Molecular Biology of the Cell click for CBE Life Science Education Page

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E04-09-0769 on April 27, 2005

Vol. 16, Issue 7, 3162-3175, July 2005

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E04-09-0769v1
16/7/3162    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bimbó, A.
Right arrow Articles by Balasubramanian, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bimbó, A.
Right arrow Articles by Balasubramanian, M. K.

Roles of Pdk1p, a Fission Yeast Protein Related to Phosphoinositide-dependent Protein Kinase, in the Regulation of Mitosis and Cytokinesis

Andrea Bimbó * {dagger}, Jianhua Liu {ddagger}, and Mohan K. Balasubramanian * {dagger}

* Cell Division Laboratory, Temasek Life Sciences Laboratory, National University of Singapore, Singapore 117604, Singapore; {dagger} Department of Biological Sciences, National University of Singapore, Singapore 117604, Singapore; and {ddagger} Genome Institute of Singapore, Singapore 138672, Singapore

Submitted September 3, 2004; Revised April 7, 2005; Accepted April 14, 2005
Monitoring Editor: David Drubin


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Proteins related to the phosphoinositide-dependent protein kinase family have been identified in the majority of eukaryotes. Although much is known about upstream mechanisms that regulate the PDK1-family of kinases in metazoans, how these kinases regulate cell growth and division remains unclear. Here, we characterize a fission yeast protein related to members of this family, which we have termed Pdk1p. Pdk1p localizes to the spindle pole body and the actomyosin ring in early mitotic cells. Cells deleted for pdk1 display multiple defects in mitosis and cytokinesis, all of which are exacerbated when the function of fission yeast polo kinase, Plo1p, is partially compromised. We conclude that Pdk1p functions in concert with Plo1p to regulate multiple processes such as the establishment of a bipolar mitotic spindle, transition to anaphase, placement of the actomyosin ring and proper execution of cytokinesis. We also present evidence that the effects of Pdk1p on cytokinesis are likely mediated via the fission yeast anillin-related protein, Mid1p, and the septation initiation network.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The segregation of chromosomes during mitosis and the physical division of cells during cytokinesis represent two irreversible events in the cell cycle. Not surprisingly, mitosis and cytokinesis are tightly regulated in the cell cycle in such a way that mitosis is initiated only upon completion of DNA synthesis and cytokinesis is executed only after completion of mitosis.

The fission yeast Schizosaccharomyces pombe has been used extensively for the study of mitosis and cytokinesis, due to the structural and molecular conservation of these events in fission yeast and metazoans (Nurse 1990Go; Gould and Simanis, 1997Go; Feierbach and Chang, 2001Go). S. pombe has three chromosomes that condense during mitosis and are separated along an intranuclear mitotic spindle (Yanagida, 1998Go). After chromosome segregation, S. pombe cells divide through the use of an actomyosin-based contractile ring. Gene products important for mitotic entry, mitotic progression, and cytokinesis have been identified from a number of genetic screens, as well as from reverse genetic approaches (Nurse et al., 1976Go; Hirano et al., 1986Go; Chang et al., 1996Go; Balasubramanian et al., 1998Go). Central to the regulation of mitosis and cytokinesis are the S. pombe polo-related protein kinase Plo1p (Ohkura et al., 1995Go; Bähler et al., 1998Go; Mulvihill et al., 1999Go) and members of the septation initiation network (SIN), a signaling pathway comprised of three protein kinases (Cdc7p, Sid1p, and Sid2p) and a GTPase (Spg1p) (McCollum and Gould, 2001Go; Rajagopalan et al., 2003Go). Members of the polo-kinase family are conserved across all eukaryotes (Nigg, 1998Go). In addition, several components of the SIN are highly conserved, including an analogous signaling complex in the budding yeast referred to as the mitotic exit network (Bardin and Amon, 2001Go; McCollum and Gould, 2001Go; Simanis, 2003Go). The fission yeast Plo1p-kinase and SIN components localize to the spindle pole body and coordinate mitotic events with cytokinesis (McCollum and Gould, 2001Go).

To identify novel regulators of mitosis and cytokinesis, we screened a genome-wide bank of fission yeast protein kinase deletion mutants (Bimbó et al., 2005Go). The characterization of one of these, Pdk1p (related to phosphoinositide-dependent protein kinase), is reported in this article. Members of the phosphoinositide-dependent-protein kinase family have been identified in a variety of eukaryotes, including plants and humans (Vanhaesebroeck and Alessi, 2000Go). One of the best-characterized members from mouse has been shown to be important for insulin-signaling (Lawlor et al., 2002Go) and the Drosophila Pdk1p-related protein is required for growth control in a mechanism involving the Akt and S6-kinases (Rintelen et al., 2001Go). The Saccharomyces cerevisiae genome encodes two proteins related to mammalian PDK1 termed Pkh1 and Pkh2 (Casamayor et al., 1999Go). Although neither is essential, combined deletion leads to loss of viability of cells (Casamayor et al., 1999Go). Similarly to other members of the family, they phosphorylate and activate effectors belonging to the AGC family of protein kinases, thereby regulating various cellular processes, such as growth, survival, stress response, cell wall integrity, and endocytosis (Friant et al., 2001Go; deHart et al., 2002Go; Roelants et al., 2002Go, 2004Go; Zhang et al., 2004Go).

Although several functions have been attributed to Pdk1p-related proteins in metazoans, the finding that Pdk1p-related proteins exist in single-celled organisms raises the possibility that these molecules might be involved in fundamental cellular mechanisms that occur in all cell types. Here, we show that the fission yeast Pdk1p, a component of the mitotic spindle pole bodies (SPBs) and the medial actomyosin ring, is important for progression through mitosis and cytokinesis. Pdk1p seems to synergize with polo-kinase to mediate these effects.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Sequence Analysis
Protein sequences were compared and aligned by ClustalW software. An unrooted evolutionary distance tree was generated with the neighbor joining methods (pairwise deletion of gaps and interior branch test) by using Mega 2.1 software (www.megasoftware.net) (Kumar et al., 2001Go).

Construction of pdk1{Delta} and Pdk1p-GFP Strains
The knockout strain of pdk1 was produced by applying a method of PCR-based homologous recombination. Long oligonucleotide primers (forward: 5'-TTCAGTTGGAATCGAACAGCAAACGTAAAGTAACTCAAACACAACTTCATTTTTCATGAAAACCTCTTTTATAAATGATGCAACAGCTATGACC TCGTAAGCACCCAACTGACGACCCTCACTAAAGGGAAC and reverse: 5'-AAAACACTGACGACAAATAATAAAATATAAAGAAGGTAGTAAATGG GTTGAAAAATCAAATAAAACAAGGTATGGGGTTATTGTAAAACGACG GCCATGGAGTTCTTATCGCCCGCCACTATAGGGCGAATTGG) obtained from Integrated DNA Technologies (Coralville, IA) were used in a PCR reaction to amplify the ura selection marker cassette flanked by sequences homologous to flanking regions of the open reading frame encoded by SPBC1778.10C.

A strain expressing Pdk1p-GFP was generated by first amplifying 1000 base pairs from the 3' end of pdk1 by using the following primers: forward: 5'-GTCGTCCTCGAGTAATTACCGATTTCGGCACAGCC and reverse: 5'-GTCGTCGGATCCCCTCTTCCTCGTTCTCTTCTAC. The PCR fragment was cloned into XhoI-BamHI sites of the integrating vector pJK210-GFP. The obtained plasmid (pCDL711) was linearized using ClaI. All yeast transformations were carried out using the lithium acetate method (Keeney and Boeke, 1994Go).

S. pombe Strains, Media, and Reagents
The S. pombe strains used in this study are listed in Table 1. Fission yeast media and genetic manipulations were as described previously (Moreno et al., 1991Go). Strains were synchronized by using a temperature-sensitive cdc25-22 mutant. The synchrony at late G2 was achieved by incubating the cultures at the restrictive temperature of 36°C for 4 h. Latrunculin A (LatA) was purchased from Molecular Probes (Eugene, OR) and used at a final concentration of 50 µM.


View this table:
[in this window]
[in a new window]
 
Table 1. Yeast strains used in this study

 

Microscopy
Indirect immunofluorescence staining was performed as described previously (Balasubramanian et al., 1997Go). {alpha}-TAT-1 (Woods et al., 1989Go) (1:200), {alpha}-Cdc4p (McCollum et al., 1995Go) (1:200), {alpha}-Sad1p (Hagan and Yanagida, 1995Go) (1:50), and rabbit or mouse {alpha}-green fluorescent protein (GFP) (A-6455, A-11120; Molecular Probes) (1:800) antibodies were used at indicated dilutions. Primary antibodies were detected with goat anti-mouse or goat anti-rabbit IgG conjugated with either Alexa-488 or Alexa-594 (A-11001, A-11020, A-11008, and A-11012; Molecular Probes) (1:400).

Images were captured using a Leica DMLB microscope in conjunction with either an Optronics DEI 750-T cooled charge-coupled device (CCD) camera and Leica QWIN software or CoolSNAP ES CCD camera (Photometrics, Tucson, AZ) and Metavue software (Universal Imaging, Downingtown, PA). In some experiments, live cells were visualized using a Zeiss laser scanning confocal microscope LSM META system. Z series of images (for quantification of astral microtubules in Figure 2B) were acquired using a Leica DMIRE2 microscope equipped with Uniblitz shutter, CoolSNAP HQ CCD camera (Photometrics), and MetaMorph 4.6r9 software (Universal Imaging). Images were processed using ImageJ and Adobe Photoshop 5.5.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 2. pdk1{Delta} is defective in mitosis and cytokinesis. (A) Asynchronously growing pdk1{Delta} cells fixed with formaldehyde and stained with DAPI (DNA), anilin blue (septum and cell wall), and Alexa-488–phalloidin (F-actin). 1, cell with back-to-back interphase nuclear architecture characteristic of SIN mutants; 2, multinucleate cell; bar, 5 µm. (B) Deletion of pdk1 results in extensive proliferation of astral microtubules. Cells of pdk1{Delta} cdc25-22 and control cdc25-22 strains were synchronized at G2/M. Samples taken 30–45 min after release into mitosis were fixed, processed for immunofluorescence, and stained with DAPI, {alpha}-Cdc4p, and {alpha}-TAT-1-antibodies (microtubules). Bar, 5 µm. (C) The number of astral microtubules observed in cells in metaphase/anaphase A (spindle length 2–4 µm) was determined by acquiring series of Z stacks with the interval of 0.1 µm; gray bars, control cdc25-22; black bars, pdk1{Delta} cdc25-22; n = 62 for each strain. (D) The astral microtubules in pdk1{Delta} cells at metaphase are intranuclear. Cells of pdk1{Delta} Uch2p-GFP cdc25-22 were synchronized as described in B and stained with {alpha}-TAT-1, {alpha}-GFP, and DAPI). A representative cell is shown. The merge image is the overlay of GFP and tubulin stainings.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Phosphoinositide-dependent Protein Kinase Pdk1p Is Important for Mitosis and Cytokinesis
In a functional genomics-based approach to identify signaling proteins important for mitosis and cytokinesis, we created a genome-wide bank of mutants deleted for genes encoding protein kinases in fission yeast (Bimbó et al., 2005Go). The characterization of one of these, Pdk1p, is the subject of this article. Pdk1p encodes a serine/threonine protein kinase 549 amino acids in length, with its kinase domain at its N terminus (Figure 1A). Phylogenetic analysis and sequence comparisons established that Pdk1p is related to members of the phosphoinositide-dependent protein kinase family. Pdk1p was most related in its kinase domain to S. cerevisiae Pkh1 kinase (Casamayor et al., 1999Go). S. pombe Pdk1p shared 47% sequence identity with S. cerevisiae Pkh1p that rose to 67% when conserved amino acid substitutions were considered. Pdk1p showed clear similarity to phosphoinositide-dependent protein kinases of arabidopsis, fly, worm, zebrafish, mouse, and human (Figure 1, B and C), and belonged to the polo-kinase superfamily (Bimbó et al., 2005Go). However, unlike other members of the PDK family, a pleckstrin homology (PH) domain was not detected at the C-terminal region of S. pombe Pdk1p. No other readily recognizable motifs were detected outside the protein kinase domains.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. Pdk1p is related to phosphoinositide-dependent protein kinases. (A) Schematic representation of Pdk1p showing the position of the protein kinase domain. (B) ClustalW alignment of kinase domains of Pdk1p (bold) and related proteins (Mm, Mus musculus [Q9Z2A0]; Hs, Homo sapiens [NP_002604]; Dr, Danio rerio [NP_991262]; Os, Oryza sativa [NP_915701]; At, Arabidopsis thaliana [NP_974730]; Dm, Drosophila melanogaster [NP_728471]; Sc, S. cerevisiae-Pkh1p [NP_010778]; Sp, Schizosaccharomyces pombe-Ksg1p [NP_588442]; Ce, Caenorhabditis elegans [NP_508242]. Identical amino acids are marked with an asterisk, conserved substitutions are marked with a colon, and semiconserved substitutions are indicated with dots. (C) Evolutionary distance analysis of fission yeast Pdk1p and phosphoinositide-dependent protein kinases from other species based on the homology of kinase domains.

 
To understand the cellular role of Pdk1p, we analyzed the phenotypes resulting from loss of its function in a strain deleted for the entire coding region of Pdk1p. Pdk1p is dispensable for vegetative growth, although upon microscopic examination, cells of varying sizes were detected in the pdk1{Delta} strain, indicating possible defects in mitosis and cytokinesis. To further characterize the phenotype, an asynchronous population of pdk1{Delta} cells was fixed and stained with Alexa-488–conjugated phalloidin, 4,6-diamidino-2-phenylindole (DAPI), and anilin blue to visualize F-actin, nuclei, and division septa, respectively (Figure 2A). Wild-type cells treated similarly were used as a control. Approximately 15% of wild-type cells were binucleate, and the remainder was uninucleate. These binucleate wild-type cells contained actomyosin rings, a subset of which seemed to be undergoing constriction. In contrast, 5% of pdk1{Delta} cells contained more than two nuclei, 27% contained two nuclei, and the remainder had a single nucleus. Although the assembly and function of the actomyosin ring were not compromised in these cells, additional phenotypes pertaining to the actomyosin ring were detected upon detailed examination (discussed in a later section). Furthermore, some binucleate cells adopted a back-to-back interphase nuclear architecture as observed in SIN mutants (Hagan and Yanagida, 1997Go) (Figure 2A, cell 1). In addition a higher proportion of cells (6.36 ± 1.20%) contained condensed metaphase/anaphase A-like chromosomes, compared with wild-type cells (1.90 ± 1.13%). The incidence of a higher percentage of multinucleate cells (Figure 2A, cell 2) and those with condensed chromosomes indicated that Pdk1p might be important for aspects of mitosis and cytokinesis, although its function was not essential for either process.

Microtubule staining of asynchronous pdk1{Delta} cells revealed the presence of a higher proportion of cells with short spindles (wild type, 2.50 ± 1.26; pdk1{Delta}, 6.38 ± 1.09), confirming a delay in early stages of mitosis. In addition, pronounced astral microtubules were detected in cells with short spindles with unsegregated chromosomes. This phenotype was more evident in elongated cells, such as pdk1{Delta} cdc25-22 (Figure 2B). To quantify the number of astral microtubules, we synchronized wild-type cdc25-22 and pdk1{Delta} cdc25-22 cells at late G2 by shifting the cultures to the restrictive temperature of 36°C. After release to the permissive temperature of 24°C to allow resumption of synchronous mitosis, samples were taken at 15-min intervals. Microtubule structures were stained with anti-TAT-1 antibody, and the number of astral microtubules in cells with a spindle length of 2–4 µm was counted. Interestingly, although a majority of wild-type cells had one or two astral microtubules, more than two (and typically three or four) astral microtubules were detected in pdk1{Delta} cdc25-22 cells (Figure 2C). Furthermore, some astral microtubules were qualitatively longer than in wild-type cells. Given recent observations that the majority of astral microtubules were intranuclear (described as intranuclear astral microtubules [Sagolla et al., 2003Go] or intranuclear microtubules [Zimmerman et al., 2004Go]) before anaphase B, we were interested to determine whether the profusion of astral microtubules was intranuclear in nature. To answer this question, we created a pdk1{Delta} strain expressing Uch2p-GFP, a component of the nuclear envelope and the nuclear matrix. In this strain, the majority of astral microtubules were intranuclear in nature. Thus, loss of Pdk1p function leads to a delay in early stages of mitosis characterized by an increased number of intranuclear astral microtubules.

To further investigate the role of Pdk1p in mitosis and cytokinesis, we analyzed a population of cells that were synchronously released into mitosis (as described in the previous section). Comparison of the localization of essential cyclinB/Cdc13p-YFP fluorescence, as an indicator of entry into mitosis (Decottignies et al., 2001Go), established that pdk1{Delta} cells were not appreciably delayed for entry into mitosis (Figure 3A). We also did not detect a considerable delay in the separation of spindle pole bodies visualized using Sid2p-GFP as a marker for the SPB (Figure 3B). Interestingly, Cdc13p-YFP was detected for longer periods on the spindle. Given that Cdc13p-YFP is only detected on the metaphase spindle, it seemed that pdk1{Delta} cells were delayed for progression from metaphase to anaphase. Correspondingly, the appearance of binucleate cells, assembly of actomyosin rings (Figure 3D), and division septa (Figure 3E) also were delayed.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Metaphase delay in pdk1{Delta}. (A) pdk1{Delta} cells enter mitosis with dynamics similar to the wild type. Exponentially growing pdk1{Delta} cdc25-22 and Cdc13p-YFP cdc25-22 strains were synchronized at G2/M. After release into mitosis the number of live cells showing yellow fluorescent protein (YFP) signal on metaphase/anaphase A spindles was counted at indicated time points. Inset shows a cell displaying Cdc13p-YFP on metaphase spindle. Bar, 1 µm. (B) The separation of spindle pole bodies in pdk1{Delta} cells is only slightly delayed compared with the wild type. Exponentially growing pdk1{Delta} Sid2p-GFP cdc25-22 and Sid2p-GFP cdc25-22 strains were synchronized at G2/M. After release into mitosis samples were taken at 10-min intervals, fixed with formaldehyde, and the number of cells with separated SPBs was counted (n = 300 for each time point). Insets of cell with unseparated SPBs (arrow) and cell with separated SPBs (arrowheads) are shown. Bar, 1 µm. (C–E) Cultures of exponentially growing pdk1{Delta} cdc25-22, pdk1{Delta} mph1{Delta} cdc25-22, and control cdc25-22 were synchronized at G2/M. Cell samples were collected every 15 min after release into mitosis, fixed with formaldehyde, and stained with DAPI and anilin blue as well as processed for immunofluorescence microscopy and stained with DAPI, Alexa-488–conjugated phalloidin, and {alpha}-TAT-1 antibody. Percentage of binucleate cells (C), cells with assembled actin rings (D), and septated cells (E) in the population was determined by counting at least 300 cells for each time point and strain. (F) pdk1{Delta} cells likely have defects in kinetochore attachment. Asynchronously grown cdc25-22 and pdk1{Delta} cdc25-22 strains expressing Mad2p-GFP were fixed and stained with DAPI, {alpha}-TAT-1, and {alpha}-GFP antibodies. Number of cells with short metaphase like spindles expressing Mad2p-GFP on kinetochores was determined. p = 0.00039 (Student's t-test) (n = 500).

 
Given the metaphase delay in pdk1{Delta} cells, we asked whether bypassing the spindle assembly checkpoint (by inactivation of Mad2p and/or Mph1p; He et al., 1997Go, 1998Go) could rescue the metaphase delay seen in pdk1{Delta}. We found that the metaphase delay was almost completely eliminated in pdk1{Delta} mph1{Delta} cdc25-22 (Figure 3C) and pdk1{Delta} mad2{Delta} cdc25-22 (our unpublished data), and anaphase onset in these strains seemed to occur at a timing comparable with that in cdc25-22 single mutant cells. Thus, the metaphase delay likely results from the activation of the spindle assembly checkpoint. Interestingly, even though the chromosome segregation delay was abolished in the absence of Mph1p or Mad2p, the delay in actomyosin ring assembly was only partially corrected in the absence of Mad2p or Mph1p (Figure 3D), suggesting that a possible structural defect might cause the delay in the assembly of the ring.

To further characterize whether the metaphase delay resulted from a defect in kinetochore attachment to microtubules (MTs), we studied the localization of Mad2p in pdk1{Delta} cells. Mad2p has been reported to localize transiently to unattached kinetochores and relocate to the mitotic spindle once attachment of kinetochores to microtubules and bipolar orientation of chromosomes is achieved (Ikui et al., 2002Go). Whereas ~20% of wild-type cells with short metaphase-like spindles displayed a prominent kinetochore-associated Mad2p-GFP signal, this signal was detected in ~31% of pdk1{Delta} cells, indicating that at least part of the metaphase delay might result from improper kinetochore attachment (Figure 3F).

Pdk1p Localizes to the SPBs and Cell Cortex in Early Mitosis
To study the in vivo localization of Pdk1p, the chromosomal copy of the gene was fused at its 3' end to the gene encoding GFP. Observation of cells fixed with formaldehyde revealed that Pdk1p-GFP was present in a single medial spot in a small proportion of uninucleate cells and in two spots in mitotic cells, suggesting SPB localization of Pdk1p. To test whether this was the case, we investigated the localization of Pdk1p in cells concomitantly expressing a cyan fluorescent protein (CFP)-tagged version of the SPB component, Sid4p (Chang and Gould, 2000Go). In early mitotic cells, with metaphase- and anaphase-like configuration, Pdk1p was found to colocalize with Sid4p-CFP (Figure 4A). Whereas Sid4p-CFP was detected at the SPBs throughout mitosis and in interphase cells, Pdk1p was visible only in metaphase/anaphase A and early anaphase B (Figure 4A). Of 200 cells with two SPBs, Pdk1p was detected at the SPBs only in 50 cells (25%). Cells with Pdk1p-GFP at 1 SPB were rarely observed and were found subsequently to represent duplicated and unseparated SPBs early upon entry into mitosis (Figure 4A, arrow). Costaining with antibodies against Sad1p (Hagan and Yanagida, 1995Go) also confirmed that Pdk1p was a component of early mitotic SPBs (our unpublished data).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 4. Subcellular localization of Pdk1p. (A) Association of Pdk1p with the SPB is demonstrated by its colocalization with a known spindle pole body marker, Sid4p. An asynchronous population of cells was fixed and imaged using a Zeiss confocal microscope-Meta LSM 510 system. Pdk1p-GFP, green; Sid4p-CFP, red; and colocalization, yellow. Note that Pdk1p is present on the SPBs only during mitosis. Arrow indicates a cell with unseparated SPBs, expressing both Pdk1p-GFP and Sid4p-CFP. Bar, 1 µm. (B) Pdk1p localizes in vivo to both spindle pole bodies as well as to the cortical region in the equatorial region of the cell. Arrows, SPBs; arrowhead, medial cortical signal. Bar, 1 µm. (C) Detection of timing of Pdk1p localization during mitosis. Pdk1p-GFP cdc25-22 cells were synchronized at G2/M. On release into mitosis, the GFP signal was monitored every minute by using time-lapse confocal microscopy. Selected frames from one movie are shown. Arrowhead: medial cortical staining. (D) Localization of Pdk1p to the cortical region is not dependent on the actin cytoskeleton. cdc25-22 mutants expressing Pdk1p-GFP were synchronized as described above. Live cells were examined every 10 min. LatA was added to the culture to a final concentration of 50 µM, 5 min before shift down to the permissive temperature of 24°C. Depolymerization of all F-actin structures was confirmed by staining with Alexa-488–conjugated phalloidin. Dimethyl sulfoxide was used as a solvent control. Arrowheads indicate medial cortical fluorescence.

 

In some live cells undergoing mitosis, we noticed a faint cortical signal in the middle of the cell (Figure 4B, arrowheads). However, this Pdk1p-GFP staining was lost upon fixation. To determine the exact timing of appearance of GFP signal on the structures mentioned, we examined the Pdk1p-GFP localization in a synchronous cdc25-22 cell population by using time-lapse microscopy. No Pdk1p-GFP signal was visible in G2 arrested cdc25-22 cells (our unpublished data). On release to the permissive temperature and early in mitosis, Pdk1p was detected on unseparated spindle pole bodies and the cortex overlying the nucleus. The strongest signal of Pdk1p-GFP on the SPBs and the cortical band/ring was visible in the early stages of mitosis (metaphase and anaphase A). After anaphase A onset and spindle elongation, the intensity of GFP signal on SPBs declined, and Pdk1p-GFP was undetectable in late anaphase B (Figure 4C).

Next, we tested the possibility of involvement of the actin cytoskeleton in Pdk1p localization. On treatment of synchronized Pdk1p-GFP cdc25-22 cells with the actin-depolymerizing drug LatA, we were able to observe Pdk1p in the medial cortical region of 45 of 50 metaphase cells examined (Figure 4D). Therefore, it seems that the actin cytoskeleton is not required to localize Pdk1p to the cortex.

Interaction of pdk1 with Fission Yeast Polo-Kinase plo1
The localization pattern of Pdk1p is reminiscent of the fission yeast polo-kinase Plo1p (Mulvihill et al., 1999Go), in that both proteins are present on early mitotic SPBs and in medial cortical rings. To test the possibility that these similarly localizing proteins performed overlapping functions, we crossed pdk1{Delta} strain to different temperature-sensitive mutants of plo1. The alleles chosen were plo1-1, plo1-24C, plo1-25 (Bähler et al., 1998Go). Given the possibility of synthetic genetic interactions, and that plo1ts mutants were rescued by addition of 1.2 M sorbitol as an osmotic stabilizer (Bimbó, unpublished data), tetrads were dissected on plates containing 1.2 M sorbitol. In all cases, we found that the double mutants were significantly slower growing in the absence of sorbitol, suggesting a possible overlap of function. To characterize the phenotype resulting from simultaneous loss of Pdk1p and Plo1p, the double mutants were grown on medium containing sorbitol and transferred to medium lacking sorbitol. pdk1{Delta} plo1-1 and pdk1{Delta} plo1-25 double mutants were found to be incapable of colony formation and although the pdk1{Delta} plo1-24C double mutant was able to form colonies (Figure 5A), the cells exhibited a variety of morphological phenotypes.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. Genetic interactions of pdk1 with plo1. (A) Double mutants were grown on YES plates in the presence or absence of 1.2 M sorbitol at 24°C. (B and C) Single and double mutants were grown in liquid YES medium containing 1.2 M sorbitol to early log phase and then washed three times and resuspended in sorbitol-free medium. The cultures were incubated at 24°C for 4 h and fixed with formaldehyde. (B) Bipolar and monopolar spindles in wild-type and pdk1{Delta} plo1-25 mutants, respectively. Cells were stained with DAPI, {alpha}-Sad1p, and {alpha}-TAT-1 antibodies. Merged images are overlays of {alpha}-Sad1p and {alpha}-TAT-1 staining. (C) Quantification of various phenotypes observed in single and double mutants. a, chromosome segregation defects (cells with unequally segregated DNA or "cut" cells in which the division septum cuts through the chromosomes); b, nuclear number in cells: white bars, binucleate; black bars, multinucleate; c, percentage of cells exhibiting SIN phenotype (cells that failed cytokinesis and show an interphase nuclear architecture as well as clustering at the medial region); and d, percentage of cells with misplaced septa (cells with septa not placed in the medial region, and/or not perpendicular to the long axis). For each mutant, at least 300 cells were counted.

 
Three major phenotypes have been described in cells depleted of Plo1p-kinase. These include 1) mitotic abnormalities caused by the formation of a monopolar mitotic spindle; 2) misplaced actomyosin rings; and 3) cytokinesis defects associated with the formation of multinucleate cells with back-to-back nuclei, similar to that observed in SIN mutants (Ohkura et al., 1995Go; Bähler et al., 1998Go; Tanaka et al., 2001Go). The plo1ts mutants used in this study display all the above-mentioned phenotypes at the restrictive temperature of 36°C but rarely do so at the permissive temperature of 24°C. In contrast, double mutants exhibited a striking increase in the numbers of cells with all three phenotypes at 24°C. We observed a high incidence of cells with monopolar mitotic spindles (76.00 ± 5.64%) (Figure 5B) as well as improper chromosome segregation. Compared with the single mutants, which either did not have or only a minor fraction (1–2%) showed defects in chromosome segregation, the pdk1{Delta} plo1ts double mutants exhibited chromosome segregation defects in 5–20% of the cells (Figure 5C, a). Whereas multinucleate cells with a SIN phenotype were rarely observed in plo1ts mutants at 24°C, between 20 and 25% of all three pdk1{Delta} plo1ts double mutants displayed a SIN phenotype (Figure 5C, b and c). Finally, whereas <1% of all plo1ts mutants and ~7% of pdk1{Delta} cells contained misplaced septa, up to 50% of the pdk1{Delta} plo1ts cells contained misplaced septa (Figure 5C, d). The genetic analyses performed with plo1 and pdk1 established that these two gene products possibly function in an overlapping manner to regulate mitotic progression, actomyosin ring positioning and SIN signaling.

Mid1p-Ring Assembly Is Altered in pdk1 Mutants
We have shown that the pdk1{Delta} mutant accumulates cells with multiple nuclei. This could result from improper assembly/function of the actomyosin ring or from defective SIN signaling. Mishra et al. (2004Go) recently reported that a checkpoint mechanism that depends on the protein phosphatase Clp1p/Flp1p (Cueille et al., 2001Go; Trautmann et al., 2001Go), and SIN allows for completion of cytokinesis and increased viability in response to minor damage to the cell division apparatus. Several viable mutants partially defective in the cell division apparatus depend on Clp1p for their viability. We found that the pdk1{Delta} phenotype was substantially worsened in the absence of Clp1p. Thirty-four percent of the pdk1{Delta} clp1{Delta} double mutant (Figure 6) cells accumulated more than two nuclei. This is considerably higher than that seen in clp1{Delta} (0.5%) and pdk1{Delta} (7%) mutants. The additive phenotypic effect upon combination of pdk1{Delta} and clp1{Delta} suggested that pdk1{Delta} cells were partially defective in the assembly and/or function of the cell division apparatus.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 6. clp1{Delta} shows an additive deleterious effect in combination with pdk1{Delta} or mid1{Delta}. (A) Mutants of indicated genotypes were grown in YES to early log phase and then fixed and stained with DAPI and anilin blue. Bar, 5 µm. (B) The proportion of cells with one, two, or more nuclei was determined (n = 500).

 

The similarities between the localization of Pdk1p and Plo1p (which regulates Mid1p localization; Bähler et al., 1998Go) and the finding that mid1 mutants, as with pdk1{Delta} mutants, are delayed for actomyosin ring assembly (Wu et al., 2003Go), suggested that pdk1{Delta} cells might be defective for Mid1p localization. Alternatively, pdk1{Delta} cells might be defective for proper assembly and function of other actomyosin ring components. We therefore examined the localization of Mid1p-GFP, Cdc4p, Rlc1p-GFP, and F-actin in wild-type and pdk1{Delta} cells. The localization of Cdc4p (Figure 7A), Rlc1p-GFP, and F-actin (our unpublished data) was similar in wild-type and pdk1{Delta} cells. Interestingly, however, Mid1p-GFP localization was altered in pdk1{Delta} cells compared with wild-type cells (Figure 7A). It has been reported that Mid1p leaves the nucleus early in mitosis upon activation by polokinase and translocates into a cortical band, which collapses into a tight ring during anaphase (Paoletti and Chang, 2000Go). Whereas Mid1p exit from the nucleus was not altered in pdk1{Delta} cells, properly organized Mid1p rings were infrequently observed. In a wild-type culture, 2% of cells undergoing anaphase contained Mid1p-GFP in a broad medial band, whereas the rest contained fully formed Mid1p-GFP rings. In contrast, 34% of pdk1{Delta} cells undergoing anaphase exhibited Mid1p-GFP in a broad medial band (Figure 7B). Thus, Pdk1p is important for efficient organization of Mid1p rings at mitosis.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 7. Pdk1p has a role in the assembly of the Mid1p ring. Exponentially growing Mid1p-GFP and pdk1{Delta} Mid1p-GFP strains were fixed with formaldehyde and then processed for immunofluorescence and stained with DAPI (a), {alpha}-TAT-1 (b), and {alpha}-Cdc4p or {alpha}-GFP antibodies. (A) Representative stainings of cells in anaphase B are shown. Bar, 1 µm. (B) Quantification of cells in anaphase B exhibiting fully assembled tight rings or broad bands when stained with {alpha}-Cdc4p or {alpha}-GFP antibodies. For each strain, 200 cells were examined. (C) Pdk1p localization to the medial region is dependent on mid1 function. Pdk1p-GFP mid1{Delta} cdc25-22 cells were synchronously released into mitosis as described above. (Note that there is no detectable fluorescence in the cortical region; Pdk1p-GFP localizes only to SPBs in the absence of mid1). Bar, 5 µm.

 

Because pdk1{Delta} cells are defective in assembly of proper Mid1p rings and are dependent on Clp1p for maximal viability, we examined whether mid1{Delta} (Chang et al., 1996Go; Sohrmann et al., 1996Go) cells showed a deleterious effect in combination with clp1{Delta}. In mid1{Delta}, 20% of cells contained two or more nuclei. In contrast, 66% of the double mutant of mid1{Delta} clp1{Delta} cells accumulated two or more nuclei (Figure 6, A and B). Thus mid1{Delta} cells depend on Clp1p for maximal viability.

Given the interaction between Mid1p and Pdk1p, we addressed whether Pdk1p localization to the cell cortex depended on Mid1p function. To this end, we expressed Pdk1p-GFP in a mid1{Delta} cdc25-22 strain. Whereas mitotic cdc25-22 cells displayed prominent cortical Pdk1p localization, such localization was not detected in cells deleted for mid1 (Figure 7C). This observation indicated that Mid1p is essential for cortical localization of Pdk1p necessary to target Pdk1p to the future site of cell division.

Genetic Interactions with the Components of Septation Initiation Network
We have described the occurrence of pdk1{Delta} cells with multiple nuclei, a phenotype similar to that observed in SIN mutants. Moreover, components of this signaling cascade in S. pombe are known to localize to the SPB at discrete stages during the cell cycle (reviewed in Simanis, 2003Go). We therefore tested genetic interactions between SIN mutants and pdk1{Delta}. Given the possibility of deleterious interactions, tetrads were dissected on plates containing sorbitol. The mutants sid1-239, sid2-250, spg1-106, sid4-A1, cdc7-24, cdc11-123, cdc14-118, and cdc16-116 were crossed to pdk1{Delta}. Double mutants of the genotypes pdk1{Delta} sid2-250, pdk1{Delta} spg1-106, pdk1{Delta} sid4-A1 were unable to divide and form colonies at all temperatures in the absence of sorbitol but were capable of colony formation at 24°C when the growth medium was supplemented with sorbitol (Figure 8A). Microscopic examination of cells revealed that the lethality of all three double mutants was due to the accumulation of multiple nuclei in cells after failure of cytokinesis (Figure 8B).



View larger version (97K):
[in this window]
[in a new window]
 
Figure 8. pdk1{Delta} is synthetically lethal with several mutants of the septation initiation network: sid2-250, spg1-106, and sid4-A1. (A) Double mutants with indicated genotypes were grown on YES plates in the presence or absence of 1.2 M sorbitol at 24°C. (B) Cells with indicated genotypes were fixed with formaldehyde and stained with DAPI and anilin blue. Bar, 5 µm.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We have identified Pdk1p by screening a bank of S. pombe strains deleted for all predicted protein kinases to find novel proteins involved in mitosis and cytokinesis (Bimbó et al., 2005Go). Pdk1p is closely related to phosphoinositide dependent protein kinases identified in different eukaryotic organisms (Figure 1). PDK1 is one of the two key effectors of the insulin/insulin-like growth factor-1 signaling pathway (reviewed in Belham et al., 1999Go; Pearl and Barford, 2002Go; Mora et al., 2004Go). Studies in mammalian cells have shown that PDK1 phosphorylates and activates the AGC kinase members regulated by phosphoinositide 3-kinase (reviewed in Belham et al., 1999Go; Peterson and Schreiber, 1999Go). In Drosophila, dPDK1 functions as a central regulator of cellular and organism growth by controlling AGC kinases Akt and S6K (Rintelen et al., 2001Go).

The majority of phosphoinositide-dependent protein kinases isolated from higher eukaryotes have a pleckstrin homology domain enabling their binding to phospholipid membranes and association with substrates. Interestingly, the budding yeast homologues Pkh1p/Pkh2p lack the pleckstrin homology domain (Casamayor et al., 1999Go) and are regulated by sphingolipid long-chain bases instead (Sun et al., 2000Go; Friant et al., 2001Go; Zhang et al., 2004Go). According to our results obtained from the sequence analysis, S. pombe Pdk1p is most related to Pkh1p and does not contain detectable PH domains. There is an additional PDK1-like protein in fission yeast, termed Ksg1, and its function is required for meiosis and growth (Niederberger and Schweingruber, 1999Go; Matsuo et al., 2003Go; Tang and McLeod, 2004Go), whereas Pdk1p is important for aspects of mitosis and cytokinesis.

Presently, it is not clear how Pdk1p is regulated. It is possible that although Pdk1p lacks a PH domain, it might interact physically with other proteins possessing a PH domain. Although we have been unable to find physical interactions between an obvious candidate, the PH domain protein Mid1p, and Pdk1p, it remains formally possible that Mid1p and Pdk1p function together in a complex in vivo. It is interesting to note that mammalian PDK1 interacts with the PH domain protein PKB/AKT (reviewed in Mora et al., 2004Go). Phosphatidylinositol 3,4,5-trisphosphate [PtdIns(3,4,5)P3] has recently been observed in fission yeast cells lacking Ptn1p, a PTEN homolog (Mitra et al., 2004Go). It will be interesting to study whether Pdk1p is regulated by PtdIns(3,4,5)P3 and/or sphingolipids.

Pdk1p is not essential for cell viability, although mitotic and cytokinetic abnormalities were observed. These include a pronounced delay in metaphase due to the activation of the spindle assembly checkpoint, a delay in actomyosin ring assembly, and defects associated with assembly of anillin-related Mid1p into the actomyosin ring. Pdk1p seems to mediate these effects in combination with Plo1p, the fission yeast Polo-kinase orthologue.

What role does Pdk1p play in mitosis? Cultures of pdk1{Delta} contain a high proportion of cells with short metaphase spindles, suggesting that Pdk1p plays an important, although nonessential role in mitotic progression. As a consequence of the metaphase delay, cytokinesis and septation are delayed in pdk1{Delta} cells. This delay in metaphase is likely a result of the activation of the spindle assembly checkpoint, given our observation that the delay is abolished in the absence of Mph1p or Mad2p. Previous studies have implicated at least two events that are monitored at metaphase (reviewed in Zhou et al., 2002Go): kinetochore attachment to the plus ends of the kinetochore microtubules (monitored by function of Mph1p and Mad2p) (He et al., 1997Go; He et al., 1998Go; Howell et al., 2000Go; Ikui et al., 2002Go), and proper orientation of the bipolar metaphase spindle leading to the establishment of tension (monitored by function of Mph1p but not Mad2p) (Stern and Murray, 2001Go; Rajagopalan et al., 2004Go). Pdk1p might be important for kinetochore attachment, because pdk1{Delta} mad2{Delta} shows reduced metaphase delay and the absence of pdk1 results in an increased proportion of cells with Mad2p at the kinetochores.

An abnormal proliferation of astral microtubules was detected in pdk1{Delta} cells in early stages of mitosis. Because most of the astral microtubules are intranuclear at metaphase in pdk1{Delta} mutants (as shown in wild-type cells by Zimmerman et al., 2004Go), the proliferation of intranuclear astral microtubules observed in pdk1 mutant cells might result from defects in kinetochore attachment and the intranuclear asters might serve the "search-and-capture" function.

Pdk1p localizes to both SPBs and the medial cortical region from early mitosis until early anaphase B. Pdk1p is not detected at the SPBs in cells with fully elongated mitotic spindles and in cells with postanaphase array of microtubules. Pdk1p also was not observed in interphase cells. The localization of Pdk1p is strikingly similar to that of the fission yeast Polo-related Plo1p (Bähler et al., 1998Go; Mulvihill et al., 1999Go). However, although Plo1p localization depends on the SIN components (Morrell et al., 2004Go) localization of Pdk1p is independent of SIN function and Plo1p function (Bimbó, unpublished data). However, as in the case with Plo1p, Pdk1p requires Mid1p function to localize to the cell cortex. These similarities in the localization of Pdk1p and Plo1p led us to investigate relationships between these two protein kinases. We show that compromising Pdk1p function leads to the exacerbation of the phenotype of certain ts alleles of plo1. In particular, whereas plo1-1 and plo1-25 are able to form colonies at 24°C, the double mutants pdk1{Delta} plo1-1 and pdk1{Delta} plo1-25 display a synthetic lethal phenotype and are unable to form colonies at 24°C, the permissive temperature for all parental strains. All obvious aspects of Plo1p function seem to overlap with Pdk1p function. Thus, pdk1{Delta} plo1-1 and pdk1{Delta} plo1-25 exhibit defects in chromosome segregation, bipolar spindle assembly, actomyosin ring positioning, timely actomyosin ring assembly as well as division septum assembly. Therefore, Pdk1p plays a minor role in several processes that Plo1p participates in, and these minor roles are exposed when Plo1p function is partially compromised. We have been unable to presently find physical interactions between Plo1p and Pdk1p by coimmunoprecipitation and two-hybrid analyses (our unpublished data). It is therefore possible that Pdk1p and Plo1p do not physically interact but share substrates leading to the overlap of function. Alternatively, the interaction might be too weak to be detected in our immunoprecipitation assays.

We have shown that pdk1{Delta} cells exhibit a delay in actomyosin ring assembly that is not fully bypassed by deletion of mph1 or mad2, suggesting that the delay might in part be due to structural defects associated with the actomyosin ring. Previous studies have shown that structural defects in the actomyosin ring are monitored via a checkpoint mechanism that involves the protein phosphatase Clp1p/Flp1p and the SIN (Le Goff et al., 1999Go; Liu et al., 1999Go, 2000Go; Cueille et al., 2001Go; Trautmann et al., 2001Go; Mishra et al., 2004Go). We have shown that clp1{Delta} displays an additive deleterious effect in combination with pdk1{Delta}, consistent with the idea that pdk1{Delta} cells assemble structurally defective rings and that their maximal viability depends on Clp1p function. Delayed actomyosin ring assembly has been described from the analysis of mid1 mutants (Wu et al., 2003Go), suggesting that Pdk1p might modulate Mid1p function. Consistent with this, whereas Mid1p is detected in rings in wild-type cells in late anaphase, Mid1p was more diffuse in a high proportion of pdk1{Delta} cells. Interestingly, a similarly incomplete accumulation of Mid1p into actomyosin rings has been detected in plo1ts mutants (Paoletti and Chang, 2000Go). Thus, Pdk1p and Plo1p might phosphorylate Mid1p to regulate its structural properties leading to timely actomyosin ring assembly and incorporation of Mid1p into the actomyosin ring. The molecular mechanism of Pdk1p–Mid1p interaction is presently unclear, particularly because we have been unable to detect physical interactions between these two proteins (our unpublished data).

pdk1{Delta} mutants also exhibit synthetic lethal interactions with several mutants of the SIN, such as spg1-106, sid4-A1, and sid2-250. Despite the genetic interactions, Pdk1p localization is independent of SIN function and SIN components Cdc7p, Cdc11p, Cdc14p, Sid1p, Sid2p, Spg1p, and Sid4p localize in a Pdk1p-independent manner (Bimbó, unpublished data). Notwithstanding the lack of dependencies in localization, the occurrence of cells with SIN phenotype in pdk1{Delta} cultures suggests that Pdk1p might modulate SIN function positively. In particular, it is interesting to note that Sid2p is related to members of the AGC family of kinases (Sparks et al., 1999Go; Tamaskovic et al., 2003Go) which are known to be regulated by PDK1 family members (Belham et al., 1999Go). However, the finding that SIN proteins participate in correcting defects associated with the cell division apparatus (Le Goff et al., 1999Go; Liu et al., 1999Go; Mishra et al., 2004Go) might provide an alternate explanation to the observed synthetic lethality between pdk1{Delta} and SIN mutants.

In conclusion, we have reported the first characterized role of the PDK1 family of protein kinases in the regulation of events of mitosis and cytokinesis. The fission yeast PDK1-related protein Pdk1p seems to be important for assembly of a bipolar spindle, actomyosin ring positioning, and Mid1p incorporation into the actomyosin ring. We have shown that Pdk1p cooperates with Plo1p to regulate mitosis and cytokinesis. Future studies should identify substrates of these kinases that bring about the events of mitosis and cytokinesis. Given the high degree of conservation of members of the PDK1 family of kinases, these studies should be relevant to the understanding of related kinases in metazoans and plants.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Drs. Keith Gull, Iain Hagan, Dan McCollum, Jürg Bähler, Kathy Gould, Annabelle Decottignies, Paul Nurse, Srividya Rajagopalan for strains, antibodies, and reagents. Special thanks are due to all members of the TLL fungal biology groups and in particular Volker Wachtler, Jim Karagiannis, Suniti N. Naqvi, and Snezhana Oliferenko for discussion and/or helpful comments on the manuscript. This work was supported by research funds from the Temasek Life Sciences Laboratory.


    Footnotes
 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E04–09–0769) on April 27, 2005.

Address correspondence to: Mohan K. Balasubramanian (mohan{at}tll.org.sg).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Balasubramanian, M. K., McCollum, D., and Gould, K. L. ((1997). ). Cytokinesis in fission yeast Schizosaccharomyces pombe. Methods Enzymol. 283, , 494–506.[Medline]

Balasubramanian, M. K., McCollum, D., Chang, L., Wong, K. C., Naqvi, N. I., He, X., Sazer, S., and Gould, K. L. ((1998). ). Isolation and characterization of new fission yeast cytokinesis mutants. Genetics 149, , 1265–1275.[Abstract/Free Full Text]

Bardin, A. J., and Amon, A. ((2001). ). Men and sin: what's the difference? Nat. Rev. Mol. Cell. Biol. 2, , 815–826.[CrossRef][Medline]

Bähler, J., Steever, A. B., Wheatley, S., Wang, Y., Pringle, J. R., Gould, K. L., and McCollum, D. ((1998). ). Role of polo kinase and Mid1p in determining the site of cell division in fission yeast. J. Cell Biol. 143, , 1603–1616.[Abstract/Free Full Text]

Belham, C., Wu, S., and Avruch, J. ((1999). ). Intracellular signaling: PDK1–a kinase at the hub of things. Curr. Biol. 9, , R93–R96.[CrossRef][Medline]

Bimbó, A., Jia, Y., Poh, S. L., Karuturi, R.K.M., den Elzen, N., Peng, X., Zheng, L., O'Connell, M., Liu, E. T., Balasubramanian, M. K., and Liu, J. ((2005). ). Systematic deletion analysis of fission yeast protein kinases. Eukaryot. Cell 4, , 799–813.[Abstract/Free Full Text]

Casamayor, A., Torrance, P. D., Kobayashi, T., Thorner, J., and Alessi, D. R. ((1999). ). Functional counterparts of mammalian protein kinases PDK1 and SGK in budding yeast. Curr. Biol. 9, , 186–197.[CrossRef][Medline]

Chang, F., Woollard, A., and Nurse, P. ((1996). ). Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring. J. Cell Sci. 109, , 131–142.[Abstract]

Chang, L., and Gould, K. L. ((2000). ). Sid4p is required to localize components of the septation initiation pathway to the spindle pole body in fission yeast. Proc. Natl. Acad. Sci. USA 97, , 5249–5254.[Abstract/Free Full Text]

Cueille, N., Salimova, E., Esteban, V., Blanco, M., Moreno, S., Bueno, A., and Simanis, V. ((2001). ). Flp1, a fission yeast orthologue of the S. cerevisiae CDC14 gene, is not required for cyclin degradation or rum1p stabilisation at the end of mitosis. J. Cell Sci. 114, , 2649–2664.

deHart, A.K.A., Schnell, J. D., Allen, D. A., and Hicke, L. ((2002). ). The conserved PKH-YPK kinase cascade is required for endocytosis in yeast. J. Cell Biol. 156, , 241–248.[Abstract/Free Full Text]

Decottignies, A., Zarzov, P., and Nurse, P. ((2001). ). In vivo localisation of fission yeast cyclin-dependent kinase cdc2p and cyclin B cdc13p during mitosis and meiosis. J. Cell Sci. 114, , 2627–2640.

Feierbach, B., and Chang, F. ((2001). ). Cytokinesis and the contractile ring in fission yeast. Curr. Opin. Microbiol. 4, , 713–719.[CrossRef][Medline]

Friant, S., Lombardi, R., Schmelzle, T., Hall, M. N., and Riezman, H. ((2001). ). Sphingoid base signaling via Pkh kinases is required for endocytosis in yeast. EMBO J. 20, , 6783–6792.[CrossRef][Medline]

Gould, K. L., and Simanis, V. ((1997). ). The control of septum formation in fission yeast. Genes Dev. 11, , 2939–2951.[Free Full Text]

Hagan, I., and Yanagida, M. ((1995). ). The product of the spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J. Cell Biol. 129, , 1033–1047.[Abstract/Free Full Text]

Hagan, I., and Yanagida, M. ((1997). ). Evidence for cell cycle-specific, spindle pole body-mediated, nuclear positioning in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 110, , 1851–1866.[Abstract]

He, X., Jones, M. H., Winey, M., and Sazer, S. ((1998). ). Mph1, a member of Mps1-like family of dual specificity protein kinases, is required for the spindle checkpoint in S. pombe. J. Cell Sci. 111, , 1635–1647.[Abstract]

He, X., Patterson, T. E., and Sazer, S. ((1997). ). The Schizosaccharomyces pombe spindle checkpoint protein mad2p blocks anaphase and genetically interacts with the anaphase-promoting complex. Proc. Natl. Acad. Sci. USA 94, , 7965–7970.[Abstract/Free Full Text]

Hirano, T., Funahashi, S., Uemura, T., and Yanagida, M. ((1986). ). Isolation and characterization of Schizosaccharomyces pombe cut mutants that block nuclear division but not cytokinesis. EMBO J. 5, , 2973–2979.[Medline]

Howell, B. J., Hoffman, D. B., Fang, G., Murray, A. W., and Salmon, E. D. ((2000). ). Visualization of Mad2 dynamics at kinetochores, along spindle fibers, and at spindle poles in living cells. J. Cell Biol. 150, , 1233–1250.[Abstract/Free Full Text]

Ikui, A. E., Furuya, K., Yanagida, M., and Matsumoto, T. ((2002). ). Control of localization of a spindle checkpoint protein, Mad2, in fission yeast. J. Cell Sci. 115, , 1603–1610.[Abstract/Free Full Text]

Keeney, J. B., and Boeke, J. D. ((1994). ). Efficient targeted integration at leu1–32 and ura4–294 in Schizosaccharomyces pombe. Genetics 136, , 849–856.[Abstract]

Kumar, S., Tamura, K., Jakobsen, I. B., and Nei, M. ((2001). ). MEGA 2, molecular evolutionary genetics analysis software, Bioinformatics 17, , 1244–1245.[Abstract/Free Full Text]

Lawlor, M. A., Mora, A., Ashby, P. R., Williams, M. R., Murray-Tait, V., Malone, L., Prescott, A. R., Lucocq, J. M., and Alessi, D. R. ((2002). ). Essential role of PDK1 in regulating cell size and development in mice. EMBO J. 21, , 3728–3738.[CrossRef][Medline]

Liu, J., Wang, H., and Balasubramanian, M. K. ((2000). ). A checkpoint that monitors cytokinesis in Schizosaccharomyces pombe. J. Cell Sci. 113, , 1223–1230.[Abstract]

Liu, J., Wang, H., McCollum, D., and Balasubramanian, M. K. ((1999). ). Drc1p/Cps1p, a 1,3-beta-glucan synthase subunit, is essential for division septum assembly in Schizosaccharomyces pombe. Genetics 153, , 1193–1203.[Abstract/Free Full Text]

Le Goff, X., Woollard, A., and Simanis, V. ((1999). ). Analysis of the cps1 gene provides evidence for a septation checkpoint in Schizosaccharomyces pombe. Mol. Gen. Genet. 262, , 163–172.[CrossRef][Medline]

Matsuo, T., Kubo, Y., Watanabe, Y., and Yamamoto, M. ((2003). ). Schizosaccharomyces pombe AGC family kinase Gad8p forms a conserved signaling module with TOR and PDK1-like kinases. EMBO J. 22, , 3073–3083.[CrossRef][Medline]

McCollum, D., Balasubramanian, M. K., Pelcher, L. E., Hemmingsen, S. M., and Gould, K. L. ((1995). ). Schizosaccharomyces pombe cdc4+ gene encodes a novel EF-hand protein essential for cytokinesis. J. Cell Biol. 130, , 651–660.[Abstract/Free Full Text]

McCollum, D., and Gould, K. L. ((2001). ). Timing is everything: regulation of mitotic exit and cytokinesis by the MEN and SIN. Trends Cell Biol. 11, , 89–95.[CrossRef][Medline]

Mishra, M., Karagiannis, J., Trautmann, S., Wang, H., McCollum, D., and Balasubramanian, M. K. ((2004). ). The Clp1p/Flp1p phosphatase ensures completion of cytokinesis in response to minor perturbation of the cell division machinery in Schizosaccharomyces pombe. J. Cell Sci. 117, , 3897–3910.[Abstract/Free Full Text]

Mitra, P., Zhang, Y., Rameh, L. E., Ivshina, M. P., McCollum, D., Nunnari, J. J., Hendricks, G. M., Kerr, M. L., Field, S. J., Cantley, L. C., and Ross, A. H. ((2004). ). A novel phosphatidylinositol(3,4,5)P3 pathway in fission yeast. J. Cell Biol. 166, , 205–211.[Abstract/Free Full Text]

Mora, A., Komander, D., van Aalten, D. M., and Alessi, D. R. ((2004). ). PDK1, the master regulator of AGC kinase signal transduction. Semin. Cell Dev. Biol. 15, , 161–170.[CrossRef][Medline]

Moreno, S., Klar, A., and Nurse, P. ((1991). ). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, , 795–823.[Medline]

Morrell, J. L., Tomlin, G. C., Rajagopalan, S., Venkatram, S., Feoktistova, A. S., Tasto, J. J., Mehta, S., Jennings, J. L., Link, A., Balasubramanian, M. K., and Gould, K. L. ((2004). ). Sid4p-Cdc11p assembles the septation initiation network and its regulators at the S. pombe SPB. Curr. Biol. 14, , 579–584.[CrossRef][Medline]

Mulvihill, D. P., Petersen, J., Ohkura, H., Glover, D. M., and Hagan, I. M. ((1999). ). Plo1 kinase recruitment to the spindle pole body and its role in cell division in Schizosaccharomyces pombe. Mol. Biol. Cell 10, , 2771–2785.[Abstract/Free Full Text]

Niederberger, C., and Schweingruber, M. E. ((1999). ). A Schizosaccharomyces pombe gene, ksg1, that shows structural homology to the human phosphoinositide-dependent protein kinase PDK1, is essential for growth, mating and sporulation. Mol. Gen. Genet. 261, , 177–183.[CrossRef][Medline]

Nigg, E. A. ((1998). ). Polo-like kinases: positive regulators of cell division from start to finish. Curr. Opin. Cell Biol. 10, , 776–783.[CrossRef][Medline]

Nurse, P., Thuriaux, P., and Nasmyth, K. ((1976). ). Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146, , 167–167.[CrossRef][Medline]

Nurse, P. ((1990). ). Universal control mechanism regulating onset of M-phase. Nature 344, , 503–508.[CrossRef][Medline]

Ohkura, H., Hagan, I. M., and Glover, D. M. ((1995). ). The conserved Schizosaccharomyces pombe kinase plo1, required to form a bipolar spindle, the actin ring, and septum, can drive septum formation in G1 and G2 cells. Genes Dev. 9, , 1059–1073.[Abstract/Free Full Text]

Pearl, L. H., and Barford, D. ((2002). ). Regulation of protein kinases in insulin, growth factor and Wnt signaling. Curr. Opin. Struct. Biol. 12, , 761–767.[CrossRef][Medline]

Peterson, R. T., and Schreiber, S. L. ((1999). ). Keeping it all in the family. Curr. Biol. 9, , R521–R524.[CrossRef][Medline]

Paoletti, A., and Chang, F. ((2000). ). Analysis of mid1p, a protein required for placement of the cell division site, reveals a link between the nucleus and the cell surface in fission yeast. Mol. Biol. Cell 11, , 2757–2773.[Abstract/Free Full Text]

Rajagopalan, S., Bimbó, A., Balasubramanian, M. K., and Oliferenko, S. ((2004). ). A potential tension sensing mechanism that ensures timely anaphase onset upon metaphase spindle orientation. Curr. Biol. 14, , 69–74.[CrossRef][Medline]

Rajagopalan, S., Wachtler, V., and Balasubramanian, M. K. ((2003). ). Cytokinesis in fission yeast: a story of rings, rafts and walls. Trends Genet. 19, , 403–408.[CrossRef][Medline]

Rintelen, F., Stocker, H., Thomas, G., and Hafen, E. ((2001). ). PDK1 regulates growth through Akt and S6K in Drosophila. Proc. Natl. Acad. Sci. USA 98, , 15020–15025.[Abstract/Free Full Text]

Roelants, F. M., Torrance, P. D., Bezman, N., and Thorner, J. ((2002). ). Pkh1 and pkh2 differentially phosphorylate and activate ypk1 and ykr2 and define protein kinase modules required for maintenance of cell wall integrity. Mol. Biol. Cell 13, , 3005–3028.[Abstract/Free Full Text]

Roelants, F. M., Torrance, P. D., and Thorner, J. ((2004). ). Differential roles of PDK1- and PDK2-phosphorylation sites in the yeast AGC kinases Ypk1, Pkc1 and Sch9. Microbiology 150, , 3289–3304.[Abstract/Free Full Text]

Russell, P., Nurse, P. ((1986). ). cdc25+ functions as an inducer in the mitotic control of fission yeast. Cell 45, , 145–153.[CrossRef][Medline]

Sagolla, M. J., Uzawa, S., and Cande, W. Z. ((2003). ). Individual microtubule dynamics contribute to the function of mitotic and cytoplasmic arrays in fission yeast. J. Cell Sci. 15, , 4891–4903.

Simanis, V. ((2003). ). The mitotic exit and septation initiation networks. J. Cell Sci. 116, , 4261–4262.[Free Full Text]

Sohrmann, M., Fankhauser, C., Brodbeck, C., and Simanis, V. ((1996). ). The dmf1/mid1 gene is essential for correct positioning of the division septum in fission yeast. Genes Dev. 10, , 2707–2719.[Abstract/Free Full Text]

Sparks, C. A., Morphew, M., and McCollum, D. ((1999). ). Sid2p, a spindle pole body kinase that regulates the onset of cytokinesis. J. Cell Biol. 146, , 777–790.[Abstract/Free Full Text]

Stern, B. M., and Murray, A. W. ((2001). ). Lack of tension at kinetochores activates the spindle checkpoint in budding yeast. Curr. Biol. 11, , 1462–1467.[CrossRef][Medline]

Sun, Y., Taniguchi, R., Tanoue, D., Yamaji, T., Takematsu, H., Mori, K., Fujita, T., Kawasaki, T., and Kozutsumi, Y. ((2000). ). Sli2 (Ypk1), a homologue of mammalian protein kinase SGK, is a downstream kinase in the sphingolipid-mediated signaling pathway of yeast. Mol. Cell. Biol. 20, , 4411–4419.[Abstract/Free Full Text]

Tanaka, K., Petersen, J., MacIver, F., Mulvihill, D. P., Glover, D. M., and Hagan, I. M. ((2001). ). The role of Plo1 kinase in mitotic commitment and septation in Schizosaccharomyces pombe. EMBO J. 20, , 1259–1270.[CrossRef][Medline]

Tang, Y., and McLeod, M. ((2004). ). In vivo activation of protein kinase A in Schizosaccharomyces pombe requires threonine phosphorylation at its activation loop and is dependent on PDK1. Genetics 168, , 1843–1853.[Abstract/Free Full Text]

Tamaskovic, R., Bichsel, S. J., and Hemmings, B. A. ((2003). ). NDR family of AGC kinases–essential regulators of the cell cycle and morphogenesis. FEBS Lett. 546, , 73–80.[CrossRef][Medline]

Trautmann, S., Wolfe, B., Jorgensen, P., Tyers, M., Gould, K. L., and McCollum, D. ((2001). ). Fission yeast Clp1p phosphatase regulates G2/M transition and coordination of cytokinesis with cell cycle progression. Curr. Biol. 11, , 931–940.[CrossRef][Medline]

Yanagida, M. ((1998). ). Fission yeast cut mutations revisited: control of anaphase. Trends Cell Biol. 8, , 144–149.[CrossRef][Medline]

Vanhaesebroeck, B., and Alessi, D. R. ((2000). ). The PI3K-PDK1 connection: more than just a road to PKB. Biochem. J. 346, , 561–576.

Woods, A., Sherwin, T., Sasse, R., MacRae, T. H., Baines, A. J., and Gull, K. ((1989). ). Definition of individual components within the cytoskeleton of Trypanosoma brucei by a library of monoclonal antibodies. J. Cell Sci. 93, , 491–500.[Abstract/Free Full Text]

Wu, J. Q., Kuhn, J. R., Kovar, D. R., and Pollard, T. D. ((2003). ). Spatial and temporal pathway for assembly and constriction of the contractile ring in fission yeast cytokinesis. Dev. Cell. 5, , 723–734.[CrossRef][Medline]

Zhang, X., Lester, R. L., and Dickson, R. C. ((2004). ). Pil1p and Lsp1p negatively regulate the 3-phosphoinositide-dependent protein kinase-like kinase Pkh1p and downstream signaling pathways Pkc1p and Ypk1p. J. Biol. Chem. 279, , 22030–22038.[Abstract/Free Full Text]

Zimmerman, S., Daga, R. R., and Chang, F. ((2004). ). Intra-nuclear microtubules and a mitotic spindle orientation checkpoint. Nat. Cell Biol. 6, , 1245–1246.[CrossRef][Medline]

Zhou, J., Yao, J., and Joshi, H. C. ((2002). ). Attachment and tension in the spindle assembly checkpoint. J. Cell Sci. 115, , 3547–5355.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
DevelopmentHome page
M. Mori, M. Hara, K. Tachibana, and T. Kishimoto
p90Rsk is required for G1 phase arrest in unfertilized starfish eggs
Development, May 1, 2006; 133(9): 1823 - 1830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E04-09-0769v1
16/7/3162    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bimbó, A.
Right arrow Articles by Balasubramanian, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bimbó, A.
Right arrow Articles by Balasubramanian, M. K.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2005 by The American Society for Cell Biology. Terms of copyright protection, warranties, and disclaimers.