors, we suspected that the DdLIS1-D327H point mutation or MBP-DdLIS1 overexpression may interfere with Dictyostelium cell motility. In neither case we could detect any defect in random cell motility or chemotaxis (our own unpublished data), but both MBP-DdLIS1 overexpressors and DdLIS1-D327H mutants were altered in cell shape and appeared much flatter than untransformed cells. This became obvious when both cell lines were viewed by reflection interference contrast microscopy (RICM) in comparison with control cells. This technique, which can be applied at conventional confocal microscopes, visualizes the contact surface of a cell to the substratum in a reflection image (Weber, 1999
). In both MBP-DdLIS1 overexpressors and DdLIS1-D327H mutants the cell contact surface to the coverslip was greatly enlarged (Figure 10; see supplementary videos 46). Furthermore, these flat cells appeared to be more active in filopodia formation (arrowheads in Figure 10).
|
|
|
C), a treatment that is known to disrupt dynein function (Ma et al., 1999
C overexpressors, we were unable to perform similar live cell studies as in case of the other cell lines or to obtain sufficient amounts of cells to evaluate the F-/G-actin ratio. Nevertheless, our data support a dynein-dependent role of DdLIS1 in actin dynamics.
DdLIS1 May Alter Actin Dynamics through Its Interaction with the Small GTPase Rac1A
We wondered how DdLIS1 could participate in the regulation of actin dynamics. Because DdLIS1 showed no clear colocalization with actin, we suspected that DdLIS1 might interact with regulators of actin dynamics such as small GTPases. This assumption was also supported by the observation that both DdLIS1-D327H mutants and MBP-DdLIS1 overexpressors were more active in filopodia formation, a process regulated by Rac1 GTPases (Dumontier et al., 2000
). Therefore, we investigated whether DdLIS1 was able to interact with Rac1A (Bush et al., 1993
), the Dictyostelium Rac1 homologue (Dumontier et al., 2000
). Because the available antibodies against Rac1A were not suitable for immunoprecipitations, we performed a GST-Rac1A pull-down experiment. GST-Rac1A preloaded with either nonhydrolyzable GTP
S or GDP was incubated with a cytosolic Dictyostelium extract (strain AX2). In both cases endogenous DdLIS1 clearly coprecipitated with GST-Rac1A (Figure 13, lanes 13). The interaction between DdLIS1 and Rac1A was specific as we detected no coprecipitation when the cytosolic extracts were incubated with GST alone. GST-Rac1A also specifically brought down purified, recombinant, 6xHis-tagged DdLIS1 (His-DdLIS1; Figure 13, lanes 46). This proves that DdLIS1 and Rac1A interact directly with each other. Again, the interaction was not dependent on the guanosine nucleotide, GTP
S or GDP that was bound to GST-Rac1A. When the GST-Rac1A pull-down assay was performed with cytosolic extracts from MBP-DdLIS1 overexpressing cells (Figure 13, lane 79), the MBP-DdLIS1 fusion protein surprisingly showed no coprecipitation with GST-Rac1A, although it was overexpressed
18-fold (as calculated from Western blot band intensities; Figure 13, lane 10). This suggests that the bulky N-terminal MBP-tag interfered with the ability of DdLIS1 to bind Rac1A resulting in a dominant-negative effect on DdLIS1 function.
|
| DISCUSSION |
|---|
|
|
|---|
DdLIS1 was also strongly localized along microtubules, but there was no bias of its distribution toward microtubule plus ends as observed in mammalian cells, where LIS1 seems to cooperate with CLIP-170 and dynein/dynactin in the interaction of microtubule tips with capturing sites at the cell cortex (Coquelle et al., 2002
). This suggests that DdLIS1 might not be necessary for microtubule capture itself, however, our data demonstrate that it is certainly required for maintenance of radial microtubule arrays and centrosome positioning near the centroid of the cell (Figure 3). This process is apparently based on microtubule pulling forces provided by dynein that is evenly distributed at the Dictyostelium cell cortex (Koonce and Khodjakov, 2002
). The first experimental evidence for the necessity of cortical dynein/dynactin for centrosome positioning and maintenance of microtubule arrays came from Koonce and coworkers (Koonce and Samso, 1996
; Koonce et al., 1999
), who overexpressed the dynein motor domain in Dictyostelium. As a consequence, microtubules frequently lost contact with the cell cortex and trailed behind an extraordinarily motile centrosome that circulated around, often close to the cell cortex. This phenotype could also be elicited by overexpression of fragments of the dynein IC (Ma et al., 1999
), an N-terminal fragment of the Dictyostelium XMAP215-homologue DdCP224 (DdCP224
C; Hestermann and Gräf, 2004
) or, as described in this work, by interfering with DdLIS1 function through the D327H point mutation or overexpression of dominant-negative MBP-tagged DdLIS1. The simplest explanation for this phenotype is that all these manipulations disrupt dynein/dynactin-mediated linkage of membrane structures with microtubules. The observation of Golgi dispersal in all Dictyostelium cell lines mentioned above strongly supports this view, because dynein/dynactin-mediated coupling of Golgi vesicles and microtubules is crucial for Golgi positioning in the centrosomal vicinity (Burkhardt et al., 1997
). Consequently, disrupted dynein/dynactin-mediated linkage of membrane structures and microtubules causes dissociation of Golgi vesicles from microtubules and, in a similar manner, loss of cortical tethering of microtubule ends. However, remaining, still functional cortical dynein/dynactin complexes could exert asymmetric pulling forces on single microtubules, resulting in rapid displacement of the centrosome with all the untethered microtubules dragged behind (reviewed in Gräf et al., 2004
). In this work we have provided live cell data supporting the existence of such cortical pulling forces. Supplementary Movie3 reveals that microtubules are not just depolymerized once they lose their connection to the centrosome in early prophase, but that they move toward and along the cell cortex. It is conceivable that these microtubule movements are driven by cortical dynein.
The problems in dynein/dynactin-dependent linkage of membrane structures and microtubules could arise either from an inability of the dynein/dynactin complex to bind to microtubules, from dissociation of dynactin from membrane structures or, as it seems to occur in dynein IC mutants and DdCP224
C cells (Ma et al., 1999
; Hestermann and Gräf, 2004
), from dissociation of dynein from the dynactin complex. In case of our DdLIS1 mutants it appears more likely that the mutant phenotypes are based on defective binding of membrane associated dynein/dynactin to microtubules, because we found no indications for reduced presence of the dynein heavy chain at any of its localizations.
Because both DdCP224 (Hestermann and Gräf, 2004
) and DdLIS1 interact with dynein and each other in the cytosol, it is likely that these proteins cooperate in Golgi positioning and the interaction of microtubule ends with the cell cortex. We cannot judge whether DdLIS1 and DdCP224 and dynein interact directly or indirectly, because so far it has been impossible to express functional, recombinant DdCP224 or dynein for in vitro binding assays. The interaction between a LIS1 and an XMAP215-family protein is shown here for the first time. However, because of the functional and structural conservation of these proteins, it is likely that it will also be found in higher cells where it could also be involved in microtubule/cortex interactions and centrosome positioning. The requirement of cortical dynein/dynactin for centrosome positioning in mammalian cells has been demonstrated in wound-healing experiments (Dujardin et al., 2003
). In fibroblast monolayers, cells at the wound edge reorient their centrosomes toward the direction of migration during the healing process (Schliwa et al., 1999
). Centrosome reorientation between the leading edge of the cell and the nucleus is blocked by inhibition of cytoplasmic dynein and dynactin and regulated through the small GTPase Cdc42 and protein kinase C
(Etienne-Manneville and Hall, 2001
; Palazzo et al., 2001
). This suggests that cortical dynein/dynactin is required for capturing of microtubules extending into cortical regions of a freshly formed pseudopod. An involvement of LIS1 in this process has not been demonstrated yet; however, it could explain at least part of the neuronal migration defect in lissencephaly.
Cortical anchorage of microtubule ends is a prerequisite for nucleokinesis, a major aspect of neuronal cell motility. The term nucleokinesis describes the "reeling in" of the nucleus into the freshly extended leading process of the migrating neuron. At the leading process, cortically anchored dynein is thought to exert a force on microtubules, which extend from the nucleus-associated centrosome to the leading edge. In this process, LIS1 appears to be not only required for cortical dynein function but also for the linkage of the centrosome to the nucleus. Recently, (Tanaka et al., 2004
) could show in migrating cerebellar granule neurons that the distance between the centrosome and the nucleus was significantly larger in case of LIS1 haploinsufficiency. According to a model established in Caenorhabditis elegans, centrosome/nucleus attachment is mediated by centrosomally bound microtubules together with dynein immobilized at the nuclear surface and it is maintained through SUN and Hook-family proteins (Malone et al., 2003
). It is conceivable that the role of LIS1 in this pathway is also mediated by dynein as in case of almost all other known LIS1 functions. This view is supported by our observation of a small fraction of the dynein heavy chain at the nucleus in immunofluorescence specimens in Dictyostelium. Thus, our data clearly support a dynein-dependent role of LIS1 in centrosome/nucleus association, even in cells with different centrosomal structure and closed mitosis such as Dictyostelium amoebae.
Until recently, the severe defects in neuronal cell migration observed upon compromised LIS1 function were mainly attributed to the role of LIS1 in microtubule-dependent dynamic processes through the regulation of dynein (Gupta et al., 2002
). Yet, Kholmanskikh et al. (2003
) have just shown that the actin cytoskeleton also contributes to the migration defect in LIS1-deficient neurons. Haploinsufficiency of LIS1 caused a reduced F-actin content at the leading edge of migrating neurons, which was accompanied by dysregulation of Rho-GTPases. Although RhoA was up-regulated under these conditions, the activities of the antagonistic GTPases Rac1 and Cdc42 were decreased. The motility defect of LIS1 deficient neurons was rescued when Rac1 and Cdc42 activity could be restored by inhibition of the RhoA effector p160ROCK. These data suggested that LIS1 promotes actin polymerization through the regulation of Rho-GTPase activities. However, no direct interaction of LIS1 with Rho-GTPases or any of their effectors or modulators could be shown. Because microtubule growth has been shown to stimulate Rac1 activity and thereby to promote actin polymerization at the leading edge (Waterman-Storer et al., 1999
), LIS1 could also increase Rac1 activity indirectly through its role as a suppressor of microtubule catastrophes and promoter of increased MT length (Sapir et al., 1997
).
In this article we have demonstrated for the first time a direct interaction of a LIS1-family protein with a Rac1-homologue (Dictyostelium Rac1A) by GST-pull down assays. This suggests that LIS1 could regulate actin dynamics directly through Rho-family GTPases. Because MBP-tagged DdLIS1 was essentially unable to bind Rac1A although it displayed the same subcellular localization as endogenous DdLIS1, we concluded that its overexpression exerts a dominant-negative effect, possibly through replacement of endogenous DdLIS1. This explains why MBP-DdLIS1 overexpression in Dictyostelium caused phenotypes, which were rather similar to those observed in DdLIS1-D327H cells and in LIS1+/ cerebellar granule cells with reduced LIS1 activity (Kholmanskikh et al., 2003
). In all these cases, the F-actin content was reduced.
Furthermore, the microtubule-related phenotypes suggested a dominant-negative effect as well, because MBP-DdLIS1 overexpression caused Golgi dispersal and indicated reduced cortical pulling forces. By contrast, in mammalian cells LIS1 overexpression resulted in Golgi compaction and disordered microtubule arrays, which are indicative for increased cortical microtubule pulling forces (Faulkner et al., 2000
; Smith et al., 2000
). There are two likely explanations for the dominant-negative effect of MBP-DdLIS1 overexpression on dynein function. First, overexpressed MBP-DdLIS1 could sequester other dynein/dynactin-regulating binding partners, which would then be missing at the cell cortex or Golgi apparatus where they are required for proper dynein function. Second, the failure of MBP-DdLIS1 to associate with other binding partners such as Rac1A could be responsible for the disruption of dynein function.
How could DdLIS1 be involved in Rac1A-dependent actin dynamics? Rac1A regulates the cortical actin cytoskeleton through the actin-bundling proteins cortexillin I and II. Both are required for cortical stiffness and are directed to cortical sites with activated Rac1A through their Rac1A effector DGAP1 (Faix, 2002
). It is unlikely that DdLIS1 acts as a Rac1A effector in this pathway, because it binds both Rac1A-GDP and Rac1A-GTP
S. Yet, it is more likely that DdLIS1 is required for Rac1A activation or for delivery of Rac1A to its site of action. This view is supported by the fact that MBP-tagged DdLIS1 localizes similar to endogenous DdLIS1 but does not bind to Rac1A. Replacement of endogenous DdLIS1 by overexpressed, nonfunctional MBP-DdLIS1 would lead to reduced amounts of active Rac1A at the cortex.
Traveling waves of actin polymerization appear to recruit Arp2/3-rich actin foci that are distributed all over the substrate attached surface of the cell (Bretschneider et al., 2004
). Such foci are also visible in Supplementary Movie8 (for example, see time points 308350 s). Although traveling actin waves have been described in untransformed Dictyostelium cells (Vicker, 2002
; Bretschneider et al., 2004
), we have only rarely encountered them in our AX2 wild-type control cells. Wave appearance seemed to depend on the cell shape, because traveling actin waves could only be detected in flattened cells. Yet, such cells were rare in AX2 cultures but were rather frequently observed after latrunculin treatment and upon disruption of DdLIS1 function because of the D327H mutation or MBP-DdLIS1 overexpression. This suggests that both the appearance of flattened cells and traveling actin waves were based on a reduced cortical F-actin content. Dynein has not yet been recognized as a player in actin dynamics and, thus, it was an interesting question whether disturbed dynein function could result in similar alterations of actin dynamics as observed in our DdLIS1 mutants. Although our dynein IC overexpression cell line was very unstable, we could reproducibly observe similarly altered F-actin distribution is these cells as detected upon disruption of DdLIS1 function. This strongly suggests that the role of DdLIS1 in actin dynamics also involves dynein just like all other LIS1 functions known so far.
Bearing in mind the effects of partial loss of DdLIS1 function on both the tubulin and the actin cytoskeleton it is surprising that our mutants showed no defects in cell migration as they were observed in migrating neurons. However, our own unpublished results with nocodazole clearly showed that Dictyostelium cells do not require microtubules for directed cell migration. Even the partial disassembly of the actin cytoskeleton by treatment with low dosages of latrunculin A, did not prevent chemotactic cell migration of Dictyostelium amoebae. Thus, Dictyostelium cells are more reminiscent of nonneuronal cells, which are also not strongly affected by partial loss of LIS1 function. However, like LIS1 in mammals, DdLIS1 is certainly an essential protein because it was not possible to knock out the DdLIS1 gene completely or to replace it by a stronger hypomorphic allele such as H149R.
Taken together, in this work we have shown that DdLIS1 is not only a microtubule-associated protein but also a genuine centrosomal component. The D327H point mutation of DdLIS1 as well as overexpression of MBP-tagged DdLIS1 disrupted DdLIS1 function and resulted in a palette of mutant phenotypes including Golgi dispersal, decreased centrosome/nucleus association, disturbed microtubule tip/cell cortex interactions, and altered actin dynamics. All these phenotypes appeared to be dynein-dependent. Furthermore, we have demonstrated for the first time an association between LIS1 and XMAP215-family proteins in a cytosolic complex and direct binding of a LIS1-family protein to an actin regulating small GTPase, suggesting a contribution of these proteins in LIS1 function and, thus, the pathogenesis of lissencephaly.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Ralph Gräf (rgraef{at}lrz.uni-muenchen.de).
| REFERENCES |
|---|
|
|
|---|
Burkhardt, J. K., Echeverri, C. J., Nilsson, T., and Vallee, R. B. ((1997). ). Overexpression of the dynamitin (p50) subunit of the dynactin complex disrupts dynein-dependent maintenance of membrane organelle distribution. J. Cell Biol. 139, , 469484.
Bush, J., Franek, K., and Cardelli, J. ((1993). ). Cloning and characterization of seven novel Dictyostelium discoideum rac-related genes belonging to the rho family of GTPases. Gene 136, , 6168.[CrossRef][Medline]
Caspi, M., Atlas, R., Kantor, A., Sapir, T., and Reiner, O. ((2000). ). Interaction between LIS1 and doublecortin, two lissencephaly gene products. Hum. Mol. Genet. 9, , 22052213.
Caspi, M., Coquelle, F. M., Koifman, C., Levy, T., Arai, H., Aoki, J., De Mey, J. R., and Reiner, O. ((2003). ). LIS1 missense mutations: variable phenotypes result from unpredictable alterations in biochemical and cellular properties. J. Biol. Chem. 278, , 3874038748.
Coquelle, F. M. et al. ((2002). ). LIS1, CLIP-170's key to the dynein/dynactin pathway. Mol. Cell. Biol. 22, , 30893102.
Daunderer, C., and Gräf, R. ((2002). ). Molecular analysis of the cytosolic Dictyostelium gamma-tubulin complex. Eur. J. Cell Biol. 81, , 175184.[Medline]
Dujardin, D. L., Barnhart, L. E., Stehman, S. A., Gomes, E. R., Gundersen, G. G., and Vallee, R. B. ((2003). ). A role for cytoplasmic dynein and LIS1 in directed cell movement. J. Cell Biol. 163, , 12051211.
Dujardin, D. L., and Vallee, R. B. ((2002). ). Dynein at the cortex. Curr. Opin. Cell Biol. 14, , 4449.[CrossRef][Medline]
Dumontier, M., Hocht, P., Mintert, U., and Faix, J. ((2000). ). Rac1 GTPases control filopodia formation, cell motility, endocytosis, cytokinesis and development in Dictyostelium. J. Cell Sci. 113, (Pt 12), 22532265.[Abstract]
Etienne-Manneville, S., and Hall, A. ((2001). ). Integrin-mediated activation of Cdc42 controls cell polarity in migrating astrocytes through PKCzeta. Cell 106, , 489498.[CrossRef][Medline]
Euteneuer, U., Gräf, R., Kube-Granderath, E., and Schliwa, M. ((1998). ). Dictyostelium gamma-tubulin: molecular characterization and ultrastructural localization. J. Cell Sci. 111, , 405412.[Abstract]
Faix, J. ((2002). ). The actin-bundling protein cortexillin is the downstream target of a Rac1-signaling pathway required for cytokinesis. J. Muscle Res. Cell Motil. 23, , 765772.[Medline]
Faix, J., Clougherty, C., Konzok, A., Mintert, U., Murphy, J., Albrecht, R., Mühlbauer, B., and Kuhlmann, J. ((1998). ). The IQGAP-related protein DGAP1 interacts with Rac and is involved in the modulation of the F-actin cytoskeleton and control of cell motility. J. Cell Sci. 111, , 30593071.[Abstract]
Faix, J., Kreppel, L., Shaulsky, G., Schleicher, M., and Kimmel, A. R. ((2004). ). A rapid and efficient method to generate multiple gene disruptions in Dictyostelium discoideum using a single selectable marker and the Cre-loxP system. Nucleic Acids Res. 32, , e143
Faulkner, N. E., Dujardin, D. L., Tai, C. Y., Vaughan, K. T., O'Connell, C. B., Wang, Y., and Vallee, R. B. ((2000). ). A role for the lissencephaly gene LIS1 in mitosis and cytoplasmic dynein function. Nat. Cell Biol. 2, , 784791.[CrossRef][Medline]
Fukui, Y., Yumura, S., and Yumura, T. K. ((1987). ). Agar-overlay immunofluorescence: high resolution studies of cytoskeletal components and their changes during chemotaxis. Methods Cell Biol. 28, , 347356.[Medline]
Gräf, R. ((2001a). ). Isolation of centrosomes from Dictyostelium. Methods Cell Biol. 67, , 337357.[Medline]
Gräf, R. ((2001b). ). Maltose-binding protein as a fusion tag for the localization and purification of cloned proteins in Dictyostelium. Anal. Biochem. 289, , 297300.[CrossRef][Medline]
Gräf, R., Brusis, N., Daunderer, C., Euteneuer, U., Hestermann, A., Schliwa, M., and Ueda, M. ((2000a). ). Comparative structural, molecular and functional aspects of the Dictyostelium discoideum centrosome. Curr. Top. Dev. Biol. 49, , 161185.[Medline]
Gräf, R., Daunderer, C., and Schliwa, M. ((1999). ). Cell cycle-dependent localization of monoclonal antibodies raised against isolated Dictyostelium centrosomes. Biol. Cell 91, , 471477.[CrossRef][Medline]
Gräf, R., Daunderer, C., and Schliwa, M. ((2000b). ). Dictyostelium DdCP224 is a microtubule-associated protein and a permanent centrosomal resident involved in centrosome duplication. J. Cell Sci. 113, , 17471758.[Abstract]
Gräf, R., Daunderer, C., and Schulz, I. ((2004). ). Molecular and functional analysis of the Dictyostelium centrosome. Int. Rev. Cytol. 241, , 155202.[Medline]
Gräf, R., Euteneuer, U., Ho, T. H., and Rehberg, M. ((2003). ). Regulated expression of the centrosomal protein DdCP224 affects microtubule dynamics and reveals mechanisms for the control of supernumerary centrosome number. Mol. Biol. Cell 14, , 40674074.
Gräf, R., Euteneuer, U., Ueda, M., and Schliwa, M. ((1998). ). Isolation of nucleation-competent centrosomes from Dictyostelium discoideum. Eur. J. Cell Biol. 76, , 167175.[Medline]
Gupta, A., Tsai, L. H., and Wynshaw-Boris, A. ((2002). ). Life is a journey: a genetic look at neocortical development. Nat. Rev. Genet. 3, , 342355.[CrossRef][Medline]
Hestermann, A., and Gräf, R. ((2004). ). The XMAP215-family protein DdCP224 is required for cortical interactions of microtubules. BMC Cell Biol. 5, , 24.[CrossRef][Medline]
Kholmanskikh, S. S., Dobrin, J. S., Wynshaw-Boris, A., Letourneau, P. C., and Ross, M. E. ((2003). ). Disregulated RhoGTPases and actin cytoskeleton contribute to the migration defect in Lis1-deficient neurons. J. Neurosci. 23, , 86738681.
Kitanishi, T., Shibaoka, H., and Fukui, Y. ((1984). ). Disruption of microtubules and retardation of development of Dictyostelium with ethyl N-phenylcarbamate and thiabendazole. Protoplasma 120, , 185196.[CrossRef]
Koonce, M. P., and Khodjakov, A. ((2002). ). Dynamic microtubules in Dictyostelium. J. Muscle Res. Cell Motil. 23, , 613619.[CrossRef][Medline]
Koonce, M. P., Kohler, J., Neujahr, R., Schwartz, J. M., Tikhonenko, I., and Gerisch, G. ((1999). ). Dynein motor regulation stabilizes interphase microtubule arrays and determines centrosome position. EMBO J. 18, , 67866792.[CrossRef][Medline]
Koonce, M. P., and Samso, M. ((1996). ). Overexpression of cytoplasmic dynein's globular head causes a collapse of the interphase microtubule network in Dictyostelium. Mol. Biol. Cell 7, , 935948.[Abstract]
Ma, S., Triviños Lagos, L., Gräf, R., and Chisholm, R. L. ((1999). ). Dynein intermediate chain mediated dynein-dynactin interaction is required for interphase microtubule organization and centrosome replication and separation in Dictyostelium. J. Cell Biol. 147, , 12611274.
Malone, C. J., Misner, L., Le Bot, N., Tsai, M. C., Campbell, J. M., Ahringer, J., and White, J. G. ((2003). ). The C. elegans hook protein, ZYG-12, mediates the essential attachment between the centrosome and nucleus. Cell 115, , 825836.[CrossRef][Medline]
Morio, T. et al. ((1998). ). The Dictyostelium developmental cDNA project: generation and analysis of expressed sequence tags from the first-finger stage of development. DNA Res. 5, , 335340.[Abstract]
Morris, N. R., Efimov, V. P., and Xiang, X. ((1998). ). Nuclear migration, nucleokinesis and lissencephaly. Trends Cell Biol. 8, , 467470.[CrossRef][Medline]
Ohkura, H., Garcia, M. A., and Toda, T. ((2001). ). Dis1/TOG universal microtubule adaptorsone MAP for all? J. Cell Sci. 114, , 38053812.
Palazzo, A. F., Joseph, H. L., Chen, Y. J., Dujardin, D. L., Alberts, A. S., Pfister, K. K., Vallee, R. B., and Gundersen, G. G. ((2001). ). Cdc42, dynein, and dynactin regulate MTOC reorientation independent of Rho-regulated microtubule stabilization. Curr. Biol. 11, , 15361541.[CrossRef][Medline]
Pilz, D. T., Kuc, J., Matsumoto, N., Bodurtha, J., Bernadi, B., Tassinari, C. A., Dobyns, W. B., and Ledbetter, D. H. ((1999). ). Subcortical band heterotopia in rare affected males can be caused by missense mutations in DCX (XLIS) or LIS1. Hum. Mol. Genet. 8, , 17571760.
Reiner, O., Carrozzo, R., Shen, Y., Wehnert, M., Faustinella, F., Dobyns, W. B., Caskey, C. T., and Ledbetter, D. H. ((1993). ). Isolation of a Miller-Dieker lissencephaly gene containing G protein beta-subunit-like repeats. Nature 364, , 717721.[CrossRef][Medline]
Sapir, T., Eisenstein, M., Burgess, H. A., Horesh, D., Cahana, A., Aoki, J., Hattori, M., Arai, H., Inoue, K., and Reiner, O. ((1999). ). Analysis of lissencephaly-causing LIS1 mutations. Eur. J. Biochem. 266, , 10111020.[Medline]
Sapir, T., Elbaum, M., and Reiner, O. ((1997). ). Reduction of microtubule catastrophe events by LIS1, platelet-activating factor acetylhydrolase subunit. EMBO J. 16, , 69776984.[CrossRef][Medline]
Sasaki, S., Shionoya, A., Ishida, M., Gambello, M. J., Yingling, J., Wynshaw-Boris, A., and Hirotsune, S. ((2000). ). A LIS1/NUDEL/cytoplasmic dynein heavy chain complex in the developing and adult nervous system. Neuron 28, , 681696.[CrossRef][Medline]
Schaar, B. T., Kinoshita, K., and McConnell, S. K. ((2004). ). Doublecortin microtubule affinity is regulated by a balance of kinase and phosphatase activity at the leading edge of migrating neurons. Neuron 41, , 203213.[CrossRef][Medline]
Schliwa, M., Euteneuer, U., Gräf, R., and Ueda, M. ((1999). ). Centrosomes, microtubules and cell migration. Biochem. Soc. Symp. 65, , 223231.[Medline]
Smith, D. S., Niethammer, M., Ayala, R., Zhou, Y., Gambello, M. J., Wynshaw-Boris, A., and Tsai, L. H. ((2000). ). Regulation of cytoplasmic dynein behaviour and microtubule organization by mammalian Lis1. Nat. Cell Biol. 2, , 767775.[CrossRef][Medline]
Spector, I., Shochet, N. R., Blasberger, D., and Kashman, Y. ((1989). ). Latrunculinsnovel marine macrolides that disrupt microfilament organization and affect cell growth: I. Comparison with cytochalasin D. Cell Motil. Cytoskeleton 13, , 127144.[CrossRef][Medline]
Tanaka, T., Serneo, F. F., Higgins, C., Gambello, M. J., Wynshaw-Boris, A., and Gleeson, J. G. ((2004). ). Lis1 and doublecortin function with dynein to mediate coupling of the nucleus to the centrosome in neuronal migration. J. Cell Biol. 165, , 709721.
Toyo-Oka, K. et al. ((2003). ). 143-3epsilon is important for neuronal migration by binding to NUDEL: a molecular explanation for Miller-Dieker syndrome. Nat. Genet. 34, , 274285.[CrossRef][Medline]
Ueda, M., Schliwa, M., and Euteneuer, U. ((1999). ). Unusual centrosome cycle in Dictyostelium: correlation of dynamic behavior and structural changes. Mol. Biol. Cell 10, , 151160.
Vicker, M. G. ((2002). ). F-actin assembly in Dictyostelium cell locomotion and shape oscillations propagates as a self-organized reaction-diffusion wave. FEBS Lett. 510, , 59.[CrossRef][Medline]
Waterman-Storer, C. M., Worthylake, R. A., Liu, B. P., Burridge, K., and Salmon, E. D. ((1999). ). Microtubule growth activates Rac1 to promote lamellipodial protrusion in fibroblasts. Nat. Cell Biol. 1, , 4550.[CrossRef][Medline]
Weber, I. ((1999). ). Computer-assisted morphometry of cell-substratum contacts. Croat. Med. J. 40, , 334339.[Medline]
Weiner, O. H., Murphy, J., Griffiths, G., Schleicher, M., and Noegel, A. A. ((1993). ). The actin-binding protein comitin (p24) is a component of the golgi apparatus. J. Cell Biol. 123, , 2334.
Westphal, M., Jungbluth, A., Heidecker, M., Mühlbauer, B., Heizer, C., Schwartz, J. M., Marriott, G., and Gerisch, G. ((1997). ). Microfilament dynamics during cell movement and chemotaxis monitored using a GFP-actin fusion protein. Curr. Biol. 7, , 176183.[CrossRef][Medline]
Xiang, X., Osmani, A. H., Osmani, S. A., Xin, M., and Morris, N. R. ((1995). ). NudF, a nuclear migration gene in Aspergillus nidulans, is similar to the human LIS-1 gene required for neuronal migration. Mol. Biol. Cell 6, , 297310.[Abstract]
This article has been cited by other articles:
![]() |
I. Tikhonenko, D. K. Nag, D. N. Robinson, and M. P. Koonce Microtubule-Nucleus Interactions in Dictyostelium discoideum Mediated by Central Motor Kinesins Eukaryot. Cell, May 1, 2009; 8(5): 723 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tang, J. Franca-Koh, Y. Xiong, M.-Y. Chen, Y. Long, R. M. Bickford, D. A. Knecht, P. A. Iglesias, and P. N. Devreotes tsunami, the Dictyostelium homolog of the Fused kinase, is required for polarization and chemotaxis Genes & Dev., August 15, 2008; 22(16): 2278 - 2290. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Helmstaedt, K. Laubinger, K. Vosskuhl, O. Bayram, S. Busch, M. Hoppert, O. Valerius, S. Seiler, and G. H. Braus The Nuclear Migration Protein NUDF/LIS1 Forms a Complex with NUDC and BNFA at Spindle Pole Bodies Eukaryot. Cell, June 1, 2008; 7(6): 1041 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Banerjee, R. Pandey, R. Zheng, M. M. Suhoski, L. Monaco-Shawver, and J. S. Orange Cdc42-interacting protein 4 functionally links actin and microtubule networks at the cytolytic NK cell immunological synapse J. Exp. Med., October 1, 2007; 204(10): 2305 - 2320. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Hatten LIS-less neurons don't even make it to the starting gate J. Cell Biol., September 12, 2005; 170(6): 867 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, C. E. Oakley, G. Chen, X. Han, B. R. Oakley, and X. Xiang Cytoplasmic Dynein's Mitotic Spindle Pole Localization Requires a Functional Anaphase-promoting Complex, {gamma}-Tubulin, and NUDF/LIS1 in Aspergillus nidulans Mol. Biol. Cell, August 1, 2005; 16(8): 3591 - 3605. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Brito, J. Strauss, V. Magidson, I. Tikhonenko, A. Khodjakov, and M. P. Koonce Pushing Forces Drive the Comet-like Motility of Microtubule Arrays in Dictyostelium Mol. Biol. Cell, July 1, 2005; 16(7): 3334 - 3340. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||