|
|
|
|
Vol. 16, Issue 7, 3162-3175, July 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



* Cell Division Laboratory, Temasek Life Sciences Laboratory, National University of Singapore, Singapore 117604, Singapore;
Department of Biological Sciences, National University of Singapore, Singapore 117604, Singapore; and
Genome Institute of Singapore, Singapore 138672, Singapore
Submitted September 3, 2004;
Revised April 7, 2005;
Accepted April 14, 2005
Monitoring Editor: David Drubin
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The fission yeast Schizosaccharomyces pombe has been used extensively for the study of mitosis and cytokinesis, due to the structural and molecular conservation of these events in fission yeast and metazoans (Nurse 1990
; Gould and Simanis, 1997
; Feierbach and Chang, 2001
). S. pombe has three chromosomes that condense during mitosis and are separated along an intranuclear mitotic spindle (Yanagida, 1998
). After chromosome segregation, S. pombe cells divide through the use of an actomyosin-based contractile ring. Gene products important for mitotic entry, mitotic progression, and cytokinesis have been identified from a number of genetic screens, as well as from reverse genetic approaches (Nurse et al., 1976
; Hirano et al., 1986
; Chang et al., 1996
; Balasubramanian et al., 1998
). Central to the regulation of mitosis and cytokinesis are the S. pombe polo-related protein kinase Plo1p (Ohkura et al., 1995
; Bähler et al., 1998
; Mulvihill et al., 1999
) and members of the septation initiation network (SIN), a signaling pathway comprised of three protein kinases (Cdc7p, Sid1p, and Sid2p) and a GTPase (Spg1p) (McCollum and Gould, 2001
; Rajagopalan et al., 2003
). Members of the polo-kinase family are conserved across all eukaryotes (Nigg, 1998
). In addition, several components of the SIN are highly conserved, including an analogous signaling complex in the budding yeast referred to as the mitotic exit network (Bardin and Amon, 2001
; McCollum and Gould, 2001
; Simanis, 2003
). The fission yeast Plo1p-kinase and SIN components localize to the spindle pole body and coordinate mitotic events with cytokinesis (McCollum and Gould, 2001
).
To identify novel regulators of mitosis and cytokinesis, we screened a genome-wide bank of fission yeast protein kinase deletion mutants (Bimbó et al., 2005
). The characterization of one of these, Pdk1p (related to phosphoinositide-dependent protein kinase), is reported in this article. Members of the phosphoinositide-dependent-protein kinase family have been identified in a variety of eukaryotes, including plants and humans (Vanhaesebroeck and Alessi, 2000
). One of the best-characterized members from mouse has been shown to be important for insulin-signaling (Lawlor et al., 2002
) and the Drosophila Pdk1p-related protein is required for growth control in a mechanism involving the Akt and S6-kinases (Rintelen et al., 2001
). The Saccharomyces cerevisiae genome encodes two proteins related to mammalian PDK1 termed Pkh1 and Pkh2 (Casamayor et al., 1999
). Although neither is essential, combined deletion leads to loss of viability of cells (Casamayor et al., 1999
). Similarly to other members of the family, they phosphorylate and activate effectors belonging to the AGC family of protein kinases, thereby regulating various cellular processes, such as growth, survival, stress response, cell wall integrity, and endocytosis (Friant et al., 2001
; deHart et al., 2002
; Roelants et al., 2002
, 2004
; Zhang et al., 2004
).
Although several functions have been attributed to Pdk1p-related proteins in metazoans, the finding that Pdk1p-related proteins exist in single-celled organisms raises the possibility that these molecules might be involved in fundamental cellular mechanisms that occur in all cell types. Here, we show that the fission yeast Pdk1p, a component of the mitotic spindle pole bodies (SPBs) and the medial actomyosin ring, is important for progression through mitosis and cytokinesis. Pdk1p seems to synergize with polo-kinase to mediate these effects.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of pdk1
and Pdk1p-GFP Strains
The knockout strain of pdk1 was produced by applying a method of PCR-based homologous recombination. Long oligonucleotide primers (forward: 5'-TTCAGTTGGAATCGAACAGCAAACGTAAAGTAACTCAAACACAACTTCATTTTTCATGAAAACCTCTTTTATAAATGATGCAACAGCTATGACC TCGTAAGCACCCAACTGACGACCCTCACTAAAGGGAAC and reverse: 5'-AAAACACTGACGACAAATAATAAAATATAAAGAAGGTAGTAAATGG GTTGAAAAATCAAATAAAACAAGGTATGGGGTTATTGTAAAACGACG GCCATGGAGTTCTTATCGCCCGCCACTATAGGGCGAATTGG) obtained from Integrated DNA Technologies (Coralville, IA) were used in a PCR reaction to amplify the ura selection marker cassette flanked by sequences homologous to flanking regions of the open reading frame encoded by SPBC1778.10C.
A strain expressing Pdk1p-GFP was generated by first amplifying 1000 base pairs from the 3' end of pdk1 by using the following primers: forward: 5'-GTCGTCCTCGAGTAATTACCGATTTCGGCACAGCC and reverse: 5'-GTCGTCGGATCCCCTCTTCCTCGTTCTCTTCTAC. The PCR fragment was cloned into XhoI-BamHI sites of the integrating vector pJK210-GFP. The obtained plasmid (pCDL711) was linearized using ClaI. All yeast transformations were carried out using the lithium acetate method (Keeney and Boeke, 1994
).
S. pombe Strains, Media, and Reagents
The S. pombe strains used in this study are listed in Table 1. Fission yeast media and genetic manipulations were as described previously (Moreno et al., 1991
). Strains were synchronized by using a temperature-sensitive cdc25-22 mutant. The synchrony at late G2 was achieved by incubating the cultures at the restrictive temperature of 36°C for 4 h. Latrunculin A (LatA) was purchased from Molecular Probes (Eugene, OR) and used at a final concentration of 50 µM.
|
Microscopy
Indirect immunofluorescence staining was performed as described previously (Balasubramanian et al., 1997
).
-TAT-1 (Woods et al., 1989
) (1:200),
-Cdc4p (McCollum et al., 1995
) (1:200),
-Sad1p (Hagan and Yanagida, 1995
) (1:50), and rabbit or mouse
-green fluorescent protein (GFP) (A-6455, A-11120; Molecular Probes) (1:800) antibodies were used at indicated dilutions. Primary antibodies were detected with goat anti-mouse or goat anti-rabbit IgG conjugated with either Alexa-488 or Alexa-594 (A-11001, A-11020, A-11008, and A-11012; Molecular Probes) (1:400).
Images were captured using a Leica DMLB microscope in conjunction with either an Optronics DEI 750-T cooled charge-coupled device (CCD) camera and Leica QWIN software or CoolSNAP ES CCD camera (Photometrics, Tucson, AZ) and Metavue software (Universal Imaging, Downingtown, PA). In some experiments, live cells were visualized using a Zeiss laser scanning confocal microscope LSM META system. Z series of images (for quantification of astral microtubules in Figure 2B) were acquired using a Leica DMIRE2 microscope equipped with Uniblitz shutter, CoolSNAP HQ CCD camera (Photometrics), and MetaMorph 4.6r9 software (Universal Imaging). Images were processed using ImageJ and Adobe Photoshop 5.5.
|
| RESULTS |
|---|
|
|
|---|
|
strain, indicating possible defects in mitosis and cytokinesis. To further characterize the phenotype, an asynchronous population of pdk1
cells was fixed and stained with Alexa-488conjugated phalloidin, 4,6-diamidino-2-phenylindole (DAPI), and anilin blue to visualize F-actin, nuclei, and division septa, respectively (Figure 2A). Wild-type cells treated similarly were used as a control. Approximately 15% of wild-type cells were binucleate, and the remainder was uninucleate. These binucleate wild-type cells contained actomyosin rings, a subset of which seemed to be undergoing constriction. In contrast, 5% of pdk1
cells contained more than two nuclei, 27% contained two nuclei, and the remainder had a single nucleus. Although the assembly and function of the actomyosin ring were not compromised in these cells, additional phenotypes pertaining to the actomyosin ring were detected upon detailed examination (discussed in a later section). Furthermore, some binucleate cells adopted a back-to-back interphase nuclear architecture as observed in SIN mutants (Hagan and Yanagida, 1997
Microtubule staining of asynchronous pdk1
cells revealed the presence of a higher proportion of cells with short spindles (wild type, 2.50 ± 1.26; pdk1
, 6.38 ± 1.09), confirming a delay in early stages of mitosis. In addition, pronounced astral microtubules were detected in cells with short spindles with unsegregated chromosomes. This phenotype was more evident in elongated cells, such as pdk1
cdc25-22 (Figure 2B). To quantify the number of astral microtubules, we synchronized wild-type cdc25-22 and pdk1
cdc25-22 cells at late G2 by shifting the cultures to the restrictive temperature of 36°C. After release to the permissive temperature of 24°C to allow resumption of synchronous mitosis, samples were taken at 15-min intervals. Microtubule structures were stained with anti-TAT-1 antibody, and the number of astral microtubules in cells with a spindle length of 24 µm was counted. Interestingly, although a majority of wild-type cells had one or two astral microtubules, more than two (and typically three or four) astral microtubules were detected in pdk1
cdc25-22 cells (Figure 2C). Furthermore, some astral microtubules were qualitatively longer than in wild-type cells. Given recent observations that the majority of astral microtubules were intranuclear (described as intranuclear astral microtubules [Sagolla et al., 2003
] or intranuclear microtubules [Zimmerman et al., 2004
]) before anaphase B, we were interested to determine whether the profusion of astral microtubules was intranuclear in nature. To answer this question, we created a pdk1
strain expressing Uch2p-GFP, a component of the nuclear envelope and the nuclear matrix. In this strain, the majority of astral microtubules were intranuclear in nature. Thus, loss of Pdk1p function leads to a delay in early stages of mitosis characterized by an increased number of intranuclear astral microtubules.
To further investigate the role of Pdk1p in mitosis and cytokinesis, we analyzed a population of cells that were synchronously released into mitosis (as described in the previous section). Comparison of the localization of essential cyclinB/Cdc13p-YFP fluorescence, as an indicator of entry into mitosis (Decottignies et al., 2001
), established that pdk1
cells were not appreciably delayed for entry into mitosis (Figure 3A). We also did not detect a considerable delay in the separation of spindle pole bodies visualized using Sid2p-GFP as a marker for the SPB (Figure 3B). Interestingly, Cdc13p-YFP was detected for longer periods on the spindle. Given that Cdc13p-YFP is only detected on the metaphase spindle, it seemed that pdk1
cells were delayed for progression from metaphase to anaphase. Correspondingly, the appearance of binucleate cells, assembly of actomyosin rings (Figure 3D), and division septa (Figure 3E) also were delayed.
|
cells, we asked whether bypassing the spindle assembly checkpoint (by inactivation of Mad2p and/or Mph1p; He et al., 1997
. We found that the metaphase delay was almost completely eliminated in pdk1
mph1
cdc25-22 (Figure 3C) and pdk1
mad2
cdc25-22 (our unpublished data), and anaphase onset in these strains seemed to occur at a timing comparable with that in cdc25-22 single mutant cells. Thus, the metaphase delay likely results from the activation of the spindle assembly checkpoint. Interestingly, even though the chromosome segregation delay was abolished in the absence of Mph1p or Mad2p, the delay in actomyosin ring assembly was only partially corrected in the absence of Mad2p or Mph1p (Figure 3D), suggesting that a possible structural defect might cause the delay in the assembly of the ring.
To further characterize whether the metaphase delay resulted from a defect in kinetochore attachment to microtubules (MTs), we studied the localization of Mad2p in pdk1
cells. Mad2p has been reported to localize transiently to unattached kinetochores and relocate to the mitotic spindle once attachment of kinetochores to microtubules and bipolar orientation of chromosomes is achieved (Ikui et al., 2002
). Whereas
20% of wild-type cells with short metaphase-like spindles displayed a prominent kinetochore-associated Mad2p-GFP signal, this signal was detected in
31% of pdk1
cells, indicating that at least part of the metaphase delay might result from improper kinetochore attachment (Figure 3F).
Pdk1p Localizes to the SPBs and Cell Cortex in Early Mitosis
To study the in vivo localization of Pdk1p, the chromosomal copy of the gene was fused at its 3' end to the gene encoding GFP. Observation of cells fixed with formaldehyde revealed that Pdk1p-GFP was present in a single medial spot in a small proportion of uninucleate cells and in two spots in mitotic cells, suggesting SPB localization of Pdk1p. To test whether this was the case, we investigated the localization of Pdk1p in cells concomitantly expressing a cyan fluorescent protein (CFP)-tagged version of the SPB component, Sid4p (Chang and Gould, 2000
). In early mitotic cells, with metaphase- and anaphase-like configuration, Pdk1p was found to colocalize with Sid4p-CFP (Figure 4A). Whereas Sid4p-CFP was detected at the SPBs throughout mitosis and in interphase cells, Pdk1p was visible only in metaphase/anaphase A and early anaphase B (Figure 4A). Of 200 cells with two SPBs, Pdk1p was detected at the SPBs only in 50 cells (25%). Cells with Pdk1p-GFP at 1 SPB were rarely observed and were found subsequently to represent duplicated and unseparated SPBs early upon entry into mitosis (Figure 4A, arrow). Costaining with antibodies against Sad1p (Hagan and Yanagida, 1995
) also confirmed that Pdk1p was a component of early mitotic SPBs (our unpublished data).
|
In some live cells undergoing mitosis, we noticed a faint cortical signal in the middle of the cell (Figure 4B, arrowheads). However, this Pdk1p-GFP staining was lost upon fixation. To determine the exact timing of appearance of GFP signal on the structures mentioned, we examined the Pdk1p-GFP localization in a synchronous cdc25-22 cell population by using time-lapse microscopy. No Pdk1p-GFP signal was visible in G2 arrested cdc25-22 cells (our unpublished data). On release to the permissive temperature and early in mitosis, Pdk1p was detected on unseparated spindle pole bodies and the cortex overlying the nucleus. The strongest signal of Pdk1p-GFP on the SPBs and the cortical band/ring was visible in the early stages of mitosis (metaphase and anaphase A). After anaphase A onset and spindle elongation, the intensity of GFP signal on SPBs declined, and Pdk1p-GFP was undetectable in late anaphase B (Figure 4C).
Next, we tested the possibility of involvement of the actin cytoskeleton in Pdk1p localization. On treatment of synchronized Pdk1p-GFP cdc25-22 cells with the actin-depolymerizing drug LatA, we were able to observe Pdk1p in the medial cortical region of 45 of 50 metaphase cells examined (Figure 4D). Therefore, it seems that the actin cytoskeleton is not required to localize Pdk1p to the cortex.
Interaction of pdk1 with Fission Yeast Polo-Kinase plo1
The localization pattern of Pdk1p is reminiscent of the fission yeast polo-kinase Plo1p (Mulvihill et al., 1999
), in that both proteins are present on early mitotic SPBs and in medial cortical rings. To test the possibility that these similarly localizing proteins performed overlapping functions, we crossed pdk1
strain to different temperature-sensitive mutants of plo1. The alleles chosen were plo1-1, plo1-24C, plo1-25 (Bähler et al., 1998
). Given the possibility of synthetic genetic interactions, and that plo1ts mutants were rescued by addition of 1.2 M sorbitol as an osmotic stabilizer (Bimbó, unpublished data), tetrads were dissected on plates containing 1.2 M sorbitol. In all cases, we found that the double mutants were significantly slower growing in the absence of sorbitol, suggesting a possible overlap of function. To characterize the phenotype resulting from simultaneous loss of Pdk1p and Plo1p, the double mutants were grown on medium containing sorbitol and transferred to medium lacking sorbitol. pdk1
plo1-1 and pdk1
plo1-25 double mutants were found to be incapable of colony formation and although the pdk1
plo1-24C double mutant was able to form colonies (Figure 5A), the cells exhibited a variety of morphological phenotypes.
|
plo1ts double mutants exhibited chromosome segregation defects in 520% of the cells (Figure 5C, a). Whereas multinucleate cells with a SIN phenotype were rarely observed in plo1ts mutants at 24°C, between 20 and 25% of all three pdk1
plo1ts double mutants displayed a SIN phenotype (Figure 5C, b and c). Finally, whereas <1% of all plo1ts mutants and
7% of pdk1
cells contained misplaced septa, up to 50% of the pdk1
plo1ts cells contained misplaced septa (Figure 5C, d). The genetic analyses performed with plo1 and pdk1 established that these two gene products possibly function in an overlapping manner to regulate mitotic progression, actomyosin ring positioning and SIN signaling.
Mid1p-Ring Assembly Is Altered in pdk1 Mutants
We have shown that the pdk1
mutant accumulates cells with multiple nuclei. This could result from improper assembly/function of the actomyosin ring or from defective SIN signaling. Mishra et al. (2004
) recently reported that a checkpoint mechanism that depends on the protein phosphatase Clp1p/Flp1p (Cueille et al., 2001
; Trautmann et al., 2001
), and SIN allows for completion of cytokinesis and increased viability in response to minor damage to the cell division apparatus. Several viable mutants partially defective in the cell division apparatus depend on Clp1p for their viability. We found that the pdk1
phenotype was substantially worsened in the absence of Clp1p. Thirty-four percent of the pdk1
clp1
double mutant (Figure 6) cells accumulated more than two nuclei. This is considerably higher than that seen in clp1
(0.5%) and pdk1
(7%) mutants. The additive phenotypic effect upon combination of pdk1
and clp1
suggested that pdk1
cells were partially defective in the assembly and/or function of the cell division apparatus.
|
The similarities between the localization of Pdk1p and Plo1p (which regulates Mid1p localization; Bähler et al., 1998
) and the finding that mid1 mutants, as with pdk1
mutants, are delayed for actomyosin ring assembly (Wu et al., 2003
), suggested that pdk1
cells might be defective for Mid1p localization. Alternatively, pdk1
cells might be defective for proper assembly and function of other actomyosin ring components. We therefore examined the localization of Mid1p-GFP, Cdc4p, Rlc1p-GFP, and F-actin in wild-type and pdk1
cells. The localization of Cdc4p (Figure 7A), Rlc1p-GFP, and F-actin (our unpublished data) was similar in wild-type and pdk1
cells. Interestingly, however, Mid1p-GFP localization was altered in pdk1
cells compared with wild-type cells (Figure 7A). It has been reported that Mid1p leaves the nucleus early in mitosis upon activation by polokinase and translocates into a cortical band, which collapses into a tight ring during anaphase (Paoletti and Chang, 2000
). Whereas Mid1p exit from the nucleus was not altered in pdk1
cells, properly organized Mid1p rings were infrequently observed. In a wild-type culture, 2% of cells undergoing anaphase contained Mid1p-GFP in a broad medial band, whereas the rest contained fully formed Mid1p-GFP rings. In contrast, 34% of pdk1
cells undergoing anaphase exhibited Mid1p-GFP in a broad medial band (Figure 7B). Thus, Pdk1p is important for efficient organization of Mid1p rings at mitosis.
|
Because pdk1
cells are defective in assembly of proper Mid1p rings and are dependent on Clp1p for maximal viability, we examined whether mid1
(Chang et al., 1996
; Sohrmann et al., 1996
) cells showed a deleterious effect in combination with clp1
. In mid1
, 20% of cells contained two or more nuclei. In contrast, 66% of the double mutant of mid1
clp1
cells accumulated two or more nuclei (Figure 6, A and B). Thus mid1
cells depend on Clp1p for maximal viability.
Given the interaction between Mid1p and Pdk1p, we addressed whether Pdk1p localization to the cell cortex depended on Mid1p function. To this end, we expressed Pdk1p-GFP in a mid1
cdc25-22 strain. Whereas mitotic cdc25-22 cells displayed prominent cortical Pdk1p localization, such localization was not detected in cells deleted for mid1 (Figure 7C). This observation indicated that Mid1p is essential for cortical localization of Pdk1p necessary to target Pdk1p to the future site of cell division.
Genetic Interactions with the Components of Septation Initiation Network
We have described the occurrence of pdk1
cells with multiple nuclei, a phenotype similar to that observed in SIN mutants. Moreover, components of this signaling cascade in S. pombe are known to localize to the SPB at discrete stages during the cell cycle (reviewed in Simanis, 2003
). We therefore tested genetic interactions between SIN mutants and pdk1
. Given the possibility of deleterious interactions, tetrads were dissected on plates containing sorbitol. The mutants sid1-239, sid2-250, spg1-106, sid4-A1, cdc7-24, cdc11-123, cdc14-118, and cdc16-116 were crossed to pdk1
. Double mutants of the genotypes pdk1
sid2-250, pdk1
spg1-106, pdk1
sid4-A1 were unable to divide and form colonies at all temperatures in the absence of sorbitol but were capable of colony formation at 24°C when the growth medium was supplemented with sorbitol (Figure 8A). Microscopic examination of cells revealed that the lethality of all three double mutants was due to the accumulation of multiple nuclei in cells after failure of cytokinesis (Figure 8B).
|
| DISCUSSION |
|---|
|
|
|---|
The majority of phosphoinositide-dependent protein kinases isolated from higher eukaryotes have a pleckstrin homology domain enabling their binding to phospholipid membranes and association with substrates. Interestingly, the budding yeast homologues Pkh1p/Pkh2p lack the pleckstrin homology domain (Casamayor et al., 1999
) and are regulated by sphingolipid long-chain bases instead (Sun et al., 2000
; Friant et al., 2001
; Zhang et al., 2004
). According to our results obtained from the sequence analysis, S. pombe Pdk1p is most related to Pkh1p and does not contain detectable PH domains. There is an additional PDK1-like protein in fission yeast, termed Ksg1, and its function is required for meiosis and growth (Niederberger and Schweingruber, 1999
; Matsuo et al., 2003
; Tang and McLeod, 2004
), whereas Pdk1p is important for aspects of mitosis and cytokinesis.
Presently, it is not clear how Pdk1p is regulated. It is possible that although Pdk1p lacks a PH domain, it might interact physically with other proteins possessing a PH domain. Although we have been unable to find physical interactions between an obvious candidate, the PH domain protein Mid1p, and Pdk1p, it remains formally possible that Mid1p and Pdk1p function together in a complex in vivo. It is interesting to note that mammalian PDK1 interacts with the PH domain protein PKB/AKT (reviewed in Mora et al., 2004
). Phosphatidylinositol 3,4,5-trisphosphate [PtdIns(3,4,5)P3] has recently been observed in fission yeast cells lacking Ptn1p, a PTEN homolog (Mitra et al., 2004
). It will be interesting to study whether Pdk1p is regulated by PtdIns(3,4,5)P3 and/or sphingolipids.
Pdk1p is not essential for cell viability, although mitotic and cytokinetic abnormalities were observed. These include a pronounced delay in metaphase due to the activation of the spindle assembly checkpoint, a delay in actomyosin ring assembly, and defects associated with assembly of anillin-related Mid1p into the actomyosin ring. Pdk1p seems to mediate these effects in combination with Plo1p, the fission yeast Polo-kinase orthologue.
What role does Pdk1p play in mitosis? Cultures of pdk1
contain a high proportion of cells with short metaphase spindles, suggesting that Pdk1p plays an important, although nonessential role in mitotic progression. As a consequence of the metaphase delay, cytokinesis and septation are delayed in pdk1
cells. This delay in metaphase is likely a result of the activation of the spindle assembly checkpoint, given our observation that the delay is abolished in the absence of Mph1p or Mad2p. Previous studies have implicated at least two events that are monitored at metaphase (reviewed in Zhou et al., 2002
): kinetochore attachment to the plus ends of the kinetochore microtubules (monitored by function of Mph1p and Mad2p) (He et al., 1997
; He et al., 1998
; Howell et al., 2000
; Ikui et al., 2002
), and proper orientation of the bipolar metaphase spindle leading to the establishment of tension (monitored by function of Mph1p but not Mad2p) (Stern and Murray, 2001
; Rajagopalan et al., 2004
). Pdk1p might be important for kinetochore attachment, because pdk1
mad2
shows reduced metaphase delay and the absence of pdk1 results in an increased proportion of cells with Mad2p at the kinetochores.
An abnormal proliferation of astral microtubules was detected in pdk1
cells in early stages of mitosis. Because most of the astral microtubules are intranuclear at metaphase in pdk1
mutants (as shown in wild-type cells by Zimmerman et al., 2004
), the proliferation of intranuclear astral microtubules observed in pdk1 mutant cells might result from defects in kinetochore attachment and the intranuclear asters might serve the "search-and-capture" function.
Pdk1p localizes to both SPBs and the medial cortical region from early mitosis until early anaphase B. Pdk1p is not detected at the SPBs in cells with fully elongated mitotic spindles and in cells with postanaphase array of microtubules. Pdk1p also was not observed in interphase cells. The localization of Pdk1p is strikingly similar to that of the fission yeast Polo-related Plo1p (Bähler et al., 1998
; Mulvihill et al., 1999
). However, although Plo1p localization depends on the SIN components (Morrell et al., 2004
) localization of Pdk1p is independent of SIN function and Plo1p function (Bimbó, unpublished data). However, as in the case with Plo1p, Pdk1p requires Mid1p function to localize to the cell cortex. These similarities in the localization of Pdk1p and Plo1p led us to investigate relationships between these two protein kinases. We show that compromising Pdk1p function leads to the exacerbation of the phenotype of certain ts alleles of plo1. In particular, whereas plo1-1 and plo1-25 are able to form colonies at 24°C, the double mutants pdk1
plo1-1 and pdk1
plo1-25 display a synthetic lethal phenotype and are unable to form colonies at 24°C, the permissive temperature for all parental strains. All obvious aspects of Plo1p function seem to overlap with Pdk1p function. Thus, pdk1
plo1-1 and pdk1
plo1-25 exhibit defects in chromosome segregation, bipolar spindle assembly, actomyosin ring positioning, timely actomyosin ring assembly as well as division septum assembly. Therefore, Pdk1p plays a minor role in several processes that Plo1p participates in, and these minor roles are exposed when Plo1p function is partially compromised. We have been unable to presently find physical interactions between Plo1p and Pdk1p by coimmunoprecipitation and two-hybrid analyses (our unpublished data). It is therefore possible that Pdk1p and Plo1p do not physically interact but share substrates leading to the overlap of function. Alternatively, the interaction might be too weak to be detected in our immunoprecipitation assays.
We have shown that pdk1
cells exhibit a delay in actomyosin ring assembly that is not fully bypassed by deletion of mph1 or mad2, suggesting that the delay might in part be due to structural defects associated with the actomyosin ring. Previous studies have shown that structural defects in the actomyosin ring are monitored via a checkpoint mechanism that involves the protein phosphatase Clp1p/Flp1p and the SIN (Le Goff et al., 1999
; Liu et al., 1999
, 2000
; Cueille et al., 2001
; Trautmann et al., 2001
; Mishra et al., 2004
). We have shown that clp1
displays an additive deleterious effect in combination with pdk1
, consistent with the idea that pdk1
cells assemble structurally defective rings and that their maximal viability depends on Clp1p function. Delayed actomyosin ring assembly has been described from the analysis of mid1 mutants (Wu et al., 2003
), suggesting that Pdk1p might modulate Mid1p function. Consistent with this, whereas Mid1p is detected in rings in wild-type cells in late anaphase, Mid1p was more diffuse in a high proportion of pdk1
cells. Interestingly, a similarly incomplete accumulation of Mid1p into actomyosin rings has been detected in plo1ts mutants (Paoletti and Chang, 2000
). Thus, Pdk1p and Plo1p might phosphorylate Mid1p to regulate its structural properties leading to timely actomyosin ring assembly and incorporation of Mid1p into the actomyosin ring. The molecular mechanism of Pdk1pMid1p interaction is presently unclear, particularly because we have been unable to detect physical interactions between these two proteins (our unpublished data).
pdk1
mutants also exhibit synthetic lethal interactions with several mutants of the SIN, such as spg1-106, sid4-A1, and sid2-250. Despite the genetic interactions, Pdk1p localization is independent of SIN function and SIN components Cdc7p, Cdc11p, Cdc14p, Sid1p, Sid2p, Spg1p, and Sid4p localize in a Pdk1p-independent manner (Bimbó, unpublished data). Notwithstanding the lack of dependencies in localization, the occurrence of cells with SIN phenotype in pdk1
cultures suggests that Pdk1p might modulate SIN function positively. In particular, it is interesting to note that Sid2p is related to members of the AGC family of kinases (Sparks et al., 1999
; Tamaskovic et al., 2003
) which are known to be regulated by PDK1 family members (Belham et al., 1999
). However, the finding that SIN proteins participate in correcting defects associated with the cell division apparatus (Le Goff et al., 1999
; Liu et al., 1999
; Mishra et al., 2004
) might provide an alternate explanation to the observed synthetic lethality between pdk1
and SIN mutants.
In conclusion, we have reported the first characterized role of the PDK1 family of protein kinases in the regulation of events of mitosis and cytokinesis. The fission yeast PDK1-related protein Pdk1p seems to be important for assembly of a bipolar spindle, actomyosin ring positioning, and Mid1p incorporation into the actomyosin ring. We have shown that Pdk1p cooperates with Plo1p to regulate mitosis and cytokinesis. Future studies should identify substrates of these kinases that bring about the events of mitosis and cytokinesis. Given the high degree of conservation of members of the PDK1 family of kinases, these studies should be relevant to the understanding of related kinases in metazoans and plants.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Address correspondence to: Mohan K. Balasubramanian (mohan{at}tll.org.sg).
| REFERENCES |
|---|
|
|
|---|
Balasubramanian, M. K., McCollum, D., Chang, L., Wong, K. C., Naqvi, N. I., He, X., Sazer, S., and Gould, K. L. ((1998). ). Isolation and characterization of new fission yeast cytokinesis mutants. Genetics 149, , 12651275.
Bardin, A. J., and Amon, A. ((2001). ). Men and sin: what's the difference? Nat. Rev. Mol. Cell. Biol. 2, , 815826.[CrossRef][Medline]
Bähler, J., Steever, A. B., Wheatley, S., Wang, Y., Pringle, J. R., Gould, K. L., and McCollum, D. ((1998). ). Role of polo kinase and Mid1p in determining the site of cell division in fission yeast. J. Cell Biol. 143, , 16031616.
Belham, C., Wu, S., and Avruch, J. ((1999). ). Intracellular signaling: PDK1a kinase at the hub of things. Curr. Biol. 9, , R93R96.[CrossRef][Medline]
Bimbó, A., Jia, Y., Poh, S. L., Karuturi, R.K.M., den Elzen, N., Peng, X., Zheng, L., O'Connell, M., Liu, E. T., Balasubramanian, M. K., and Liu, J. ((2005). ). Systematic deletion analysis of fission yeast protein kinases. Eukaryot. Cell 4, , 799813.
Casamayor, A., Torrance, P. D., Kobayashi, T., Thorner, J., and Alessi, D. R. ((1999). ). Functional counterparts of mammalian protein kinases PDK1 and SGK in budding yeast. Curr. Biol. 9, , 186197.[CrossRef][Medline]
Chang, F., Woollard, A., and Nurse, P. ((1996). ). Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring. J. Cell Sci. 109, , 131142.[Abstract]
Chang, L., and Gould, K. L. ((2000). ). Sid4p is required to localize components of the septation initiation pathway to the spindle pole body in fission yeast. Proc. Natl. Acad. Sci. USA 97, , 52495254.
Cueille, N., Salimova, E., Esteban, V., Blanco, M., Moreno, S., Bueno, A., and Simanis, V. ((2001). ). Flp1, a fission yeast orthologue of the S. cerevisiae CDC14 gene, is not required for cyclin degradation or rum1p stabilisation at the end of mitosis. J. Cell Sci. 114, , 26492664.
deHart, A.K.A., Schnell, J. D., Allen, D. A., and Hicke, L. ((2002). ). The conserved PKH-YPK kinase cascade is required for endocytosis in yeast. J. Cell Biol. 156, , 241248.
Decottignies, A., Zarzov, P., and Nurse, P. ((2001). ). In vivo localisation of fission yeast cyclin-dependent kinase cdc2p and cyclin B cdc13p during mitosis and meiosis. J. Cell Sci. 114, , 26272640.
Feierbach, B., and Chang, F. ((2001). ). Cytokinesis and the contractile ring in fission yeast. Curr. Opin. Microbiol. 4, , 713719.[CrossRef][Medline]
Friant, S., Lombardi, R., Schmelzle, T., Hall, M. N., and Riezman, H. ((2001). ). Sphingoid base signaling via Pkh kinases is required for endocytosis in yeast. EMBO J. 20, , 67836792.[CrossRef][Medline]
Gould, K. L., and Simanis, V. ((1997). ). The control of septum formation in fission yeast. Genes Dev. 11, , 29392951.
Hagan, I., and Yanagida, M. ((1995). ). The product of the spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J. Cell Biol. 129, , 10331047.
Hagan, I., and Yanagida, M. ((1997). ). Evidence for cell cycle-specific, spindle pole body-mediated, nuclear positioning in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 110, , 18511866.[Abstract]
He, X., Jones, M. H., Winey, M., and Sazer, S. ((1998). ). Mph1, a member of Mps1-like family of dual specificity protein kinases, is required for the spindle checkpoint in S. pombe. J. Cell Sci. 111, , 16351647.[Abstract]
He, X., Patterson, T. E., and Sazer, S. ((1997). ). The Schizosaccharomyces pombe spindle checkpoint protein mad2p blocks anaphase and genetically interacts with the anaphase-promoting complex. Proc. Natl. Acad. Sci. USA 94, , 79657970.
Hirano, T., Funahashi, S., Uemura, T., and Yanagida, M. ((1986). ). Isolation and characterization of Schizosaccharomyces pombe cut mutants that block nuclear division but not cytokinesis. EMBO J. 5, , 29732979.[Medline]
Howell, B. J., Hoffman, D. B., Fang, G., Murray, A. W., and Salmon, E. D. ((2000). ). Visualization of Mad2 dynamics at kinetochores, along spindle fibers, and at spindle poles in living cells. J. Cell Biol. 150, , 12331250.
Ikui, A. E., Furuya, K., Yanagida, M., and Matsumoto, T. ((2002). ). Control of localization of a spindle checkpoint protein, Mad2, in fission yeast. J. Cell Sci. 115, , 16031610.
Keeney, J. B., and Boeke, J. D. ((1994). ). Efficient targeted integration at leu132 and ura4294 in Schizosaccharomyces pombe. Genetics 136, , 849856.[Abstract]
Kumar, S., Tamura, K., Jakobsen, I. B., and Nei, M. ((2001). ). MEGA 2, molecular evolutionary genetics analysis software, Bioinformatics 17, , 12441245.
Lawlor, M. A., Mora, A., Ashby, P. R., Williams, M. R., Murray-Tait, V., Malone, L., Prescott, A. R., Lucocq, J. M., and Alessi, D. R. ((2002). ). Essential role of PDK1 in regulating cell size and development in mice. EMBO J. 21, , 37283738.[CrossRef][Medline]
Liu, J., Wang, H., and Balasubramanian, M. K. ((2000). ). A checkpoint that monitors cytokinesis in Schizosaccharomyces pombe. J. Cell Sci. 113, , 12231230.[Abstract]
Liu, J., Wang, H., McCollum, D., and Balasubramanian, M. K. ((1999). ). Drc1p/Cps1p, a 1,3-beta-glucan synthase subunit, is essential for division septum assembly in Schizosaccharomyces pombe. Genetics 153, , 11931203.
Le Goff, X., Woollard, A., and Simanis, V. ((1999). ). Analysis of the cps1 gene provides evidence for a septation checkpoint in Schizosaccharomyces pombe. Mol. Gen. Genet. 262, , 163172.[CrossRef][Medline]
Matsuo, T., Kubo, Y., Watanabe, Y., and Yamamoto, M. ((2003). ). Schizosaccharomyces pombe AGC family kinase Gad8p forms a conserved signaling module with TOR and PDK1-like kinases. EMBO J. 22, , 30733083.[CrossRef][Medline]
McCollum, D., Balasubramanian, M. K., Pelcher, L. E., Hemmingsen, S. M., and Gould, K. L. ((1995). ). Schizosaccharomyces pombe cdc4+ gene encodes a novel EF-hand protein essential for cytokinesis. J. Cell Biol. 130, , 651660.
McCollum, D., and Gould, K. L. ((2001). ). Timing is everything: regulation of mitotic exit and cytokinesis by the MEN and SIN. Trends Cell Biol. 11, , 8995.[CrossRef][Medline]
Mishra, M., Karagiannis, J., Trautmann, S., Wang, H., McCollum, D., and Balasubramanian, M. K. ((2004). ). The Clp1p/Flp1p phosphatase ensures completion of cytokinesis in response to minor perturbation of the cell division machinery in Schizosaccharomyces pombe. J. Cell Sci. 117, , 38973910.
Mitra, P., Zhang, Y., Rameh, L. E., Ivshina, M. P., McCollum, D., Nunnari, J. J., Hendricks, G. M., Kerr, M. L., Field, S. J., Cantley, L. C., and Ross, A. H. ((2004). ). A novel phosphatidylinositol(3,4,5)P3 pathway in fission yeast. J. Cell Biol. 166, , 205211.
Mora, A., Komander, D., van Aalten, D. M., and Alessi, D. R. ((2004). ). PDK1, the master regulator of AGC kinase signal transduction. Semin. Cell Dev. Biol. 15, , 161170.[CrossRef][Medline]
Moreno, S., Klar, A., and Nurse, P. ((1991). ). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, , 795823.[Medline]
Morrell, J. L., Tomlin, G. C., Rajagopalan, S., Venkatram, S., Feoktistova, A. S., Tasto, J. J., Mehta, S., Jennings, J. L., Link, A., Balasubramanian, M. K., and Gould, K. L. ((2004). ). Sid4p-Cdc11p assembles the septation initiation network and its regulators at the S. pombe SPB. Curr. Biol. 14, , 579584.[CrossRef][Medline]
Mulvihill, D. P., Petersen, J., Ohkura, H., Glover, D. M., and Hagan, I. M. ((1999). ). Plo1 kinase recruitment to the spindle pole body and its role in cell division in Schizosaccharomyces pombe. Mol. Biol. Cell 10, , 27712785.
Niederberger, C., and Schweingruber, M. E. ((1999). ). A Schizosaccharomyces pombe gene, ksg1, that shows structural homology to the human phosphoinositide-dependent protein kinase PDK1, is essential for growth, mating and sporulation. Mol. Gen. Genet. 261, , 177183.[CrossRef][Medline]
Nigg, E. A. ((1998). ). Polo-like kinases: positive regulators of cell division from start to finish. Curr. Opin. Cell Biol. 10, , 776783.[CrossRef][Medline]
Nurse, P., Thuriaux, P., and Nasmyth, K. ((1976). ). Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146, , 167167.[CrossRef][Medline]
Nurse, P. ((1990). ). Universal control mechanism regulating onset of M-phase. Nature 344, , 503508.[CrossRef][Medline]
Ohkura, H., Hagan, I. M., and Glover, D. M. ((1995). ). The conserved Schizosaccharomyces pombe kinase plo1, required to form a bipolar spindle, the actin ring, and septum, can drive septum formation in G1 and G2 cells. Genes Dev. 9, , 10591073.
Pearl, L. H., and Barford, D. ((2002). ). Regulation of protein kinases in insulin, growth factor and Wnt signaling. Curr. Opin. Struct. Biol. 12, , 761767.[CrossRef][Medline]
Peterson, R. T., and Schreiber, S. L. ((1999). ). Keeping it all in the family. Curr. Biol. 9, , R521R524.