![]() |
|
|
Vol. 16, Issue 6, 2772-2785, June 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular Microbiology, B. Rappaport Faculty of Medicine, Technion-IIT, and the Rappaport Institute for Research in the Medical Sciences, Haifa 31096, Israel
Submitted January 31, 2005;
Revised March 23, 2005;
Accepted March 24, 2005
Monitoring Editor: Orna Cohen-Fix
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
A variety of environmental stimuli are known to promote the switch to hyphal growth in C. albicans: neutral or alkaline pH, carbon starvation, nitrogen starvation, cell density, oxygen concentration, and elevated temperature (>35°C) (reviewed in Ernst, 2000
). Incubation in serum at 37°C is a common and potent way to induce hyphal formation, possibly because serum imposes several types of signals. Several transcription factors were identified that regulate filamentous growth: Cph1 (Liu et al., 1994
), Efg1 (Lo et al., 1997
; Stoldt et al., 1997
), Cph2 (Lane et al., 2001
), CaTec1 (Schweizer et al., 2000
), CaTup1 (Braun and Johnson, 1997
), CaNrg1 (Braun et al., 2001
), CaMcm1 (Rottmann et al., 2003
), and CaFkh2 (Bensen et al., 2002
). Deletion of CaTUP1, CaNRG1, or CaFKH2 cause constitutive pseudohyphal growth. Deletion of either CPH1 or EFG1 causes a reduction in the ability to form hyphae, with the efg1 mutant having the stronger defect, and the double mutant being virtually unable to form hyphae under most conditions (Lo et al., 1997
).
Cell morphogenesis is closely associated with regulation of the cell cycle in many eukaryotes, particularly in budding yeasts (Lew and Reed, 1995
; Rua et al., 2001
). The morphogenetic switch in C. albicans may therefore be expected to involve regulation at the level of the cell cycle regulatory machinery. Indeed, repression of the Polo-like kinase CaCdc5, a mitotic regulator, was found to induce hyphal growth (Bachewich et al., 2003
). Furthermore, CaCln1/Ccn1, a protein with homology to the Saccharomyces cerevisiae G1 cyclins, was found to be required for maintenance of hyphal growth (Loeb et al., 1999
), and Hgc1, a C. albicans cyclin related to the S. cerevisiae G1 cyclins Cln1 and Cln2 was shown to be necessary, but not sufficient, for induction of hyphal growth (Zheng and Wang, 2004
). Recently, depletion of the C. albicans Cln3 homologue, an essential protein, was shown to induce hyphal or pseudohyphal growth, depending on the conditions (Bachewich and Whiteway, 2005
; Chapa y Lazo et al., 2005
).
Ubiquitin-mediated protein degradation (Hershko and Ciechanover, 1998
; Kornitzer and Ciechanover, 2000
) plays a central role in cell cycle control. Skp1-Cullin-1/Cdc53-F-box protein (SCF)CDC4, an SCF ubiquitin ligase complex that includes Cdc4 as substrate recognition component, is one of the ubiquitin ligases implicated in cell cycle entry and progression in yeast and mammalian cells. The mammalian homologue of Cdc4 is involved in degradation of Cyclin E (Koepp et al., 2001
; Moberg et al., 2001
; Strohmaier et al., 2001
) and of the proto-oncogene c-Myc (Welcker et al., 2004
; Yada et al., 2004
) and was shown to function as a tumor suppressor gene (Spruck et al., 2002
; Mao et al., 2004
; Rajagopalan et al., 2004
). In S. cerevisiae, in contrast, CDC4 is essential for cell proliferation, and temperature-sensitive mutants arrest in G1 with elongated, multiple buds (Hereford and Hartwell, 1974
). The critical substrate of yeast SCFCDC4 for the G1-to-S transition is the cyclin-dependent kinase inhibitor Sic1 (Schwob et al., 1994
; Bai et al., 1996
; Feldman et al., 1997
; Skowyra et al., 1997
; Verma et al., 1997b
). Other substrates of SCFCDC4 include another cyclin-dependent kinase (CDK) inhibitor, Far1 (Henchoz et al., 1997
), and a transcription factor, Gcn4 (Meimoun et al., 2000
; Chi et al., 2001
).
Here, we describe the identification and characterization of the functional C. albicans homologue of Cdc4 and of a C. albicans Sol1, a homologue of the S. cerevisiae Cdc4 substrate Sic1. As opposed to ScCDC4, CaCDC4 is not essential. Deletion of CaCDC4 leads to constitutive filamentous growth, suggesting a role for ubiquitin-mediated protein degradation in the dimorphic switch of C. albicans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Plasmids
CaCDC4. The CaCDC4 genomic region was PCR amplified using primers at positions 1067 and +2564 relative to the CaCDC4 open reading frame (2307 nucleotides [nt] in length) and was cloned between the HindIII and XhoI sites of plasmid B2205, a 2µ vector based on pRS306 (Sikorski and Hieter, 1989
), to generate KB1083. In a second step, CaCDC4 was transferred as a SacI-XhoI fragment from KB1083 to pRS314 (Sikorski and Hieter, 1989
), to generate KB1261. For deleting CaCDC4, in a first step, a genomic region extending between a SacI site located at position 1228 relative to the CaCDC4 start site and a KpnI site located at position +2727 (421 nt beyond the CaCDC4 stop codon), was PCR amplified and cloned in pBSII-SK+ (Stratagene, La Jolla, CA) digested with the same enzymes, to generate KB1342. In a second step, the hisG-CaURA3-hisG BamHI-BglII "blaster" fragment (Fonzi and Irwin, 1993
) was cloned into KB1342 digested with BclI, to generate KB1344-1 and KB1344-3 (two orientations). BclI cuts the CaCDC4 region at three positions: 218, +239, and +1574 relative to the CaCDC4 start site. Thus, this deletion construct removes 218 nt of the promoter region and the majority of the coding sequence of CaCDC4, including the F-box domain and some of the WD40 repeats. For deleting CaCDC4, KB1344 was digested with SacI and KpnI before transformation.
TET-CaCDC4. Strain THE1 (Nakayama et al., 2000
) was deleted for one allele of CaCDC4 by using plasmid KB1344. The second allele was placed under the regulation of the TET promoter by transforming the strain with a fragment containing SAT-1 (nourseothricin resistance) and the TET promoter (Roemer et al., 2003
), PCR amplified with primers TET-CaCDC4up (5'-CAAAGTATCTGTGTGAATTTTGGATACAAAAGTTTCTGTTGATTTTCAGTTTGTCACAACAAAAACCCGGGATCGATAGAGCT) and TET-CaCDC4dn (5'-CTGTACTCAAATTTAGCCGTCTCCTCGCTCAAAGGATATTTGAATAGCTTTGATTTCTTATCCATATCCGGTAATTTAGTGTG). For epitope tagging of CaCdc4, in a first stage a plasmid was built containing the 13 x Myc cassette followed by the CaURA3 marker: the CaURA3 BamHI-PmeI fragment of pFA-URA3-MAL2p (Gola et al., 2003
) was cloned into pFA6a-13Myc-TRP1 (Longtine et al., 1998
) digested with BglII and PmeI, to generate pFA6a-13Myc-CaURA3 (KB1541). In a second stage, the 13 x Myc-CaURA3 was PCR amplified using primers containing 65 nt preceding the stop codon of CaCDC4 followed by sequence F2 (Longtine et al., 1998
), and the 65 nt after the stop codon followed by sequence S2 (Gola et al., 2003
). This fragment was used for transformation, and transformants were screened by Western blotting.
CaFAR1. The CaFAR1 (Orf19.7105; 2307 nt) deletion plasmid was constructed by sequentially introducing the 3' region of the gene (coordinates +2313 to +3093) as an SpeI-SacI fragment, and the 5' region (coordinates 850 to +50) as an XhoI-HindIII fragment, into KB985 and KB986, to generate KB1387 and KB1388, respectively. KB985 and KB986 contain the hisG-CaURA3-hisG BamHI-BglII blaster fragment (Fonzi and Irwin, 1993
) cloned into the BamHI site of pBSII-SK+ in two opposite orientations. For deleting CaFAR1, the plasmids were digested with XhoI and SacI before transformation.
SOL1. The SOL1 (Orf19.6930; 717 nt)-carrying plasmid KB1606 was isolated as a clone of the 2µ URA3 C. albicans genomic library (Liu et al., 1994
). The library insert extended from 317 to +1506 relative to the SOL1 transcription start site; SOL1 is the only complete open reading frame (ORF) in this insert. To express SOL1 in S. cerevisiae, the coding sequence was PCR amplified with primers that added HindIII and KpnI sites at positions 5 and +872, and the resulting PCR fragment was cloned in p416-GAL1 (Mumberg et al., 1994
) digested with the same enzymes, to generate KB1599. To express an N-terminally truncated SOL1 a 5' primer adding a HindIII site and an ATG start codon at position +319 was used with the same 3' primer, to generate KB1600. To express epitope-tagged Sol1 in C. albicans under the CaMAL2 promoter, a ClaI-HindIII PCR fragment carrying the whole SOL1 open reading frame was cloned instead of the ClaI-HindIII fragment of plasmid KB1575 (Gildor et al., 2005
), to generate KB1578. For transformation, KB1578 was linearized with AscI. For deleting SOL1, the 5' (785 to +3; KpnI-PstI) and 3' (+719 to +1558; SpeI-SacI) regions of the gene were sequentially introduced into KB985, KB986 to generate KB1476-1 and -2, respectively. The plasmids were digested with KpnI and SacI before transformation. For reintegration of SOL1, a PstI-KpnI PCR fragment extending from 667 to +865 relative to the SOL1 initiation codon was cloned into BES116 (Feng et al., 1999
) to generate KB1622.
CaCUP1p-SOL1, -SIC1. The CaCUP1p expression vector was constructed by introducing the CaCUP1 promoter fragment as a NotI-SpeI PCR fragment extending from 518 to 1 relative to the CaCUP1 open reading frame (Weissman et al., 2000
) into BES116 (Feng et al., 1999
), digested with the same enzymes, to generate KB1317. In a second stage, an ATG start codon followed by a single Myc tag sequence was introduced as an SpeI-ATG-Myc-BglII-PstI synthetic oligonucleotide (5'-ACTAGTCCATGGAACAAAAGTTGATTTCTGAAGAAGATTTGAGATCTGCAG) between the SpeI and PstI sites of KB1317 to generate KB1321. The following fragments were then cloned into KB1321: SIC1 as a PstI-HindIII fragment (2 to +1080) to generate KB1386, SIC1
N as a BglII-HindIII fragment (+408 to +1080) to generate KB1389, SOL1 as a PstI-HindIII fragment (2 to +900) to generate KB1472, and SOL1
N as a BglII-HindIII fragment (+253 to +900) to generate KB1473. All plasmids were linearized with AscI for transformation.
Protein Analysis
Protein levels were assayed by Western blotting analysis by using the monoclonal antibodies 9E10 to detect the Myc epitope or 12CA5 to detect the hemagglutinin epitope. Proteins were extracted by the quantitative NaOH/2-mercaptoethanol method, as described previously (Weissman and Kornitzer, 2004
). To compare steady-state protein levels, equal protein amounts were loaded; to monitor protein disappearance after promoter shutoff, equal culture volume equivalents were loaded. Loading and transfer were monitored by Ponceau staining of the membrane.
Microscopy
Cells were fixed in 70% ethanol and visualized with a Zeiss Axioskop 2 epifluorescence microscope equipped with differential interference contrast optics, by using a 63 or 100x objective. For cell wall staining, fixed cells were incubated 1530 min in 1 µg/ml calcofluor white, washed in phosphate-buffered saline, and observed by epifluorescence with a 4,6-diamidino-2-phenylindole (DAPI) filter. Cacdc4/ mycelia were homogenized with a motorized Kontes pellet pestle in 1.5-ml microfuge tubes before microscopic observation. Colonies were visualized with a Zeiss Stemi 2000C binocular microscope. Small colonies were visualized with a Zeiss Axiolab microscope by using a 10x long working distance objective. Time-lapse micrography was performed on an
0.5-ml agar pad on a microscope slide, on which the cells (1 µl) were laid down and covered with a coverslip. We found that at room temperature, cells actively divided for at least 8 h under these conditions.
Flow Cytometry
Cells were prepared according to Haase and Reed (2002
), with some modifications. Cells (107108) were fixed in 70% ethanol for 1 h to overnight, washed with 0.2 M Tris, pH 7.5, and then incubated overnight in a shaker at 37°C in 0.2 M Tris, pH 7.5, 10 mM EDTA with 1 mg/ml RNaseA. The cells were then spun down, resuspended in 50 mM HCl with 5 mg/ml pepsin, incubated a further 2 h at 37°, and washed with 0.2 M Tris, pH 7.5. Approximately 5 x 106 cells were then incubated at least 15 min at 30°C while shaking in 0.3 ml of 0.2 M Tris, pH 7.5, with 2 µM SYTOX (Molecular Probes, Eugene, OR). The cells were diluted 1:10 in 0.2 M Tris, pH 7.5, just before injection into the flow cytometer (BD Biosciences FACScalibur). Ungated events (20,000) were recorded for each run. In cases where the 2n versus 4n peak assignment was in doubt, the culture was spiked with a stationary phase G1-arrested culture, and the increased peak was assigned as 2n.
Sequence Analysis
Sequences of C. albicans proteins were obtained from http://www-sequence.stanford.edu/group/candida; sequences of Saccharomyces spp. and A. gossypii proteins were obtained from http://www.yeastgenome.org/. The sequences were aligned by ClustalW, implemented with the MEGALIGN software (DNAStar, Madison, WI), which also was used to generate the homology trees.
|
| RESULTS |
|---|
|
|
|---|
background strain (MTY1260) (Nash et al., 2001
Phenotype of the Cacdc4/ Mutant
To investigate the function of CaCdc4 in C. albicans, the two alleles of CaCDC4 gene were deleted sequentially from the C. albicans genome (Figure 2A). The homozygous Cacdc4 deletant displayed a striking phenotype: the colonies contained large number of aerial hair-like protrusions (Figure 2B, b and d) as well as filaments that penetrated deeply into the agar (Figure 2B, e); the protrusions, when observed under the microscope, seemed to consist of bundles of hyphae (Figure 2C, a and b). The consistency of the colonies was solid, rather than soft like a typical yeast colony. When Cacdc4/ cells were scraped off the mutant colony and grown in liquid, the cells grew in one or several mycelial balls. To determine whether the filamentous Cacdc4/ cells are hyphal or pseudohyphal, part of a colony or a ball of liquid-grown cells were separated with a homogenizer and stained with calcofluor to visualize the cell walls and the septa or the sites of cell separation. Hyphae usually exhibit straight walls with no constriction at the site of the septum, whereas pseudohyphal cells are typically wider in the middle and show constrictions at the sites of cytokinesis (Sudbery et al., 2004
). According to these criteria, cells from the Cacdc4/ colony showed a majority of hyphal cells and some pseudohyphal cells (Figure 2C, c). For the liquid cultures, both stationary and exponentially growing, cell morphology similarly seemed to be a mixture of hyphal and pseudohyphal cells, with a higher proportion of pseudohyphal cells (Figure 2C, d and e).
|
ECE1 and HWP1 are two genes that are normally expressed only under hyphal induction conditions such as serum or Lee's medium (Birse et al., 1993
; Sharkey et al., 1999
). We tested expression of these genes in wild-type versus Cacdc4/ mutant cells, under normal or hyphal-inducing conditions. The Cacdc4/ mutant cells showed constitutive high expression of both ECE1 and HWP1 regardless of the growth conditions (Figure 3).
|
|
In S. cerevisiae, cdc4 temperature-sensitive mutants arrest in G1 (Hereford and Hartwell, 1974
). To monitor the effect of CaCdc4 depletion on the cell cycle distribution of C. albicans, fluorescence-activated cell sorting (FACS) analysis was performed on the TET-CaCDC4. At 5.5 h after tetracycline addition, a significant shift toward the 4n peak was observed; at 7.5 h, the majority of cells were in the 4n peak, and an 8n peak occurred, presumably representing pseudohyphal chains of cells (Figure 4D). Beyond 7.5 h, the distribution shifted to a broad peak of high ploidy (our unpublished data), as expected from the exclusive occurrence of pseudohyphal chains at later time points (Figure 4C).
Epistasis Analysis of Cacdc4/ with efg1/ cph1/ and Cafar1/
If the filamentation phenotype of the Cacdc4/ mutant is due to stabilization of a positive regulator of filamentous growth, then a mutant of this gene should be epistatic to Cacdc4/ and should prevent filamentation in the double mutant. Efg1 and Cph1 are two transcription factors that are required for filamentation; the double efg1/ cph1/ mutant fails to form hyphae under almost all hyphae-inducing conditions (Lo et al., 1997
). Thus, one possibility was that Cdc4 is required for the turnover of one of these factors, or both. Deleting CaCDC4 in the efg1/ cph1/ background still yielded a strain that was highly filamentous on plates, although with a larger proportion of pseudohyphae versus hyphae (Figure 5). Growth in liquid yielded a flocculent but uniform culture that consisted of pseudohyphal cells (Figure 5). The fact that this mutant was still filamentous indicated that an additional factor is responsible for the phenotype of the Cacdc4/ mutant.
|
Hyphal Induction by Serum in Cacdc4/ Cells
Serum is the most potent inducer of hyphae in C. albicans. The Cacdc4/ mutant is constitutively filamentous, mainly hyphal, raising the question whether CaCdc4 is part of the signaling pathway that is involved in hyphal induction by serum. If it were, then adding serum to the Cacdc4/ strain should not cause any further induction of filamentation. However, given the constitutively filamentous phenotype of the Cacdc4/ mutant, further induction of filamentation by serum would be hard to measure on a whole cell population. Therefore, to monitor the response of this mutant to serum, we followed individual Cacdc4/ pseudohyphal cells by time-lapse micrography. The Cacdc4/ pseudohyphal cells were isolated from the mycelial cells based on their slower sedimentation. Wild-type cells and triple Cacdc4/ efg1/ cph1/ mutant cells also were followed by time-lapse micrography. As shown in Figure 6, the Cacdc4/ mutant cells did form germ tubes in response to serum and did so more rapidly and vigorously than the wild-type cells: at 40 min, several germ tubes are visible in the mutant, whereas germ tubes only start to emerge at 60 min in the wild-type. This suggests that CaCdc4 is not itself part of the serum response signal transduction pathway but that it functions as a negative regulator of this pathway. In contrast, the Cacdc4/ efg1/ cph1/ cells did not respond to serum and continued to grow as pseudohyphal cells. Thus, the nonresponsiveness of the efg1/ cph1/ mutant to serum induction (Lo et al., 1997
) is epistatic to Cacdc4/, indicating that no alternative serum response pathway is induced in the absence of CaCdc4.
|
Effect of S. cerevisiae Sic1 Expression in C. albicans
The best studied substrate of SCFCDC4 is the cyclin-dependent kinase inhibitor Sic1, stabilization of which is the cause for the G1 arrest of mutants of SCFCDC4 components (Schwob et al., 1994
; Feldman et al., 1997
; Nash et al., 2001
). If the reason for the hyphal growth phenotype of the Cacdc4/ mutant is that the C. albicans homologue of Sic1 is stabilized, then overexpressing a stabilized version of that protein might by itself lead to hyphal growth. To test this hypothesis, in a first stage we expressed in Candida a truncated version of the S. cerevisiae SIC1 gene, which is expected to yield an active, constitutively stable protein (Verma et al., 1997b
). Expression of SIC1
N was achieved by cloning it under the copper-inducible CaCUP1 promoter. The construct was transformed into the crp1/ mutant, which defective in the copper extrusion pump Crp1 and is therefore relatively sensitive to the addition of copper to the medium (Weissman et al., 2000
). Expression of this construct induced the cells to form highly elongated buds (Figure 7), indicating that C. albicans is sensitive to this CDK inhibitor.
|
Identification of a C. albicans Sic1 Homologue
Because S. cerevisiae Sic1 expression did induce morphological changes in C. albicans, suggesting that stabilization of a Sic1 homologue might be responsible for the C. albicans cdc4/ phenotype, we next attempted to identify such a homologue. A sequence homology search (using the BLAST algorithm) failed to uncover any obvious Sic1 homologues in the nearly complete C. albicans genome database. We therefore attempted to isolate this homologue functionally, based on the suppression phenotype of Sic1 overexpression on mitotic exit mutants, such as dbf2ts (Donovan et al., 1994
). A C. albicans genomic library (Liu et al., 1994
) was introduced in the dbf2-3 mutant, and transformants able to grow at 37°C were selected. The single type of suppressor plasmid contained a 238 codon-long open reading frame, Orf19.6930 (http://www-sequence.stanford.edu/group/candida) with no homology to Dbf2 but with limited homology to Sic1. Because functional analysis showed that this protein, although related, seems to be functionally distinct from Sic1 (see below), we called it Sic one-like (Sol1) (Figure 8A). Comparing this ORF to the S. cerevisiae proteome by using the BLAST algorithm did not reveal any significant homologies. The putative transcription factor Hcm1 was obtained as closest homologue. However, when multiple alignment was performed with several ascomycete Sic1 homologues, together with the corresponding Hcm1 homologues, Sol1 clearly clustered with the Sic1 group (Figure 8B). Figure 8C shows the Sol1 sequence, marked at the sites of homology to the consensus of four Saccharomycetaceae Sic1 sequences. Like ScSic1, Sol1 contains a significant number of potential CDK sites (S/T-P), concentrated in the amino-terminal half of the protein. The region of highest conservation, around Thr140, corresponds to a potential CDK/MAPK site that serves in S. cerevisiae Sic1 as a target for Hog1 (Escote et al., 2004
).
|
To further analyze Sol1, the full-length protein and an amino-terminal truncation of the protein were cloned under the control of the GAL1 promoter and expressed in S. cerevisiae. The amino-terminal half of Sol1 contains the majority of its 14 potential CDK target sites and was, by analogy with the Sic1 protein, expected to carry its degradation signal, but not its CDKI function (Verma et al., 1997b
; Hodge and Mendenhall, 1999
). Whereas the full-length Sol1 protein showed little effect on growth of the S. cerevisiae cells under inducing conditions, the truncated Sol1 protein strongly inhibited growth (Figure 9A). Furthermore, expression of full-length Sol1 caused the appearance of enlarged, elongated buds, and this phenotype was exacerbated in the cells expressing the truncated protein (Figure 9B). However, unlike stable Sic1, expression of which causes cell cycle arrest in G1 (Schwob et al., 1994
; Verma et al., 1997a
; see below), the truncated Sol1, although able to inhibit growth of S. cerevisiae, did not lead to G1 arrest in S. cerevisiae (Figure 9C).
|
|
Phenotypes of the SOL1 overexpression in C. albicans
Overexpression of SOL1 in C. albicans was achieved by cloning it under the CaCUP1 promoter and expressing it in the crp1/ mutant, as described above for SIC1. To directly compare the activities of Sol1 and Sic1, both proteins were expressed from the same promoter, in full-length form or as N-terminal truncations. Whereas ectopic expression of the full-length proteins showed little effect on cell growth, expression of the N-terminally truncated proteins caused inhibition of cell proliferation (Figure 11A). At the level of cellular morphology, expression of full-length Sol1 had no discernible effect (Figure 11B, d), whereas full-length Sic1 showed some extent of bud elongation (Figure 11B, b). The truncated proteins both induced the formation of elongated buds, but buds induced by Sol1
N (Figure 11B, e and f) were markedly longer than those induced by Sic1
N (Figures 11B, c and 7). FACS analysis of the cultures also revealed significant differences between the two proteins: whereas expression of Sic1 in its native form caused an accumulation of cells in G1, and expression of the truncated Sic1 caused cell cycle arrest in G1, overexpression of the full-length Sol1 did not affect the cell cycle distribution of the culture, and the truncated Sol1 only moderately increased the G1 cell population (Figure 11C). Because all four proteins were expressed as fusions to an identical N-terminal Myc epitope sequence, we compared the protein levels by Western blotting with an anti-Myc monoclonal antibody (mAb) (Figure 11D). The protein levels of the truncated proteins were markedly higher than their full-length counterparts. This was expected for Sic1, because the deleted region contains the residues required for its degradation (Verma et al., 1997b
), and it suggests that truncation of Sol1 likewise caused its stabilization. Importantly, levels of the two native proteins were comparable, and the level of Sol1
N seemed, if anything, higher than that of Sic1
N. Thus, lower protein levels cannot be invoked to explain the weaker effect of Sol1 on G1 accumulation.
|
|
Phenotype of the sol1/ Cacdc4/ Double Mutant
To test whether stabilization of Sol1 can account for the filamentation phenotype of the Cacdc4/ mutant, we created the double mutant by deleting both alleles of CaCDC4 in the sol1/ background. The resulting double mutant showed a constitutive hyphal morphology similar to the single Cacdc4/ mutant, suggesting that stabilization of Sol1 does not play an essential role in the filamentation phenotype of Cacdc4/ (Figure 12D).
| DISCUSSION |
|---|
|
|
|---|
C. albicans Sol1 Is a Functional Homologue of S. cerevisiae Sic1
A second possibility for the viability of the C. albicans cdc4/ mutant was that C. albicans does not possess a Sic1 homologue. Sic1 plays important roles in cell cycle progression in S. cerevisiae, both in coordinating bud emergence with the initiation of DNA replication and in promoting mitotic exit (Donovan et al., 1994
; Nugroho and Mendenhall, 1994
; Schwob et al., 1994
). However, it was possible that C. albicans uses alternative mechanisms for these functions. Indeed, database searches failed to uncover any candidates based on sequence homology. By applying a functional screen based on the ability of Sic1 to suppress mitotic exit mutants, we were nonetheless able to isolate Sol1, a homologue of Sic1 from C. albicans. Mitotic exit in S. cerevisiae requires down-regulation of Clb2/Cdc28, which occurs via activation in telophase of APC/C-Cdh1, a Clb2-specific ubiquitin ligase (Visintin et al., 1998
). Inhibition of Clb2/Cdc28 activity by the CDK inhibitor Sic1 represents an alternative pathway to promote mitotic exit. Thus, the ability of Sol1 overexpression to likewise suppress the mitotic exit mutant dbf2-3 supports its function as an inhibitor of the mitotic kinase. In spite of the low sequence conservation, multiple alignment of Sol1 with several presumed ascomycete Sic1 orthologues further supports its assignment as a Sic1 homologue.
Sol1 and Sic1 Activities Overlap Only Partially
However, the overexpression phenotype of Sol1 in both S. cerevisiae and C. albicans does not correspond to the phenotype of Sic1 overexpression. This is most clearly seen when Sic1 and Sol1 overexpression was directly compared in C. albicans: whereas full-length Sic1 lead to a G1 delay, and truncated Sic1 caused G1 arrest, the full-length and truncated Sol1 caused no visible effect, and at most a G1 delay, respectively (Figure 11). This is not due to differential accumulation of the Sic1 and Sol1 proteins, because Western blotting analysis indicates that the full-length proteins are equivalently expressed, and the truncated Sol1 is, if anything, more abundant than the truncated Sic1. The morphology of cells overexpressing Sic1 and Sol1 is also different: C. albicans cells overexpressing truncated Sic1 exhibit elongated buds, but cells overexpressing truncated Sol1 exhibit even longer buds that are reminiscent of germ tubes. Thus, we are led to the conclusion that Sic1 and Sol1 are functionally distinct. We speculate that the distinction derives from different interaction with specific cyclinCDK complexes: because the G1 arrest elicited by Sic1 is due to its inhibition of the S-phase kinase Clb5, Clb6/Cdc28 (Schwob et al., 1994
), it is possible that Sol1 has lower affinity for these cyclin-CDK complexes. The effect of Sol1 on cellular morphology may derive from its inhibitory effect on Clb1,2/Cdc28. This kinase is responsible for the switch from apical to isotropic growth after bud emergence (Lew and Reed, 1993
). Inhibition of this switch would lead to highly elongated buds, as observed upon Sol1 overexpression. Conversely, in the sol1/ mutant, one might expect an acceleration in the switch to isotropic growth, which might explain the peculiar thick-budded morphology of this mutant (Figure 12B). The elongation of the sol1/ buds could be a secondary effect of a block, e.g., in mitotic progression (Bachewich et al., 2003
). The elongated sol1/ buds usually show a single elongated DNA mass in the middle of the bud, consistent with a block in telophase (our unpublished data); however, we were unable to measure the cell cycle distribution of this mutant by flow cytometry.
Does C. albicans Contain Another Sic1 Homologue?
If Sol1 is not a "true" Sic1 homologue, i.e., one that inhibits initiation of replication, does such a homologue exist at all in C. albicans? We cannot exclude that a bona fide Sic1 homologue still hides in the C. albicans genome. However, we note that in S. cerevisiae, Sic1 is required for the coordination between budding and S-phase initiation. This results from the inhibitory function of Sic1 on the S-phase kinase Clb5,6/Cdc28, together with the fact that Cln1, 2/Cdc28, the same kinase that causes bud emergence (Lew and Reed, 1993
), phosphorylates Sic1, which leads to its degradation and to the initiation of S phase (Schneider et al., 1996
; Tyers, 1996
). In C. albicans, initiation of hyphal bud evagination is not necessarily coordinated with a specific cell cycle phase (Hazan et al., 2002
), i.e., a mechanism must exist that allows the initiation of polarized growth independently of the regulation of the S-phase kinase. In addition, during hyphal growth, DNA replication is regulated independently of the hyphal tip elongation, which is continuous. Thus, it is possible that the Sic1 S-phase kinase inhibitory function, which imposes an obligatory coordination between polarized growth and the initiation of S phase, is absent in C. albicans. Alternatively, such a function could exist, but it may be restricted to the yeast mode of growth.
Role of CaCdc4 in the Signaling Pathway of Filamentation
Analysis of the dynamics of filament formation subsequent to the loss of CaCdc4 protein and of SCFCaCDC4 function indicates that within 90 min of tetracycline addition, most of the CaCdc4 protein has disappeared from the cell (Figure 4). SCFCaCDC4 function, as measured by the accumulation of Sol1, is impeded already 4 h after tetracycline addition, but high accumulation of Sol1 only occurs some 5.5 h after tetracycline addition (our unpublished data). The discrepancy might indicate that CaCdc4 is present in excess under normal conditions, and significant levels of SCFCaCDC4 function are maintained even when most of CaCdc4 has disappeared from the cell; alternatively, it is possible that the tagged CaCdc4 protein is less stable than the untagged protein. Importantly, however, 10 h after tetracycline addition, when promoter shut-off analysis indicated that Sol1 is completely stabilized, only pseudohyphal cells were visible in the culture. Only 24 h after tetracycline addition could some true hyphal cells be detected in the culture. The lag between the loss of SCFCaCDC4 activity and the appearance of hyphae suggests that SCFCaCDC4 knockdown by itself may be sufficient to induce pseudohyphal growth but not hyphal growth. The rapid response of the Cacdc4/ mutant to serum (Figure 6) suggests that this strain may be hypersensitized to hyphal induction signals but that a signal is still required. The lag between disappearance of CaCdc4 activity and appearance of hyphae in the TET-CaCDC4 strain may reflect the requirement of an additional signal such as, e.g., starvation, or growth on a semisolid agar medium. Thus, SCFCaCDC4-mediated degradation seems to modulate the cellular response to morphogenetic signals rather than to initiate these signals.
Substrates of SCFCaCDC4
Even though Sol1 carries morphogenetic functions and is a substrate of SCFCaCDC4, epistasis analysis indicated that stabilization of Sol1 alone does not explain the hyperfilamentation phenotype of the Cacdc4/ mutant. We also identified and excluded the C. albicans Far1 homologue, another SCFCDC4 substrate in S. cerevisiae that plays a role in cell morphogenesis. Thus, the critical substrate of SCFCaCDC4 for the induction of filamentation remains elusive. Notably, until this substrate is identified, we cannot reject the formal possibility that the phenotype of the Cacdc4/ mutant reflects a function of CaCdc4 that is independent of the SCF complex. Additional potential SCFCaCDC4 candidate substrates include any one of the large number of transcription factors that have been shown to promote hyphal growth. Of these transcription factors, CaTec1 (Schweizer et al., 2000
) stands out because its yeast homologue was recently shown to be targeted for degradation by SCFCDC4 (Chou et al., 2004
). However, the Cdc4 consensus targeting sequence identified in ScTec1 is not conserved in CaTec1, and in preliminary experiments, we found that CaTec1 is degraded equally rapidly in wild-type and CaCdc4-depleted cells (our unpublished data). The critical SCFCaCDC4 substrate might alternatively be found among cell cycle regulators that promote filamentous growth. G1 cyclins, in particular, are often targeted for degradation by SCF complexes in many organisms (Willems et al., 2004
). Of the three G1 cyclins described in C. albicans, CaCln1/Ccn1 (Loeb et al., 1999
), Hgc1 (Zheng and Wang, 2004
), and CaCln3 (Bachewich and Whiteway, 2005
; Chapa y Lazo et al., 2005
), the former two play a positive role in filamentous growth. CaCln3, in contrast, negatively regulates filamentous growth, and depletion of CaCln3 induces a pseudohyphal or hyphal phenotype somewhat reminiscent of the phenotype obtained upon CaCdc4 depletion (Bachewich and Whiteway, 2005
; Chapa y Lazo et al., 2005
). Thus, it is possible that CaCln3, rather than being a substrate of CaCdc4, operates in the same pathway, one possibility being that CaCln3 phosphorylates a target(s) that is subsequently recognized by SCFCaCDC4.
The signal transduction pathways that mediate the filamentous response of C. albicans to different growth conditions are incompletely understood. The finding that a protein degradation system heavily influences the dimorphic switch adds an additional potential layer of regulation to the yeast-to-hyphae transition. The targets of SCFCaCDC4 that cause its filamentation phenotype, and the mode of regulation of their turnover, will likely represent central regulators of morphogenesis. Future studies will aim to identify these SCFCaCDC4 targets.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Address correspondence to: Daniel Kornitzer (danielk{at}techunix.technion.ac.il).
| REFERENCES |
|---|
|
|
|---|
Bachewich, C., and Whiteway, M. ((2005). ). Cyclin Cln3p links G1 progression to hyphal and pseudohyphal development in Candida albicans. Eukaryot. Cell 4, , 95102.
Bai, C., Sen, P., Hofmann, K., Ma, L., Goebl, M., Harper, J. W., and Elledge, S. J. ((1996). ). SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86, , 263274.[CrossRef][Medline]
Bensen, E. S., Filler, S. G., and Berman, J. ((2002). ). A forkhead transcription factor is important for true hyphal as well as yeast morphogenesis in Candida albicans. Eukaryot. Cell 1, , 787798.
Birse, C. E., Irwin, M. Y., Fonzi, W. A., and Sypherd, P. S. ((1993). ). Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infect. Immun. 61, , 36483655.
Braun, B. R., and Johnson, A. D. ((1997). ). Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science 277, , 105109.
Braun, B. R., Kadosh, D., and Johnson, A. D. ((2001). ). NRG1, a repressor of filamentous growth in C. albicans, is down-regulated during filament induction. EMBO J. 20, , 47534761.[CrossRef][Medline]
Chang, F., and Herskowitz, I. ((1990). ). Identification of a gene necessary for cell cycle arrest by a negative growth factor of yeast: FAR1 is an inhibitor of a G1 cyclin, CLN2. Cell 63, , 9991011.[CrossRef][Medline]
Chapa y Lazo, B., Bates, S., and Sudbery, P. ((2005). ). The G1 cyclin Cln3 regulates morphogenesis in Candida albicans. Eukaryot. Cell 4, , 9094.
Chi, Y., Huddleston, M. J., Zhang, X., Young, R. A., Annan, R. S., Carr, S. A., and Deshaies, R. J. ((2001). ). Negative regulation of Gcn4 and Msn2 transcription factors by Srb10 cyclin-dependent kinase. Genes Dev. 15, , 10781092.
Chou, S., Huang, L., and Liu, H. ((2004). ). Fus3-regulated Tec1 degradation through SCFCdc4 determines MAPK signaling specificity during mating in yeast. Cell 119, , 981990.[CrossRef][Medline]
Donovan, J. D., Toyn, J. H., Johnson, A. L., and Johnston, L. H. ((1994). ). P40SDB25, a putative CDK inhibitor, has a role in the M/G1 transition in Saccharomyces cerevisiae. Genes Dev. 8, , 16401653.
Ernst, J. F. ((2000). ). Transcription factors in Candida albicans - environmental control of morphogenesis. Microbiology 146, , 17631774.
Escote, X., Zapater, M., Clotet, J., and Posas, F. ((2004). ). Hog1 mediates cell-cycle arrest in G1 phase by the dual targeting of Sic1. Nat. Cell Biol. 6, , 9971002.[CrossRef][Medline]
Feldman, R. M., Correll, C. C., Kaplan, K. B., and Deshaies, R. J. ((1997). ). A complex of Cdc4p, Skp1p, and Cdc53p/cullin catalyzes ubiquitination of the phosphorylated CDK inhibitor Sic1p. Cell 91, , 221230.[CrossRef][Medline]
Feng, Q., Summers, E., Guo, B., and Fink, G. ((1999). ). Ras signaling is required for serum-induced hyphal differentiation in Candida albicans. J. Bacteriol. 181, , 63396346.
Fonzi, W. A., and Irwin, M. Y. ((1993). ). Isogenic strain construction and gene mapping in Candida albicans. Genetics 134, , 717728.[Abstract]
Gildor, T., Shemer, R., Atir-Lande, A., and Kornitzer, D. ((2005). ). Coevolution of cyclin pcl5 and its substrate gcn4. Eukaryot. Cell 4, , 310318.
Gola, S., Martin, R., Walther, A., Dunkler, A., and Wendland, J. ((2003). ). New modules for PCR-based gene targeting in Candida albicans: rapid and efficient gene targeting using 100 bp of flanking homology region. Yeast 20, , 13391347.[CrossRef][Medline]
Haase, S. B., and Reed, S. I. ((2002). ). Improved flow cytometric analysis of the budding yeast cell cycle. Cell Cycle 1, , 132136.[Medline]
Hazan, I., Sepulveda-Becerra, M., and Liu, H. ((2002). ). Hyphal elongation is regulated independently of cell cycle in Candida albicans. Mol. Biol. Cell 13, , 134145.
Henchoz, S., Chi, Y., Catarin, B., Herskowitz, I., Deshaies, R. J., and Peter, M. ((1997). ). Phosphorylation- and ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor Far1p in budding yeast. Genes Dev. 11, , 30463060.
Hereford, L. M., and Hartwell, L. H. ((1974). ). Sequential gene function in the initiation of Saccharomyces cerevisiae DNA synthesis. J. Mol. Biol. 84, , 445461.[CrossRef][Medline]
Hershko, A., and Ciechanover, A. ((1998). ). The ubiquitin system. Annu. Rev. Biochem. 67, , 425479.[CrossRef][Medline]
Hodge, A., and Mendenhall, M. ((1999). ). The cyclin-dependent kinase inhibitory domain of the yeast Sic1 protein is contained within the C-terminal 70 amino acids. Mol. Gen. Genet. 262, , 5564.[CrossRef][Medline]
Koepp, D. M., Schaefer, L. K., Ye, X., Keyomarsi, K., Chu, C., Harper, J. W., and Elledge, S. J. ((2001). ). Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase. Science 294, , 173177.
Kornitzer, D., and Ciechanover, A. ((2000). ). Modes of regulation of ubiquitin-mediated protein degradation. J. Cell. Physiol. 182, , 111.[CrossRef][Medline]
Lane, S., Zhou, S., Pan, T., Dai, Q., and Liu, H. ((2001). ). The basic helix-loop-helix transcription factor Cph2 regulates hyphal development in Candida albicans partly via TEC1. Mol. Cell. Biol. 21, , 64186428.
Lee, K. L., Buckley, H. R., and Campbell, C. C. ((1975). ). An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida albicans. Sabouraudia 13, , 148153.[Medline]
Lew, D. J., and Reed, S. I. ((1993). ). Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins. J. Cell Biol. 120, , 13051320.
Lew, D. J., and Reed, S. I. ((1995). ). Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5, , 1723.[CrossRef][Medline]
Liu, H., Kohler, J., and Fink, G. R. ((1994). ). Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266, , 17231726.
Lo, H.-J., Kohler, J., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., and Fink, G. R. ((1997). ). Nonfilamentous C. albicans mutants are avirulent. Cell 90, , 939950.[CrossRef][Medline]
Loeb, J. D., Sepulveda-Becerra, M., Hazan, I., and Liu, H. ((1999). ). A G1 cyclin is necessary for maintenance of filamentous growth in Candida albicans. Mol. Cell. Biol. 19, , 40194027.
Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. ((1998). ). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, , 953961.[CrossRef][Medline]
Mao, J. H., Perez-Losada, J., Wu, D., Delrosario, R., Tsunematsu, R., Nakayama, K. I., Brown, K., Bryson, S., and Balmain, A. ((2004). ). Fbxw7/Cdc4 is a p53-dependent, haploinsufficient tumour suppressor gene. Nature 432, , 775779.[CrossRef][Medline]
Meimoun, A., Holtzman, T., Weissman, Z., McBride, H. J., Stillman, D. J., Fink, G. R., and Kornitzer, D. ((2000). ). Degradation of the transcription factor Gcn4 requires the kinase Pho85 and the SCF(CDC4) ubiquitin-ligase complex. Mol. Biol. Cell 11, , 915927.
Moberg, K. H., Bell, D. W., Wahrer, D. C., Haber, D. A., and Hariharan, I. K. ((2001). ). Archipelago regulates Cyclin E levels in Drosophila and is mutated in human cancer cell lines. Nature 413, , 311316.[CrossRef][Medline]
Mumberg, D., Muller, R., and Funk, M. ((1994). ). Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res. 22, , 57675768.
Nakayama, H., Mio, T., Nagahashi, S., Kokado, M., Arisawa, M., and Aoki, Y. ((2000). ). Tetracycline-regulatable system to tightly control gene expression in the pathogenic fungus Candida albicans. Infect. Immun. 68, , 67126719.
Nash, P., Tang, X., Orlicky, S., Chen, Q., Gertler, F. B., Mendenhall, M. D., Sicheri, F., Pawson, T., and Tyers, M. ((2001). ). Multisite phosphorylation of a CDK inhibitor sets a threshold for the onset of DNA replication. Nature 414, , 514521.[CrossRef][Medline]
Nugroho, T. T., and Mendenhall, M. D. ((1994). ). An inhibitor of yeast cyclin-dependent protein kinase plays an important role in ensuring the genomic integrity of daughter cells. Mol. Cell. Biol. 14, , 33203328.
Orlicky, S., Tang, X., Willems, A., Tyers, M., and Sicheri, F. ((2003). ). Structural basis for phosphodependent substrate selection and orientation by the SCF-Cdc4 ubiquitin ligase. Cell 112, , 243256.[CrossRef][Medline]
Rajagopalan, H., Jallepalli, P. V., Rago, C., Velculescu, V. E., Kinzler, K. W., Vogelstein, B., and Lengauer, C. ((2004). ). Inactivation of hCDC4 can cause chromosomal instability. Nature 428, , 7781.[CrossRef][Medline]
Richardson, M. D., and Warnock, D. W. ((1997). ). Fungal Infection: Diagnosis and Management, Oxford, England: Blackwell Science.
Roemer, T., et al. ((2003). ). Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery. Mol. Microbiol. 50, , 167181.[CrossRef][Medline]
Rottmann, M., Dieter, S., Brunner, H., and Rupp, S. ((2003). ). A screen in Saccharomyces cerevisiae identified CaMCM1, an essential gene in Candida albicans crucial for morphogenesis. Mol. Microbiol. 47, , 943959.[CrossRef][Medline]
Rua, D., Tobe, B. T., and Kron, S. J. ((2001). ). Cell cycle control of yeast filamentous growth. Curr. Opin. Microbiol. 4, , 720727.[CrossRef][Medline]
Schneider, B. L., Yang, Q. H., and Futcher, A. B. ((1996). ). Linkage of replication to start by the Cdk inhibitor Sic1. Science 272, , 560562.[Abstract]
Schweizer, A., Rupp, S., Taylor, B. N., Rollinghoff, M., and Schroppel, K. ((2000). ). The TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence in Candida albicans. Mol. Microbiol. 38, , 435445.[CrossRef][Medline]
Schwob, E., Bohm, T., Mendenhall, M. D., and Nasmyth, K. ((1994). ). The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae. Cell 79, , 233244.[CrossRef][Medline]
Sharkey, L. L., McNemar, M. D., Saporito-Irwin, S. M., Sypherd, P. S., and Fonzi, W. A. ((1999). ). HWP1 functions in the morphological development of Candida albicans downstream of EFG1, TUP1, and RBF1. J. Bacteriol. 181, , 52735279.
Sherman, F., Fink, G. R., and Hicks, J. B. ((1986). ). Methods in Yeast Genetics, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sikorski, R. S., and Hieter, P. ((1989). ). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, , 1927.
Skowyra, D., Craig, K. L., Tyers, M., Elledge, S. J., and Harper, J. W. ((1997). ). F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91, , 209219.[CrossRef][Medline]
Spruck, C. H., Strohmaier, H., Sangfelt, O., Muller, H. M., Hubalek, M., Muller-Holzner, E., Marth, C., Widschwendter, M., and Reed, S. I. ((2002). ). hCDC4 gene mutations in endometrial cancer. Cancer Res. 62, , 45354539.
Stoldt, V. R., Sonneborn, A., Leuker, C. E., and Ernst, J. F. ((1997). ). Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16, , 19821991.[CrossRef][Medline]
Strohmaier, H., Spruck, C. H., Kaiser, P., Won, K. A., Sangfelt, O., and Reed, S. I. ((2001). ). Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line. Nature 413, , 316322.[CrossRef][Medline]
Sudbery, P., Gow, N., and Berman, J. ((2004). ). The distinct morphogenic states of Candida albicans. Trends Microbiol. 12, , 317324.[CrossRef][Medline]
Tripathi, G., Wiltshire, C., Macaskill, S., Tournu, H., Budge, S., and Brown, A. J. ((2002). ). Gcn4 co-ordinates morphogenetic and metabolic responses to amino acid starvation in Candida albicans. EMBO J. 21, , 54485456.[CrossRef][Medline]
Tyers, M. ((1996). ). The cyclin-dependent kinase inhibitor p40SIC1 imposes the requirement for Cln G1 cyclin function at Start. Proc. Natl. Acad Sci. USA 93, , 77727776.
Valtz, N., Peter, M., and Herskowitz, I. ((1995). ). FAR1 is required for oriented polarization of yeast cells in response to mating pheromones. J. Cell Biol. 131, , 863873.
Verma, R., Annan, R. S., Huddleston, M. J., Carr, S. A., Reynard, G., and Deshaies, R. J. ((1997a). ). Phosphorylation of Sic1p by G1 Cdk required for its degradation and entry into S phase. Science 278, , 455460.
Verma, R., Feldman, R. M., and Deshaies, R. J. ((1997b). ). SIC1 is ubiquitinated in vitro by a pathway that requires CDC4, CDC34, and cyclin/CDK activities. Mol. Biol. Cell 8, , 14271437.[Abstract]
Visintin, R., Craig, K., Hwang, E. S., Prinz, S., Tyers, M., and Amon, A. ((1998). ). The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation. Mol. Cell 2, , 709718.[CrossRef][Medline]
Weissman, Z., Berdicevsky, I., Cavari, B. Z., and Kornitzer, D. ((2000). ). The high copper tolerance of Candida albicans is mediated by a P-type ATPase. Proc. Natl. Acad. Sci. USA 97, , 35203525.
Weissman, Z., and Kornitzer, D. ((2004). ). A family of Candida cell surface haem-binding proteins involved in haemin and haemoglobin-iron utilization. Mol. Microbiol. 53, , 12091220.[CrossRef][Medline]
Welcker, M., Orian, A., Jin, J., Grim, J. A., Harper, J. W., Eisenman, R. N., and Clurman, B. E. ((2004). ). The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. Proc. Natl. Acad. Sci. USA 101, , 90859090.
Willems, A. R., Schwab, M., and Tyers, M. ((2004). ). A hitchhiker's guide to the cullin ubiquitin ligases: SCF and its kin. Biochim. Biophys. Acta 1695, , 133170.[Medline]
Yada, M., Hatakeyama, S., Kamura, T., Nishiyama, M., Tsunematsu, R., Imaki, H., Ishida, N., Okumura, F., Nakayama, K., and Nakayama, K. I. ((2004). ). Phosphorylation-dependent degradation of c-Myc is mediated by the F-box protein Fbw7. EMBO J. 23, , 21162125.[CrossRef][Medline]
Zheng, X., and Wang, Y. ((2004). ). Hgc1, a novel hypha-specific G1 cyclin-related protein regulates Candida albicans hyphal morphogenesis. EMBO J. 23, , 18451856.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Trunk, P. Gendron, A. Nantel, S. Lemieux, T. Roemer, and M. Raymond Depletion of the Cullin Cdc53p Induces Morphogenetic Changes in Candida albicans Eukaryot. Cell, May 1, 2009; 8(5): 756 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Jonkers and M. Rep Lessons from Fungal F-Box Proteins Eukaryot. Cell, May 1, 2009; 8(5): 677 - 695. [Full Text] [PDF] |
||||
![]() |
R. K. Sherwood and R. J. Bennett Microtubule Motor Protein Kar3 Is Required for Normal Mitotic Division and Morphogenesis in Candida albicans Eukaryot. Cell, September 1, 2008; 7(9): 1460 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Biswas, P. Van Dijck, and A. Datta Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 348 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kunze, D. MacCallum, F. C. Odds, and B. Hube Multiple functions of DOA1 in Candida albicans Microbiology, April 1, 2007; 153(4): 1026 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q.-M. Shi, Y.-M. Wang, X.-D. Zheng, R. Teck Ho Lee, and Y. Wang Critical Role of DNA Checkpoints in Mediating Genotoxic-Stress-induced Filamentous Growth in Candida albicans Mol. Biol. Cell, March 1, 2007; 18(3): 815 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wang, S. Lane, Z. Tian, A. Sharon, I. Hazan, and H. Liu Temporal and Spatial Control of HGC1 Expression Results in Hgc1 Localization to the Apical Cells of Hyphae in Candida albicans Eukaryot. Cell, February 1, 2007; 6(2): 253 - 261. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||