|
|
|
|
Vol. 16, Issue 7, 3176-3186, July 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Section of Molecular and Cellular Biology, Center for Genetics and Development, University of CaliforniaDavis, Davis, CA 95616
Submitted December 23, 2004;
Accepted April 27, 2005
Monitoring Editor: Yixian Zheng
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In mammalian cells, dynein activity is required for centrosome separation and chromosome alignment (Vaisberg et al., 1993
; Echeverri et al., 1996
) and is proposed to control spindle length by transporting the MT-deploymerizing kinesin-13 KLP10A to the spindle poles (Gaetz and Kapoor, 2004
; Lawrence et al., 2004
). In addition, a large body of evidence suggests that dyneindynactin forms a complex with the nuclear mitotic apparatus protein NuMA and transports it to spindle poles where it is enriched in a crescent-shaped area and serves to organize MTs into focused spindle poles and to attach centrosomes to spindles (Heald et al., 1996
, 1997
; Merdes et al., 1996
, 2000
; Gaglio et al., 1997
; Dionne et al., 1999
; Quintyne et al., 1999
). This activity is thought to cross-link centrosome-associated interpolar microtubules (ipMTs) to ipMTs whose minus ends are detached from centrosomes and lie within the body of the half-spindle (Mastronarde et al., 1993
), thereby maintaining spindle pole MTs as an organized continuum.
The inhibition of dynein function in Drosophila has yielded variable results. For example, we previously microinjected dynein monoclonal antibodies and p50-dynamitin into embryos to create a gradient of inhibited dynein function decreasing from the injection site, plausibly mimicking an allelic series of loss-of-function mutants (Sharp et al., 2000a
,b
). The most severe effect, observed proximal to the injection site, was a zone of spindles displaying failures in spindle pole separation, whereas further away from the injection site we observed defects in chromosome congression and segregation on apparently normal-looking bipolar spindles, and further away still we observed defects in late anaphase B spindle elongation. However, we did not observe any defects in spindle organization and centrosome attachment comparable with those caused by perturbation of the dyneindynactinNuMA pathway in vertebrates. Studies of the mitotic functions of dynein in Drosophila mutant embryos revealed defects in early centrosome separation in agreement with our data, but in contrast to our data significant detachment of centrosomes from nuclei and spindle poles was observed (Robinson et al., 1999
). Finally, a comprehensive proteomic analysis of multiple mitotic motor function in cultured Drosophila S2 cells yielded minor mitotic defects that were consistent with a delay in the metaphaseanaphase transition after dynein inhibition, but gross defects in chromosome movements and spindle integrity were not observed (Goshima and Vale, 2003
).
Here, we have examined the role of dynein in mitosis in cultured Drosophila S2 cells and show that loss of its function leads to defects in spindle pole organization and centrosome attachment comparable with those seen in vertebrate cells, but different from our results by using fly embryos. We show that the RNAi depletion of the abnormal spindle (Asp) protein, which in some respects resembles vertebrate NuMA (Saunders et al., 1997
; Carmo-Avides and Glover, 1999
; Wakefield et al., 2001
) or the spindle pole-associated kinesin-13 KLP10A (Rogers et al., 2004
; Goshima and Vale, 2003
), also lead to changes in spindle pole morphology. Moreover, the localization of these two proteins is partially disrupted by dynein depletion, suggesting they both require dynein activity for proper localization to spindle poles. Thus, we propose that in S2 cells, dyneindynactin, Asp, and KLP10A play complex, interdependent roles in spindle pole organization.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Double-stranded RNA (dsRNA) Preparation
Expression plasmids encoding the cDNA of the dynein IC (CG18000), p50-dynamitin (CG8269), and KLP10A (CG1453) were acquired from the Drosophila Genome Resource Center (Bloomington, IN), and Ncd-pET expression constructs were provided by Dr. L.S.B. Goldstein (Howard Hughes Medical Institute, University of CaliforniaSan Diego, San Diego, CA). Genomic coding sequences for dynein heavy chain and Asp were used as templates to PCR amplify corresponding 600- to 900-residue regions (individual primer sequences may be found in Table S1). Each primer used in the PCR contained a 5' T7 polymerase binding site (TAATACGACTCACTATAGGG). dsRNA was produced by in vitro transcription by using Megascript kits (Ambion, Austin, TX) according to the methods of Clemens et al., (2000
) with minor modifications. S2 cells were treated twice with 50 µg of dsRNA for 4 d (added at days 1 and 3) to deplete dynein heavy chain (DHC), dynein intermediate chain (DIC), p50, and Asp or with 30 µg of dsRNA for 4 d to deplete KLP10A and Ncd. In comparison, Goshima and Vale (2003
) used a single treatment of 15 µg of dsRNA for 7 d. The effect of dsRNA treatment on cell cultures was determined by immunoblotting, and its effect on individual cells was determined by immunofluorescence to be confident that the target protein was gone. Immunofluorescence microscopy of mitotic morphology was performed on aliquots of the same dsRNA treated as used for immunoblotting, and the reported phenotypes were consistent among at least 90% of mitotic cells in each case.
Antibodies and Western Blotting
A polyclonal Ncd antibody was prepared by immunizing rabbits with the glutathione S-transferase (GST)-Ncd tail (
200-amino acid) protein. Antibodies were purified on Affigel protein A columns (Bio-Rad, Hercules, CA), acid eluted, neutralized in Tris buffer, dialyzed into PB buffer (10 mM NaPO4, pH 7.4, 1 mM MgCl2, 1 mM EGTA, and 1 mM dithiothreitol), and concentrated. This antibody was highly specific on immunoblots (Figure S1). DHC was detected with a mouse monoclonal antibody as described previously (Sharp et al., 2000a
,b
). Asp was detected with a rabbit polyclonal anti-Asp antibody provided by D. M. Glover (Department of Genetics, University of Cambridge, Cambridge, United Kingdom). KLP10A was detected with a rabbit polyclonal anti-KLP10A antibody (Rogers et al., 2004
) provided by D. J. Sharp (Department of Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, NY). Other antibodies used were rabbit anti-phospho-histone H3 antibody (Upstate Biotechnology, Lake Placid, NY), mouse anti-DIC antibody 74.1 (Chemicon International, Temeculca, CA), mouse anti-p50 dynamitin antibody (BD Biosciences PharMingen, San Diego, CA), and mouse anti-
-tubulin and anti-tubulin DM1
(Sigma-Aldrich, St. Louis, MO). dsRNAi-treated or control lysates were prepared with 150 µl of cell lysis buffer (50 mM Tris, pH 7.8, 150 mM NaCl, 1% NP-40, and protease inhibitors). Samples were run on 7.510% SDS-PAGE gels. Protein concentrations were determined using the Bradford protein assay.
Immunofluorescence Microscopy
After dsRNA treatment, S2 cells were plated onto coverslips previously coated with 0.5 mg/ml concanavalin A for 2 h and fixed either with 0.5% glutaraldehyde (EM Scientific, Gibbstown, NJ), 3% formaldehyde (EM Scientific), and 1 mg/ml saponin in BRB80 buffer at room temperature for 10 min or with 90% methanol, 10% formaldehyde at 20°C for 10 min. Cells were permeabilized with phosphate-buffered saline (PBS) + 0.1% Triton X-100 (Rogers et al., 2002
). For blocking, coverslips were incubated at room temperature with PBS + 0.1% Triton X-100 + 0.3% bovine serum albumin (PBST) for 1 h. Blocked slides were incubated with diluted primary antibodies (anti-DHC, anti-DIC, anti-p50, anti-Asp, 1:50; anti-Ncd, anti-KLP10A, 1:1000; anti-H3, 10 µg/ml; anti-
-tubulin and DM1
, 1:200) at room temperature for 2 h and then washed three times for 10 min in PBST. Fluorescent secondary antibodies donkey anti-rabbit Cy5, donkey anti-mouse Cy5, donkey anti-mouse Cy3 (Jackson ImmunoResearch Laboratories, West Grove, PA) were used at a final dilution of 1:500. DNA was stained with propidium iodide (1 µg/ml in PBS) for 20 min. Slides were mounted in Vectashield mounting medium (Vector Laboratories, Burlingame, CA) and visualized on an Olympus microscope equipped with an UltraView spinning disk confocal head (PerkinElmer Life and Analytical Sciences, Boston, MA) and a 100x 1.35-numerical aperture objective.
|
| RESULTS |
|---|
|
|
|---|
-tubulin and radial arrays of astral MTs (Figure 1, A and B). As noted by others, S2 cell spindles display significant variability in their size, morphology, and number of microtubule organizing centers (Goshima and Vale, 2003
|
|
RNAi depletion of dyneindynactin subunits also was associated with apparent defects in chromosome alignment on spindles (Figure 3), but whether this is due to a direct mechanical or regulatory role for dynein in chromosome motility (Sharp et al., 2000b
; Basto et al., 2004
) or is instead due to an indirect effect of spindle pole disorganization cannot be determined in fixed cells. This is in contrast to our previous work on living Drosophila embryos, where we observed defects in chromosome congression and segregation on absolutely normal-looking bipolar spindles, at least at the level of light microscopy of spindles in living embryos (Sharp et al., 2000b
).
|
The defects observed in spindle organization in the dyneindynactin-depleted S2 cells was accompanied by a 1.5-fold increase in polepole distance relative to controls and an
2.7-fold elevation of the mitotic index, based on anti-phosphohistone-H3 staining (Table 1). This is consistent with previous results (Goshima and Vale, 2003
).
|
|
90% cells examined) characterized by ultralong astral and spindle MTs (Figure 5 and Table 1), although we observed monopolar spindles (
80%) when RNAi treatment was prolonged to 7 d, in agreement with a previous study (Rogers et al., 2004
In vertebrates, it has been proposed that the dyneindynactin-dependent transport of NuMA is required for the formation or maintenance of spindle poles (Merdes et al., 2000
; Zeng, 2000
). Although the Drosophila genome contains no true NuMA homolog, it does contain a protein with similar properties, the "abnormal spindle" or Asp protein (Saunders et al., 1997
). For example, Asp and NuMA share similar sizes (
200 kDa), high
helical content, similar sequence motifs (e.g., p34cdc-2 sites and calponin homology domains), MT-binding activity, and localization to spindle poles (Compton et al., 1992
; Yang et al., 1992
; Saunders et al., 1997
; Novatchkova and Eisenhaber, 2002
). Therefore, we investigated whether depletion of Asp by using RNAi also leads to mitotic defects in S2 cells, and again we observed a loss of spindle pole organization, longer spindles than controls, detached or loosely attached centrosomes, and elevated mitotic index as observed after dyneindynactin depletion (Figure 6 and Table 1). Based on visual inspection, we find that in Asp-depleted cells, the loss of focusing of spindle poles seems more severe, and the detachment of centrosomes seems less severe, than in dyneindynactin-depleted cells.
|
|
|
In dynein-depleted spindles, Asp and KLP10A show subtle but significant changes in their distributions in a manner suggesting that dynein activity may normally be required to bias the distribution of the two proteins toward the spindle pole. Immunofluorescence micrographs reveal that Asp and KLP10A both concentrate in the polar regions in a manner superficially resembling controls, but loss of dynein activity produces a partial mislocalization of both proteins (Figures 9 and 10). For example, in dynein-depleted cells, although Asp is relatively concentrated in the poles plausibly accounting for the partial pole-focusing observed in these spindles (Figure 2), there is a specific loss of Asp from the transition regions between the ends of the half-spindles and the centrosomes that is very obvious in the linescans (Figure 9). In dynein-depleted cells, KLP10A staining was high at the poles, as in controls, but moving along the polepole axis of the spindle there was an increase in fluorescence intensity at the central region of the spindle, indicating that KLP10A had redistributed throughout the spindle (Figure 10).
|
|
| DISCUSSION |
|---|
|
|
|---|
Our results lead us to conclude that dyneindynactin, Asp, and KLP10A cooperate in the organization of spindle poles, providing the required activities of focusing spindle poles and attaching centrosomes to the distal endings of spindles in spindles where the majority of MTs are not directly attached to the centrosomes (Figure S2; Mastronarde et al., 1993
). The functional interdependencies of these three spindle proteins, however, seem complex. The simplest interpretation of our data can be summarized as follows. 1) The primary function of the minus-end motor complex dyneindynactin is to cross-link centrosome-bound MTs to spindle MTs whose minus ends are detached from centrosomes and also to enhance the efficiency of targeting of KLP10A and Asp to the spindle poles (although not being absolutely essential for this). 2) Asp is a MT-binding protein that binds to the minus ends of spindle MTs and cross-links them into focused structures. 3) KLP10A binds to centrosomes and to the minus ends of MTs and depolymerizes MTs at the spindle poles. We propose that the efficiency of Asp and KLP10A localization to the spindle pole regions is enhanced by dynein, but they are capable of localizing there after dynein RNAi, possibly through the action of residual dynein through the action of a second motor with overlapping functions or possibly simply by diffusion and MT minus-end binding.
This explains the observed results of RNAi depletion as follows. 1) After dyneindynactin depletion, centrosomes are detached from spindles; KLP10A and Asp become diffusely localized on half-spindles, less concentrated on the poles, and severely depleted from the transition zone between the centrosome and half-spindles; the residual Asp can focus the spindle poles from which the centrosomes have detached; and residual or cytosolic KLP10A can depolymerize astral MTs to restrict their length, although not as efficiently as in wild types, so spindle length increases. 2) In the absence of KLP10A, astral and spindle MTs grow too long, but residual Asp can focus the poles and dyneindynactin can maintain the attachment of centrosomes to spindles. 3) In the absence of Asp, spindle poles become severely unfocused, but residual dynein can maintain the attachment of centrosomes to the disorganized poles, and residual KLP10A can partially regulate spindle length and cytosolic KLP10A can regulate astral MT length.
Our results with the MT depolymerase KLP10A are consistent with those obtained previously in S2 cells (Goshima and Vale, 2003
; Rogers et al., 2004
) and also lend support to Gaetz and Kapoor (2004
), who propose that dynein localizes the kinesin-13, KIF2A to spindle poles in vertebrates. The results are consistent with the idea that, in the absence of a NuMA homolog in the Drosophila genome, Asp substitutes functionally for NuMA in S2 cells. Concordant with this idea is the observation that Asp and NuMA display a number of similarities, including similar molecular masses (220 kDa for Asp; 240/190 kDa for NuMA), high
helical content with a propensity for coiled-coil formation, calponin-homology domains, p34cdc-2 phosphorylation sites, MT-binding activity, and roles in spindle organization (Compton et al., 1992
; Yang et al., 1992
; Parry, 1994
; Harborth et al., 1995
; Saunders et al., 1997
; Carmo-Avides and Glover, 1999
; Wakefield et al., 2001
; Haren and Merdes, 2002
). Moreover, NuMA and Asp display similar localizations, being concentrated on prophase centrosomes, forming a crescent-shaped structure at spindle poles and central spindles/midbodies. These molecular properties and localization data are all consistent with the idea that the association of both Asp and NuMA to spindle poles allows them to cross-link MTs, thereby focusing the poles (Merdes et al., 2000
, Wakefield et al., 2001
).
Recently, Maiato et al. (2004
) proposed that "kinetochore-formed kinetochore fibers" in S2 cells become organized at spindle poles by a dynein-dependent mechanism. Our observation that Asp is associated with focused poles lacking a centrosome in control cells (Figure 7E) suggests that dynein may enhance the efficiency of Asp localization to the poles, allowing it to organize such kinetochore MTs as well as other MTs that assemble by centrosome-independent pathways, thereby playing a critical role in the proposed "search-and-transport" mechanism (Maiato et al., 2004
; Wadsworth and Khodjakov, 2004
).
Our results with dynein depletion differ from the functional proteomic studies of Goshima and Vale (2003
). Such proteomic studies are extremely valuable in dissecting the spectrum of functional components that cooperate in a complex system such as the spindle, but the different results observed here underscore the possibility that such high-throughput studies can overlook key functions. Indeed, we suspect that the discrepancy between our results and those of Goshima and Vale (2003
) could be due to differences in factors such as the dsRNA concentration used in the RNAi procedure and its time of application (see Materials and Methods). Moreover, as noted by Maiato et al., (2004
), RNAi treatment of a population of cells does not affect all cells equally and the treated culture is best considered to be a mixture of cells, some of which are efficiently depleted of the target protein, thereby revealing a loss-of-function phenotype, whereas others retain significant levels of the target protein and thus would phenocopy a "weak hypomorphic" mutant. In our studies, we only scored cells that were efficiently depleted of the target protein by immunofluorescence, so our phenotypic analysis was limited to cells in which RNAi depletion seemed to have been very effective according to the criterion of loss of immunofluorescence staining. It is difficult to apply this criterion in large-scale RNAi studies where the possibility exists that the apparent absence of a phenotype might reflect inefficient depletion of the target protein in the particular cells being scored.
The results reported here differ from our own previous results obtained in dynein- or dynactin-inhibited Drosophila embryos where comparable disorganized spindle poles and detached centrosomes were never observed (Sharp et al., 2000a
,b
), although we could not rule out subtle effects that would only be seen using, e.g., high-resolution imaging and quantification of spindle pole organization. The present results are instead more concordant with the data obtained by Robinson et al., (1999
) who observed the detachment of centrosomes from spindles in dynein mutant embryos. The different results may reflect the different experimental methods used to disrupt dynein function, namely, antibody or p50-dynamitin microinjection (Sharp et al., 2000a
,b
) versus hypomorphic mutants (Robinson et al., 1999
) versus RNAi (this study), but unfortunately technical obstacles prohibit us from testing this directly. For example, our RNAi studies were performed on S2 cells that were depleted of target antigen based on immunofluorescence and were thus likely to reflect a severe loss-of-function phenotype, and it is unclear how we could use this same approach to mimic the hypomorphic alleles studied by Robinson et al., 1999
, in which unknown levels of residual mutant protein are presumed to be present. Moreover, our effort to apply RNAi depletion of various mitotic proteins to syncytial embryos has so far been unsuccessful. In addition, a sometimes unappreciated advantage of the large embryos studied by Sharp et al. (2000a
,b
) is that the injected inhibitors readily diffuse to form a concentration gradient and this in turn produces a corresponding gradient of individual spindle "phenotypes" of decreasing severity, and it would be extremely difficult to mimic these effects by microinjecting antibody and mutant protein inhibitors into small S2 cells. Therefore, we cannot exclude the possibility that differences in experimental techniques contribute to the differences observed.
An alternative possibility, however, is that dyneindynactin is used to different extents in different cell types. In many cells, including S2 cells, accurate mitosis occurs at a relatively stately pace, and overlapping centrosome-directed and centrosome-independent assembly mechanisms occur together and aspects of each can be readily observed. Drosophila embryonic spindles, on the other hand, are adapted for the much faster mitoses that occur as the mononucleate fertilized egg rapidly divides its nuclei to form the multinuclear syncytial embryo. In embryonic spindles, spindle assembly, chromatid segregation, and spindle elongation occur orders of magnitude faster than in most cell types and to accommodate this "streamlined" mitotic motility, dynein may display specialized functions. For example, it is plausible that, during anaphase A, embryonic dynein not only participates in the spindle assembly checkpoint but also in feeding kinetochore MTs into the kinetochore to facilitate pacman-related depolymerization, thereby enhancing chromatid-to-pole motility (Sharp et al., 2000b
; Basto et al., 2004
; Rogers et al., 2004
). Similarly, we suspect that rapid embryonic mitoses require that efficient centrosome-dependent assembly dominates and thus the influence of other, backup mechanism may only be observed when centrosomes become defective (Megraw et al., 2001
). Thus, by comparing the streamlined embryonic spindles to the more stately S2 cell spindles, we may identify fundamental aspects of mitosis that are common to both types of spindle as distinct from functional specializations that reflect adaptations to rapid embryonic mitotic motility.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Jonathan M. Scholey (jmscholey{at}ucdavis.edu).
| REFERENCES |
|---|
|
|
|---|
Carmo-Avides, M., and Glover, D. M. ((1999). ). Abnormal spindle protein, Asp, and the integrity of mitotic centrosomal microtubule organizing centers. Science 283, , 17331735.
Clemens, J. C., Worby, C. A., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B. A., and Dixon, J. E. ((2000). ). Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc. Natl. Acad. Sci. USA 97, , 64996503.
Compton, D. A., Szilak, I., and Cleveland, D. W. ((1992). ). Primary structure of NuMA, an intranuclear protein that defines a novel pathway for segregation of proteins at mitosis. J. Cell Biol. 116, , 13951408.
Cullen, C. F., and Ohkura, H. ((2001). ). Msps protein is localized to acentrosomal poles to ensure bipolarity of Drosophila meiotic spindles. Nat. Cell Biol. 3, , 637642.[CrossRef][Medline]
Dionne, M. A., Howard, L., and Compton, D. A. ((1999). ). NuMA is a component of an insoluble matrix at mitotic spindle poles. Cell Motil. Cytoskeleton 42, , 189203.[CrossRef][Medline]
Echeverri, C. J., Paschal, B. M., Vaughan, K. T., and Vallee, R .B. ((1996). ). Molecular characterization of the 50-kD subunit of dynactin reveals function for the complex in chromosome alignment and spindle organization during mitosis. J. Cell Biol. 132, , 617633.
Gaetz, J., and Kapoor, T. M. ((2004). ). Dynein/dynactin regulate metaphase spindle length by targeting depolymerizing activities to spindle poles. J. Cell Biol. 166, , 465471.
Gaglio, T., Dionne, M. A., and Compton, D. A. ((1997). ). Mitotic spindle poles are organized by structural and motor proteins in addition to centrosomes. J. Cell Biol. 138, , 10551066.
Goshima, G., and Vale, R. D. ((2003). ). The roles of microtubule-based motor proteins in mitosis: comprehensive RNAi analysis in the Drosophila S2 cell line. J. Cell Biol. 162, , 10031016.
Harborth, J., Weber, K., and Osborn, M. ((1995). ). Epitope mapping and direct visualization of the parallel, in-register arrangement of the double-stranded coiled-coil in the NuMA protein. EMBO J. 14, , 24472460.[Medline]
Haren, L., and Merdes, A. ((2002). ). Direct binding of NuMA to tubulin is mediated by a novel sequence motif in the tail domain that bundles and stabilizes microtubules. J. Cell Sci. 115, , 18151824.
Heald, R., Tournebize, R., Blank, T., Sandaltzopoulos, R., Becker, P., Hyman, A., and Karsenti, E. ((1996). ). Self-organization of microtubules into bipolar spindles around artificial chromosomes in Xenopus egg extracts. Nature 382, , 420425.[CrossRef][Medline]
Heald, R., Tournebize, R., Habermann, A., Karsenti, E., and Hyman, A. ((1997). ). Spindle assembly in Xenopus egg extracts: respective roles of centrosomes and microtubule self-organization J. Cell Biol. 138, , 615628.
Karsenti, E., and Vernos, I. ((2001). ). The mitotic spindle: a self-made machine. Science 294, , 543547.
Lawrence, C. J., et al. ((2004). ). A standardized kinesin nomenclature. J. Cell Biol. 167, , 1922.
Lee, M. J., Gergely, F., Geffers, K., Teak-Chew, S., and Raff, J. W. ((2001). ). Msps/XMAP215 interacts with the centrosomal protein D-TACC to regulate microtubule behavior. Nat. Cell Biol. 3, , 643649.[CrossRef][Medline]
Maiato, H., Rieder, C. L., and Khodjakov, A. ((2004). ). Kinetochore-driven formation of kinetochore fibers contributes to spindle assembly during animal mitosis. J. Cell Biol. 167, , 831840.
Mastronarde, D. N., McDonald, K. L., Ding, R., and McIntosh, J. R. ((1993). ). Interpolar spindle microtubules in PTK cells.J. Cell Biol. 123, , 14751489.
Megraw, T. L., Kao, L. R., and Kaufman, T. C. ((2001). ). Zygotic development without functional mitotic centrosomes. Curr. Biol. 11, , 116120.[CrossRef][Medline]
Merdes, A., Ramyar, K., Vechio, J. D., and Cleveland, D. W. ((1996). ). A complex of NuMA and cytoplasmic dynein is essential for mitotic spindle assembly. Cell 87, , 447458.[CrossRef][Medline]
Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., and Cleveland, D. W. ((2000). ). Formation of spindle poles by dynein/dynactin-dependent transport of NuMA. J. Cell Biol. 149, , 851861.
Novatchkova, M., and Eisenhaber, F. ((2002). ). A CH domain-containing N terminus in NuMA? Protein Sci. 11, , 22812284.
Parry, D. A. ((1994). ). NuMA/centrophilin: sequence analysis of the coiled-coil rod domain. Biophys. J. 67, , 12031206.
Quintyne, N. J., Gill, S. R., Eckley, D. M., Crego, C. L., Compton, D. A., and Schroer, T. A. ((1999). ). Dynactin is required for microtubule anchoring at centrosomes. J. Cell Biol. 147, , 321334.
Robinson, J. T., Wojcik, E. J., Sanders, M. A., McGrail, M., and Hays, T. S. ((1999). ). Cytoplasmic dyenin is required for the nuclear attachment and migration of centrosomes during mitosis in Drosophila. J. Cell Biol. 146, , 597608.
Rogers, S. L., Rogers, G. C., Sharp, D. J., and Vale, R. D. ((2002). ). Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J. Cell Biol. 158, , 873884.
Rogers, G. C., Rogers, S. L., Schwimmer, T. A., Ems-McClung, S. C., Walczack, C. E., Vale, R. D., Scholey, J. M., and Sharp, D. J. ((2004). ). Two mitotic kinesins cooperate to drive sister chromatid separation during anaphase. Nature 427, , 364370.[CrossRef][Medline]
Saunders, R.D.C., Avides, M. C., Howard, T., Gonzalez, C., and Glover, D. M. ((1997). ). The Drosophila gene abnormal spindle encodes a novel microtubule-associated protein that associates with the polar regions of the mitotic spindle. J. Cell Biol. 137, , 881890.
Scholey, J. M., Brust-Mascher, I., and Mogilner, A. ((2003). ). Cell division. Nature 422, , 746752.[CrossRef][Medline]
Sharp, D. J., Brown, H. M., Kwon, M., Rogers, G. C., Holland, G., and Scholey, J. M. ((2000a). ). Functional coordination of three mitotic motors in Drosophila embryos. Mol. Biol. Cell 11, , 241253.
Sharp, D. J., Rogers, G. C., and Scholey, J. M. ((2000b). ). Cytoplasmic dynein is required for poleward chromosome movement during mitosis in Drosophila embryos. Nat. Cell Biol. 2, , 922930.[CrossRef][Medline]
Vaisberg, E. A., Koonce, M. P., and McIntosh, J. R. ((1993). ). Cytoplasmic dynein plays a role in mammalian mitotic spindle formation. J. Cell Biol. 123, , 849858.
Wadsworth, P., and Khodjakov, A. ((2004). ). E pluribus unum: towards a universal mechanism for spindle assembly. Trends Cell Biol. 14, , 413419.[CrossRef][Medline]
Wakefield, J. G., Bonaccorsi, S., and Gatti, M. ((2001). ). The Drosophila protein Asp is involved in microtubule organization during spindle formation and cytokinesis. J. Cell Biol. 153, , 637647.
Yang, C. H., Lambie, E. J., and Snyder, M. ((1992). ). NuMA: an unusually long coiled-coil related protein in the mammalian nucleus. J. Cell Biol. 116, , 13031317.
Zeng, C. ((2000). ). NuMA: a nuclear protein involved in mitotic centrosome function. Microsc. Res. Technique 49, , 467477.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. A. Trammell, N. M. Mahoney, D. A. Agard, and R. D. Vale Mob4 plays a role in spindle focusing in Drosophila S2 cells J. Cell Sci., April 15, 2008; 121(8): 1284 - 1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Oladipo, A. Cowan, and V. Rodionov Microtubule Motor Ncd Induces Sliding of Microtubules In Vivo Mol. Biol. Cell, September 1, 2007; 18(9): 3601 - 3606. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Grishchuk, I. S. Spiridonov, and J. R. McIntosh Mitotic Chromosome Biorientation in Fission Yeast Is Enhanced by Dynein and a Minus-end-directed, Kinesin-like Protein Mol. Biol. Cell, June 1, 2007; 18(6): 2216 - 2225. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zhang, G. C. Rogers, D. W. Buster, and D. J. Sharp Three microtubule severing enzymes contribute to the "Pacman-flux" machinery that moves chromosomes J. Cell Biol., April 23, 2007; 177(2): 231 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Goshima, R. Wollman, S. S. Goodwin, N. Zhang, J. M. Scholey, R. D. Vale, and N. Stuurman Genes Required for Mitotic Spindle Assembly in Drosophila S2 Cells Science, April 20, 2007; 316(5823): 417 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kim, S.-C. Ling, G. C. Rogers, C. Kural, P. R. Selvin, S. L. Rogers, and V. I. Gelfand Microtubule binding by dynactin is required for microtubule organization but not cargo transport J. Cell Biol., February 26, 2007; 176(5): 641 - 651. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-G. Delcros, C. Prigent, and R. Giet Dynactin targets Pavarotti-KLP to the central spindle during anaphase and facilitates cytokinesis in Drosophila S2 cells J. Cell Sci., November 1, 2006; 119(21): 4431 - 4441. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhou, W. Zimmerman, X. Liu, and R. L. Erikson A mammalian NudC-like protein essential for dynein stability and cell viability PNAS, June 13, 2006; 103(24): 9039 - 9044. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Goshima, F. Nedelec, and R. D. Vale Mechanisms for focusing mitotic spindle poles by minus end-directed motor proteins J. Cell Biol., October 24, 2005; 171(2): 229 - 240. [Abstract] [Full Text] [PDF] |
||||
| |||||||