![]() |
|
|
Vol. 16, Issue 7, 3411-3424, July 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





* Center for Biochemistry, Medical Faculty, University of Cologne, 50931 Cologne, Germany;
Center for Molecular Medicine Cologne, Medical Faculty, University of Cologne, 50931 Cologne, Germany;
Institute of Human Genetics, Ernst-Moritz-Arndt-University, 17487 Greifswald, Germany;
School of Biological and Biomedical Sciences, University of Durham, Durham, DH1 3LE United Kingdom; and
|| M. E. Mueller Institute, Biozentrum, University of Basel, CH-4056 Basel, Switzerland
Submitted November 17, 2004;
Revised April 1, 2005;
Accepted April 12, 2005
Monitoring Editor: Orna Cohen-Fix
| ABSTRACT |
|---|
|
|
|---|
-actinin type actin-binding proteins residing at the nuclear membrane. Using biochemical techniques, we demonstrate that Nesprin-2 binds directly to emerin and the C-terminal common region of lamin A/C. Selective disruption of the lamin A/C network in COS7 cells, using a dominant negative lamin B mutant, resulted in the redistribution of Nesprin-2. Furthermore, using lamin A/C knockout fibroblasts we show that lamin A/C is necessary for the nuclear envelope localization of Nesprin-2. In normal skin where lamin A/C is differentially expressed, strong Nesprin-2 expression was found in all epidermal layers, including the basal layer where only lamin C is present. This indicates that lamin C is sufficient for proper Nesprin-2 localization at the nuclear envelope. Expression of dominant negative Nesprin-2 constructs and knockdown studies in COS7 cells revealed that the presence of Nesprin-2 at the nuclear envelope is necessary for the proper localization of emerin. Our data imply a scaffolding function of Nesprin-2 at the nuclear membrane and suggest a potential involvement of this multi-isomeric protein in human disease. | INTRODUCTION |
|---|
|
|
|---|
Until recently only microtubules and associated proteins were implicated in nuclear migratory events (Morris, 2003
). Genetic evidence, however, from Caenorhabditis elegans suggests that nuclear migration and nuclear anchorage also involves the actin cytoskeleton because mutations in ANC-1 affect the positioning of nuclei and mitochondria in C. elegans (Starr and Han, 2002
). ANC-1 is a giant actin-binding dystrophin-like protein localizing to the nuclear envelope in an UNC-84 and lamin-dependent manner (Malone et al., 1999
; Lee et al., 2002
). Together with the recently discovered mammalian proteins Nesprin-1/Enaptin and Nesprin-2/NUANCE, ANC-1 of C. elegans, MSP-300 of Drosophila melanogaster, and interaptin from Dictyostelium discoideum are indeed the first examples of actin-binding proteins that reside at the nuclear membrane (Rivero et al., 1998
; Zhang et al., 2001
, 2002
; Mislow et al., 2002a
; Starr and Han, 2002
; Zhen et al., 2002
; Padmakumar et al., 2004
). The hallmark of the family is a single C-terminal transmembrane domain, which is separated from the N-terminal
-actinintype actin-binding domain (ABD) by a large central coiled coil. Their C-terminus is highly conserved in evolution and responsible for nuclear envelope targeting (Zhang et al., 2001
; Zhen et al., 2002
).
Nesprin-1 and -2 are the vertebrate orthologues of ANC-1 and are encoded by two separate genes. Both genes are complex and code for several splice variants that differ in length, domain composition, and their expression pattern (Zhang et al., 2001
, 2002
; Padmakumar et al., 2004
). This diversity in architecture and function is illustrated in the names that were used to describe the various products of those two genes. The small C-terminal variants of Nesprin-1 are also known as syne-1 and myne-1 (Apel et al., 2000
; Zhang et al., 2001
; Mislow et al., 2002a
), the ones of Nesprin-2 as syne-2 (Zhang et al., 2002
). The giant ABD-containing isoforms of the Nesprin-1 and -2 gene loci have been termed as Enaptin and NUANCE, respectively (Zhen et al., 2002
; Padmakumar et al., 2004
). For nesprin-1
, a direct binding to emerin and lamin A in vitro had been reported previously (Mislow et al., 2002a
, 2002b
).
Because Nesprin-2 is highly homologous to Nesprin-1, we investigated whether it also associates with inner nuclear envelope components. In this report we provide evidence that Nesprin-2 binds both in vitro and in vivo to lamin A/C and emerin. We also provide data demonstrating that the localization and function of Nesprin proteins at the nuclear envelope depends on the lamin A/C network, suggesting that lamin mutations may affect the function of Nesprin-1 and -2 at the nuclear membrane. In addition, we provide evidence that Nesprin-2 localizes to both sites of the NE and is crucial for the nuclear envelope localization of emerin, thus implicatingeither directly or indirectlythe Nesprin genes in human disorders.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Two-hybrid Assay
The methods for performing the yeast two-hybrid assay have been described in detail elsewhere (MATCHMAKER Two-Hybrid System 2 Catalogue no. K16041; Clontech).
Purification of GST Fusion Proteins and In Vitro Binding Assays
The purification of GST fusion proteins and GST pulldown experiments were performed as described (Dreuillet et al., 2002
). For the pulldown assay using COS7 cells, lysis was performed using 50 mM Tris/HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, and protease inhibitors (Roche, Mannheim, Germany). The 100,000 x g supernatant of the lysate was incubated with equal amounts of GST-K1 and GST-SR fusion proteins. The solutions were incubated at 4°C overnight with GST-Sepharose beads on a roller. Samples were centrifuged and the pellets (washed three times with phosphate-buffered saline [PBS]) were analyzed by SDS-PAGE and Western blot analysis.
Blot-overlay Assay
Purified GST and Escherichia coli cell lysates expressing GST-lamin A were analyzed by SDS-PAGE and transferred to a membrane. After 1 h of blocking (5% milk powder in NCP buffer: 10 mM Tris/HCl, pH 8.0, 150 mM NaCl, 0.05% Tween20) the blot was incubated overnight at 4°C with the purified GST-SR recombinant fusion protein. After an extensive washing step with NCP buffer, the blot was incubated with the Nesprin-2specific monoclonal antibody (mAb) K49260 (described in this work) for 1 h at room temperature. The blot was washed with NCP buffer and incubated with anti-mouse IgG conjugated to peroxidase for 1 h at room temperature. After washing three times with NCP buffer, the blot was subjected to ECL detection.
siRNA Knockdown of Lamin A/C and Nesprin-2
The lamin A/C knockdown was performed as described (Harborth et al., 2001
). A431 cells were grown at 37°C in DMEM supplemented with 10% fetal calf serum (FCS), penicillin, and streptomycin. One day before transfection, cells were trypsinized and transferred into six-well plates. The next day the cells were washed with Opti-MEM (Life Technologies, Karlsruhe, Germany), cultured for 30 min in Opti-MEM, and transiently transfected using oligofectamine (Invitrogen) and 12 µl of a 20 µM solution of siRNA duplexes for lamin A/C per well. The specific RNA-Dimer (Harborth et al., 2001
; Dharmacon, Boulder, CO) targets the sequence of human lamin A/C from base 608626. After 4 h of transfection Opti-MEM was removed and replaced with DMEM containing 10% FCS medium. After 3 d the cells were fixed and indirect immunofluorescence was performed or analyzed by SDS-PAGE and Western blot analysis. For the knockdown experiments of Nesprin-2, the oligonucleotides 5'-GATCCCCTTTGGACAATTATCCTGCATTCAAGAGATGCAGGATAATTGTCCAAATTTTTGGAAA and 5'-AGCTTTTCCAAAAATTTGGACAATTATCCTGCATCTCTTGAATGCAGGATAATTGTCCAAAGGG-3' were annealed and phosphorylated in vitro and cloned into the BglII/HindIII site of the pSUPER plasmid (OligoEngine, Seattle, WA). The oligonucleotide-dimer targets the bases 595613 of the Nesprin-2/NUANCE ABD (accession number AF435011
[GenBank]
) and allows the silencing in human and mouse as well as COS7 (African green monkey) cells. The plasmid was transfected into COS7 cells by standard transfection methods.
Immunoprecipitation of Nesprin-2 and Emerin
Subconfluent HaCaT cells were harvested and lysed in immunoprecipitation buffer (50 mM Tris/HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, and protease inhibitors). The cell lysates were centrifuged at 12,000 x g for 10 min at 4°C, and the supernatants were precleared overnight with Protein A Sepharose. Lysates were centrifuged at 12,000 x g for 10 min, and the supernatants were mixed with the indicated antibodies (100 µl hybridoma tissue culture medium) and incubated for 2 h at 4°C. Protein A Sepharose was added to the lysates and the samples were incubated at 4°C on a rocking platform. The immunocomplexes were washed three times and subjected to SDS-PAGE and immunoblotting with the indicated antibodies.
Antibodies and Immunofluorescence Microscopy
The GST-K1 fusion protein was used for generating a mouse mAb (mAb K49260) and a rabbit polyclonal antibody (pAb K1; Pineda, Berlin, Germany). All polyclonal Nesprin-2 and Nesprin-1/Enaptin antibodies used were purified by affinity chromatography.
Immunofluorescence studies were performed as described (Zhen et al., 2002
). The following antibodies were used: mouse anti-Nesprin-2 mAb K20-478 (undiluted, Zhen et al., 2002
), mouse anti-Nesprin-2 mAb K49260 (undiluted), affinity-purified rabbit anti-Nesprin-2 pAb K1 (1:50), affinity-purified rabbit anti-Nesprin-1/Enaptin (1:50), mouse anti-lamin A/C (1:50, JoL2, Chemicon, Temecula, CA), rabbit anti-lamin A (1:30, Cell Signaling Technology, Beverly, MA), mouse anti-lamin A (1:40, JoL4), mouse anti-lamin B (1:40, LN42, kind gift from Frans Ramaekers and Jos Broers), mouse anti-emerin (1:50, Novacastra Laboratories, Newcastle upon Tyne, United Kingdom), mouse anti-LAP2
(1:100, BD Biosciences), goat polyclonal anti-GST antibody (Amersham Biosciences), mouse anti-GFP antibody mAb K3-184-2 (undiluted, Noegel et al., 2004
) and anti-
-tubulin (1:100, WA3, gift from Dr. Euteneuer), and rat a6
4 integrin antibody (1:50, gift of Dr. Niessen). Secondary antibodies for indirect immunofluorescence analysis were conjugated with Cy3 (Sigma, St. Louis, MO), FITC (Sigma), Alexa488 (Molecular Probes, Eugene, OR) and Cy5 (Chemicon). F-actin was detected with FITC-labeled phalloidin (Sigma), and nuclear staining was visualized with the DNA-specific dye DAPI (Sigma). Specimens were analyzed by wide-field fluorescence microscopy (DMR, Leica, Heidelberg, Germany) or confocal laser scanning microscopy (TCS-SP, Leica).
Immunogold Labeling
Cells were fixed in PBS, pH 7.4, containing 3% paraformaldehyde and 0.5% glutaraldehyde for 1 h, washed twice in PBS, and postfixed in 0.5% osmium tetroxide for 30 min. Next samples were dehydrated and embedded in LR White resin following the instructions of the manufacturer (Polyscience, Warrington, PA). Thin sections (50100 nm) were mounted on Parlodion-coated Cu-grids and incubated two times for 5 min in PBS containing 2% bovine serum albumin to block unspecific binding. Next the sections were incubated with primary anti-Nesprin-2 antibodies (pAbK1 diluted 1:100 in blocking buffer, mAb K20-478 diluted 1:50 and mAb K49260 undiluted) for 2 h (pAbK1 and mAb K20-478) and 6 h (K49260), respectively. After washing with PBS, the sections were incubated with secondary goat anti-rabbit antibody conjugated to 10 nm colloidal gold (BBInternational, Cardiff, United Kingdom) and secondary goat anti-mouse antibody conjugated to 10 nm colloidal gold (BBInternational), respectively, for 1 h. After rinsing with PBS and distilled H2O, samples were stained with 6% uranyl acetate for 1 h and lead acetate for 2 min and viewed in a LEO 910 transmission electron microscope (Zeiss, Oberkochen, Germany).
|
|
| RESULTS |
|---|
|
|
|---|
800 kDa (Nesprin-2 Giant), in COS7 and HaCaT cell lysates (Figure 1, E and F). The C-terminalspecific antibodies detected consistently additional bands migrating at
400 and 76 kDa in HaCaT lysates (Figure 1F, asterisks). The presence of the smaller N-terminally truncated Nesprin-2 isoforms in HaCaT cells was further strengthened by performing immunoprecipitation studies (see Figure 8D). The additional bands (>400 kDa) observed in COS7 cells were not always detectable; therefore, they may represent degradation products of NUANCE or cross-reactive proteins.
|
|
The C-terminus of Nesprin-2 Interacts In Vivo and in GST Pulldown Experiments with Lamin A/C
A previous study by Mislow et al. (2002b
) reported that the last three C-terminal spectrin repeats of nesprin-1
bind directly to lamin A in vitro. Because this domain shares 46% sequence identity and 59% homology with the C-terminus of Nesprin-2 Giant/NUANCE, we examined whether Nesprin-2 also binds to lamins, using the yeast two-hybrid system. Yeast cells which were cotransformed with plasmids expressing the GAL4 DNA-binding domain fused to a C-terminal fragment of Nesprin-2 composed of the last four spectrin repeats (aa 61466799), and the GAL4 activation domain fused to lamin A grew on selection media and induced the
-galactosidase (Figure 3A). The yeast two-hybrid plasmids did not autoactivate the LacZ reporter genes themselves upon transformation into the Y190 yeast strain, demonstrating that Nesprin-2's C-terminus interacts in vivo specifically with lamin A. To verify the observations made in yeast, GST pulldown experiments were conducted using two GST-Nesprin-2 fusion proteins: GST-K1 (spectrin repeats 21 and 22) and GST-SR (spectrin repeats 1922; Figure 3B). Equal amounts of recombinant proteins were immobilized on glutathione-agarose beads (Figure 3C, top panel) and incubated with COS7 total cell lysates. Using immunoblot analysis, lamin A/C was found to interact specifically with GST-SR but not with GST-K1 alone (Figure 3C, bottom panel).
Nesprin-2 Interacts Directly with the Common C-terminal Region of lamins A and C In Vitro
To investigate the Nesprin-2-lamin A/C-interaction in more detail we performed additional in vitro studies. Direct binding of Nesprin-2 to lamin A/C was analyzed in a blot overlay assay. Lamin A was fused to GST and its expression in E. coli was verified by Western blot analysis using the anti-lamin A/C antibody JoL2 (Figure 4A, right panel). Because most of the lamin A fusion protein was insoluble, we performed our experiments using the crude bacterial lysates. GST, uninduced E. coli cell lysate, and bacterial lysate containing GST-lamin A (Figure 4A, left panel) were blotted onto a nitrocellulose membrane and incubated with recombinant GST-SR protein. Immunodetection with mAb K49260 gave a signal corresponding to the size of the GST-lamin fusion protein, suggesting that the C-terminal region of Nesprin-2 binds directly to lamin A (Figure 4B).
|
10, and the testis-specific lamin C2, which are generated through alternative splicing. Lamins A and C differ in that lamin A possesses an additional 90 aa at its C-terminus (Figure 4C; Hutchison, 2002
The Localization of Nesprin-2 at the Nuclear Envelope Depends on the Lamin A/C Network
To pursue the interaction of Nesprin-2 and lamin A/C in vivo, we transiently expressed the mutant Xenopus lamin B1
2 in COS7 cells. This mutant protein has been previously shown to redistribute specifically A-type lamins from the lamina to nucleoplasmic granules in mammalian cells (Ellis et al., 1997
; Vaughan et al., 2001
; Figure 5, AD). In transfected cells Nesprin-2 was located primarily in the lamin Apositive nucleoplasmic aggregates rather than at the nuclear envelope (Figure 5, EH). A similar pattern was also evident for Nesprin-1, which no longer localized at the nuclear membrane in transfected cells (Figure 5, IL). In agreement with what has been reported earlier (Vaughan et al., 2001
), the distribution of other nuclear envelope components such as lamin B and LAP2
remained unaffected and were retained exclusively at the nuclear envelope (Figure 5, MP and QT, respectively). The mechanism, however, by which membrane-anchored proteins such as Nesprin-1/Nesprin-2 are being translocated to those intranuclear aggregates is unclear. To further investigate the relationship between Nesprins and lamin A/C, we investigated the localization of the Nesprin proteins in lamin A/C knockout fibroblasts (Figure 6; Sullivan et al., 1999
). Lamin A/C knockout fibroblasts harbor dramatic nuclear morphology changes and defects in nuclear structure (Sullivan et al., 1999
; Nikolova et al., 2004
) as well as mislocalization of various components of the nuclear envelope such as emerin. In wild-type fibroblasts the Nesprin-2 staining was confined to the nuclear envelope (Figure 6A), knockout cells, however, showed an aberrant cytoplasmic localization (Figure 6C). Similar data were obtained also for Nesprin-1, which no longer localized to the nuclear envelope in the lamin A/C knockout cells (Figure 6G). Emerin was used in our studies as a control, because its localization is known to be altered in lamin A/Cdeficient fibroblasts (Sullivan et al., 1999
; Figure 6, F and H). Furthermore, the knockdown of lamin A/C using RNAi primers in A431 keratinocytes resulted in the mislocalization of the endogenous emerin and Nesprin-2 proteins to the cytoplasm (unpublished data). In summary, our findings demonstrate that both Nesprin-2 as well as Nesprin-1 depend on the lamin A/C network for proper nuclear envelope localization.
|
|
|
Expression of a C-terminal Nesprin-2 Segment Composed of the Transmembrane Domain and the Highly Conserved Perinuclear Region Displaces Emerin from the Nuclear Envelope of COS7 Cells
In a previous study we have shown that the C-terminus of Nesprin-2 Giant/NUANCE (dnNesprin-2) is sufficient for nuclear envelope localization (Zhen et al., 2002
). This construct possesses spectrin repeats 21 and 22, the transmembrane domain and the highly conserved perinuclear segment of Nesprin-2 Giant. To test the significance of the two spectrin repeats in nuclear targeting, we made a shorter GFP-fusion protein, tmNesprin-2, that lacks the two spectrin repeats and harbors only the transmembrane domain and the C-terminal tail. Both fusion proteins (dnNesprin-2, tmNesprin-2; Figure 1D) localized in a similar fashion to the nuclear envelope (Figure 8A, ad and mp, respectively) and accumulated upon overexpression also in the ER (Figure 8A, f and j). Thus, the association with the nuclear membrane is not mediated by the spectrin repeats. Moreover, upon overexpression in COS7 cells both fusion proteins displaced the endogenous Nesprin-2 proteins from the nuclear membrane (Figure 8A, c and o).
To address whether the absence of endogenous Nesprin-2 protein from the nuclear envelope will affect other components of the inner nuclear membrane, we performed indirect immunofluorescence stainings of transfected cells using antibodies against lamin A/C and emerin. Although the appearance and the overall pattern of lamin A/C at the nuclear membrane was not affected by the overexpression of either dnNesprin-2 (Figure 8A, eh) or tmNesprin-2 (unpublished data) GFP fusion proteins, we found drastic changes in the emerin pattern in tmNesprin-2transfected cells. In sharp contrast to the dnNesprin-2 protein (Figure 8A, il), only the tmNesprin-2 construct (Figure 8A, qt) was able to mislocalize emerin from the nuclear membrane. Emerin displayed strong nuclear staining in untransfected COS7 cells; however, the protein no longer localized to the nuclear membrane and accumulated in cytoplasmic granules in 60% of COS7 cells that express tmNesprin-2. Around 5% of transfected cells did not display any alterations of emerin, and another 35% displayed a partial mislocalization of emerin to the cytoplasm. The numbers provided where obtained by counting 200 transiently transfected cells.
Nesprin-2 Interacts Directly with Emerin In Vitro and in HaCaT Cells
To examine whether Nesprin-2 and emerin are interacting with each other, we conducted GST pulldown experiments. Equal amounts of recombinant proteins were immobilized on glutathione-agarose beads (Figure 8B, top panel) and incubated with COS7 total cell lysates. Using immunoblot analysis, emerin was found to interact specifically with GST-K1 (Figure 8B, lower panel). To further investigate whether Nesprin-2 associates directly with emerin, we performed GST pulldown experiments using recombinant emerin protein. Our results show that in contrast to GST, GST-K1 specifically interacted with emerin (Figure 8C). Nesprin-2's interaction with emerin was further examined in vivo by immunoprecipitation using the mAb K49260 antibody. This antibody was able to coimmunoprecipitate specifically the various Nesprin-2 isoforms and emerin from HaCaT cell lysates (Figure 8D). In addition, the immunoblot analysis using the pAbK1 Nesprin-2 antibody on the CoIP samples further underlined the specificity of the C-terminal Nesprin-2 antibodies.
Ablation of Nesprin-2 Expression in COS7 Cells Using the siRNA Technology Affects the Nuclear Envelope Localization of Emerin
Our immunofluorescence studies using dominant negative Nesprin-2 constructs revealed an unexpected relationship between Nesprin-2 and emerin. The mechanism, however, by which those dominant negative Nesprin-2 proteins act has not been studied so far in detail. In addition, the Nesprin-2 interactions in the perinuclear space have not been elucidated at the biochemical level. Therefore it cannot be excluded that the effects on emerin may have been indirect.
To unequivocally demonstrate that the emerin mislocalization was caused due to the absence of Nesprin-2, we performed siRNA Nesprin-2 knockdown experiments in COS7 cells. For this purpose, we designed RNA duplexes against the N-terminus of Nesprin-2 Giant/NUANCE (see Materials and Methods). We chose for our studies COS7 cells because they express only the large ABD-containing isoforms and lack the small C-terminal isoforms (see Figure 1, E and F) in order to accomplish the complete knockdown of Nesprin-2. COS7 cells were transiently transfected with the pSUPER plasmid and after 3 d of culturing the cells were subjected to Western blot (Figure 9A) and immunofluorescence analysis (Figure 9, BJ). Lysates of transiently transfected COS7 cells contained only minor amounts of Nesprin-2, illustrating the efficacy of Nesprin-2 silencing. In sharp contrast, however, lamin A/C, emerin and tubulin levels were comparable to wild-type (Figure 9A, lower panels). Confocal microscope analysis of the transfected COS7 cells revealed that the RNA interference of the N-terminal Nesprin-2 sequences results in the complete absence of the Nesprin-2 staining pattern with both N- as well as C-terminal directed Nesprin-2 antibodies (Figure 9, B and C, asterisks). In many transfected COS7 cells the Nesprin-2 staining was absent from the nuclear membrane and what little staining that remained was cytoplasmic (Figure 9, B, E, and H, asterisks). Cells, where Nesprin-2 was absent from the nuclear membrane no longer harbored emerin at the nuclear envelope. Emerin was found primarily in aggregates that were dispersed throughout the cytoplasm (Figure 9I, arrowheads).
|
To evaluate the knockdown of Nesprin-2 in COS7 cells, we performed measurements of the fluorescence intensity (Nesprin-2)/nucleus size (ImageJ, NIH Image) in cells with an abnormal emerin distribution and compare it with cells exhibiting proper emerin localization. We found that the Nesprin-2 fluorescence intensity is reduced by 40% in cells with an abnormal emerin distribution. A paired t test showed that the reduction of fluorescence intensity/nucleus size (n = 30, p < 0001) is significant. By contrast, lamin A/C remained in the nuclear lamina (Figure 9F, arrow).
To investigate whether Nesprin-2 distribution was dependent on emerin, immunofluorescence studies were performed on dermal fibroblasts null for emerin (Figure 10, A and EG) from patients suffering from X-EDMD caused by the STA g631 del TCTAC mutation (Hoeltzenbein et al., 1999
). As shown in Figure 10A (top panel), Nesprin-2 is expressed in both wild-type and mutant human dermal fibroblasts and represented predominantly by its large 800-kDa isoform. Nesprin-2 displayed a strong nuclear envelope staining pattern in wild-type fibroblast cells (Figure 10D, arrowheads). Although some mutant fibroblasts did exhibit increased cytoplasmic staining for Nesprin-2, the majority of the protein remained at the nuclear envelope (Figure 10G, arrowheads). Thus, our data strongly suggest that the emerin localization to the nuclear envelope in COS7 cells depends on Nesprin-2.
|
Nesprin-2 Is a Component of the Outer and Inner Nuclear Membrane in HaCat Cells
The association of Nesprin-2 with inner nuclear proteins such as lamin A/C and emerin strongly suggested its presence within the nucleus. To elucidate the exact Nesprin-2 topology at the nuclear membrane we performed immunoelectron microscopy in HaCaT cells using all three Nesprin-2 antibodies. Prominent immunogold decoration of the NE was observed with all Nesprin-2 antibodies (Figure 11, AC); however, the strongest labeling was observed with the pAbK1 polyclonal antibody. Nesprin-2 labeling appeared in clusters, which were observed on the outer (Figure 11A, black arrows) as well as the inner nuclear membrane (Figure 11A, open arrowheads). A similar staining pattern was observed with the monoclonal N- and C-terminal Nesprin-2 antibodies (Figure 11, B and C, respectively). Quantitation of the immunogold particles demonstrates that more gold particles are detected within the nucleus than on the cytoplasmic side of the NE (Figure 11D).
|
| DISCUSSION |
|---|
|
|
|---|
, a C-terminal isoform of Nesprin-1 Giant/Enaptin, interacts directly with emerin and lamin A in vitro. In sharp contrast to emerin, which is not required for the proper subcellular distribution of Nesprin-2, the selective alteration and ablation of the lamin A/C network has profound effects on the nuclear envelope localization of Nesprin-2. Our biochemical observations and immunohistochemical data on skin suggest that lamin C is sufficient for Nesprin-2 binding and its proper localization at the nuclear envelope. These data are in agreement with a recent report, in which human fibroblasts that carry the homozygous missense mutation Y259X in lamin A/C exhibit an aberrant nesprin-1
and emerin localization. Interestingly, the expression of lamin C in the mutant cells was sufficient to restore the proper anchorage of both emerin and nesprin-1
at the nuclear envelope (Muchir et al., 2003
The scaffolding aspects of lamin in relation to Nesprin-2 seem to be evolutionarily conserved and have been also reported in C. elegans. The localization of ANC-1 in C. elegans at the nuclear envelope requires lamin and also the inner nuclear membrane protein UNC-84 (Lee et al., 2002
; Starr and Han, 2002
), suggesting a bridging model in which the outer nuclear membrane protein ANC-1 interacts through a "structural bridge" composed of UNC-84 and associated proteins with the nuclear lamina (Starr and Han, 2003
). Interestingly two UNC-84 orthologues, SUN1 and SUN2, have been identified in humans (Malone et al., 1999
; Hodzic et al., 2004
). Their presence suggests that an indirect anchorage mechanism to the nuclear lamina may exist also for Nesprins localized at the outer nuclear membrane in addition to the direct interaction demonstrated here.
Although the biochemical details regarding the proteins implicated in such a model are still missing, our data propose that lamin A/C mutations may disrupt the localization and function of Nesprin-2 at the nuclear envelope. Mutations in human lamins cause a variety of disorders affecting various tissues including skeletal muscle (Burke and Stewart, 2002
; Hutchison, 2002
; Worman and Courvalin, 2002
). Interestingly, both Nesprin-1 as well Nesprin-2 isoforms are expressed in skeletal muscle and genetic data from D. melanogaster indicate a requirement of the fly orthologue MSP-300 in embryonic muscle morphogenesis (Rosenberg-Hasson et al., 1996
). Therefore, lamin mutations may weaken or disrupt the interactions with Nesprins, resulting in loss-of-function mutants. Further data will be needed to prove an involvement of Nesprin-1 and -2 in laminopathies.
Our results suggest a novel Nesprin-2based mechanism by which emerin is properly localized to the nuclear membrane. The observation, however, that the dominant negative tmNesprin-2 construct or the Nesprin-2 silencing mislocalizes emerin is very surprising, considering that emerin is able to bind by itself to various nuclear proteins, including lamin A/C (Bengtsson and Wilson, 2004
). How does the absence of Nesprin-2 from the nuclear envelope influence emerin in cells exhibiting a normal expression and localization of lamin A/C? One possible scenario is that Nesprin-2 recruits and stabilizes emerin at the nuclear envelope through a direct interaction, a scenario, which is substantiated by our results showing a direct association of the last two C-terminal spectrin repeats of Nesprin-2 with emerin. Our model is further strengthened by the data we obtained from the expression of the dnNesprin-2 GFP-fusion protein in COS7 cells. In contrast to tmNesprin-2, this polypeptide contains the last two C-terminal spectrin repeats, which bind to emerin in vitro. Although both proteins can displace Nesprin-2, a profound effect on emerin is only observed with the tmNesprin-2 construct where the emerin binding site is missing. Interestingly, such an interaction has also been described for the C-terminal spectrin repeats of nesprin-1
. Although the amino-terminal half of nesprin-1
(spectrin repeats 15) was found to bind with high-affinity to emerin (53 nM), a week association (250 nM) to emerin was demonstrated for the last three spectrin repeats (spectrin repeats 57) of the nesprin-1
molecule (Mislow et al., 2002b
). Furthermore, our data provide a clear explanation for a previous study, which demonstrated that dominant negative mutants of lamin A/C cause emerin to accumulate in cytoplasmic granules (Vaughan et al., 2001
). The authors concluded that lamin A/C is essential for anchorage of emerin to the inner nuclear membrane. Our experiments showed that in addition those constructs affect also the localization of Nesprins at the nuclear envelope, suggesting that this event may lead to the accumulation of emerin in the cytoplasm. Even though much has been reported about the nuclear-membrane targeting determinants of emerin and its multiple binding partners, the exact mechanism still remains unclear (Fairley et al., 1999
; Östlund et al., 1999
; Tsuchiya et al., 1999
; Lee et al., 2001
). Interestingly, emerin was recently identified as a pointed-end actin-capping protein (Holaska et al., 2004
). Therefore, emerin and Nesprin complexes may be involved additionally in the assembly and the organization of nuclear actin structures.
|
In closing, our present study establishes linkages and interconnections between Nesprins, lamin A/C, and the emerin molecules (Figure 12), which have been implicated in a wide range of tissue-specific diseases. Genetic data using the embryonic stem cell technology will shed some light on the potential involvement of Nesprins in human genetic diseases and reveal whether they correspond to the "biological Atlas" of the cell holding up and keeping the nucleus (universe) in position. One aspect is, however, already apparent: eukaryotic nuclei use giant scaffolding proteins that, similar to cytoplasmic linkers, have the capacity to cross-bridge various architectural elements and structurally organize membranes. With an 800-kDa Nesprin-2, or an 1-MDa Nesprin-1 protein there is still much to learn about the putative interactions and their biology. Revealing their function remains a great challenge since they are the largest molecules of the
-actinin superfamily and of complex structural organization.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used: aa, amino acids; ABD, actin-binding domain; Co-IP, coimmunoprecipitation; DAPI, 4,6-diamidino-2-phenylindole; GFP, green fluorescent protein; GST, glutathione S-transferase; NUANCE, nucleus and actin connnecting element; Nesprins, nuclear envelope spectrin repeat proteins; siRNA, small interference RNA; X-EDMD, X-linked Emery-Dreifuss muscular dystrophy.
Note added in proof. While this paper was under review, Zhang et al. (2005
) published an article demonstrating the existence of various Nesprin-2 isoforms within the nucleus, the outer nuclear membrane, and various cytoplasmic compartments. These data suggest that nesprin-2 isoforms may link various membranous compartments including the nucleus to the actin cytoskeleton. The authors showed that the smaller Nesprin-2 isoforms colocalize and bind to lamin A/C and emerin at the inner nuclear membrane and require lamin A/C for proper localization in SW-13 cells. Those associations allowed the authors to suggest that a Nesprin-based mechanism may explain how disruption/s of NE constituents leads to muscle dysfunction.
Address correspondence to: Angelika A. Noegel (noegel{at}uni-koeln.de).
| REFERENCES |
|---|
|
|
|---|
Bengtsson, L., and Wilson, K. L. ((2004). ). Multiple and surprising new functions for emerin, a nuclear membrane protein. Curr. Opin. Cell Biol. 16, , 17.[CrossRef][Medline]
Burke, B., and Stewart, C. L. ((2002). ). Life at the edge: the nuclear envelope and human disease. Nat. Rev. Mol. Cell. Biol. 3, , 575585.[CrossRef][Medline]
Dreuillet, C., Tillit, J., Kress, M., and Ernoult-Lange, M. ((2002). ). In vivo and in vitro interaction between human transcription factor MOK2 and nuclear lamin A/C. Nucleic Acids Res. 30, , 46344642.
Ellis, D. J., Jenkins, H. E., Whitfield, W.G.F., and Hutchison, C. J. ((1997). ). GST-lamin fusion proteins act as dominant negative mutants in Xenopus egg extract and reveal the function of the lamina in DNA replication. J. Cell Sci. 110, , 25072518.[Abstract]
Fairley, E. A., Kendrick-Jones, J., and Ellis, J. A. ((1999). ). The Emery-Dreifuss muscular dystrophy phenotype arises from aberrant targeting and binding of emerin at the inner nuclear membrane. J. Cell Sci. 112, , 25712582.[Abstract]
Harborth, J., Elbashir, S. M., Bechert, K., Tuschl, T., and Weber, K. ((2001). ). Identification of essential genes in cultured mammalian cells using small interfering RNAs. J. Cell Sci. 114, , 45574565.
Hodzic, D. M., Yeater, D. B., Bengtsson, L., Otto, H., and Stahl, P. D. ((2004). ). Sun2 is a novel mammalian inner nuclear membrane protein. J. Biol. Chem. 279, , 2580525812.
Hoeltzenbein, M., Karow, T., Zeller, J. A., Warzok, R., Wulff, K., Zschiesche, M., Herrmann, F. H., Grosse-Heitmeyer, W., and Wehnert, M. S. ((1999). ). Severe clinical expression in X-linked Emery-Dreifuss muscular dystrophy. Neuromuscul. Disord. 9, , 166170.[CrossRef][Medline]
Holaska, J. M., Kowalski, A. K., and Wilson, K. L. ((2004). ). Emerin caps the pointed end of actin filaments: evidence for an actin cortical network at the nuclear inner membrane. PLoS Biol. 2, , E231.[CrossRef][Medline]
Hutchison, C. J. ((2002). ). Lamins: building blocks or regulators of gene expression? Nat. Rev. Mol. Cell. Biol. 3, , 848858.[CrossRef][Medline]
Lee, K. K., Haraguchi, T., Lee, R. S., Koujin, T., Hiraoka, Y., and Wilson, K. L. ((2001). ). Distinct functional domains in emerin bind lamin A and DNA-bridging protein BAF. J. Cell Sci. 114, , 45674573.
Lee, K. K., Starr, D., Cohen, M., Liu, J., Han, M., Wilson, K. L., and Gruenbaum, Y. ((2002). ). Lamin-dependent localization of UNC-84, a protein required for nuclear migration in Caenorhabditis elegans. Mol. Biol. Cell 13, , 892901.
Malone, C. J., Fixsen, W. D., Horvitz, H. R., and Han, M. ((1999). ). UNC-84 localizes to the nuclear envelope and is required for nuclear migration and anchoring during C. elegans development. Development 126, , 31713181.[Abstract]
Mislow, J.M.K., Kim, M. S., Davis, D. B., and McNally, E. M. ((2002a). ). Myne-1, a spectrin repeat transmembrane protein of the myocyte inner nuclear membrane, interacts with lamin A/C. J. Cell Sci. 115, , 6170.
Mislow, J.M.K., Holaska, J. M., Kim, M. S., Lee, K. K., Segura-Totten, M., Wilson, K. L., and McNally, E. M. ((2002b). ). Nesprin-1alpha self-associates and binds directly to emerin and lamin A in vitro. FEBS Lett. 525, , 135140.[CrossRef][Medline]
Morris, N. R. ((2003). ). Nuclear positioning: the means is at the ends. Curr. Opin. Cell Biol. 15, , 5459.[CrossRef][Medline]
Muchir, A., van Engelen, B. G., Lammens, M., Mislow, J. M., McNally, E., Schwarz, K., and Bonne, G. ((2003). ). Nuclear envelope alterations in fibroblasts from LGMD1B patients carrying nonsense Y259X heterozygous or homozygous mutation in lamin A/C gene. Exp. Cell Res. 291, , 352362.[CrossRef][Medline]
Nikolova, V. et al. ((2004). ). Defects in nuclear structure and function promote dilated cardiomyopathy in lamin A/C-deficient mice. J. Clin. Invest. 113, , 357369.[CrossRef][Medline]
Noegel, A. A., Blau-Wasser, R., Sultana, H., Muller, R., Israel, L., Schleicher, M., Patel, H., and Weijer, C. J. ((2004). ). The cyclase-associated protein CAP as regulator of cell polarity and cAMP signalling in Dictyostelium. Mol. Biol. Cell 15, , 934945.
Östlund, C., Ellenberg, J., Hallberg, E., Lippincott-Schwartz, J., and Worman, H. J. ((1999). ). Intracellular trafficking of emerin, the Emery-Dreifuss muscular dystrophy protein. J. Cell Sci. 112, , 17091719.[Abstract]
Padmakumar, V. C., Abraham, S., Braune, S., Noegel, A. A., Tunggal, B., Karakesisoglou, I., and Korenbaum, E. ((2004). ). Enaptin, a giant actin-binding protein, is an element of the nuclear membrane and the actin cytoskeleton. Exp. Cell Res. 295, , 330339.[CrossRef][Medline]
Rivero, F., Kuspa, A., Brokamp, R., Matzner, M., and Noegel, A. A. ((1998). ). Interaptin, an actin-binding protein of the alpha-actinin superfamily in Dictyostelium discoideum, is developmentally and cAMP-regulated and associates with intracellular membrane compartments. J. Cell Biol. 142, , 735750.
Rosenberg-Hasson, Y., Renert-Pasca, M., and Volk, T. ((1996). ). A Drosophila dystrophin-related protein, MSP-300, is required for embryonic muscle morphogenesis. Mech. Dev. 60, , 8394.[CrossRef][Medline]
Soullam, B., and Worman, H. J. ((1995). ). Signals and structural features involved in integral membrane protein targeting to the inner nuclear membrane. J. Cell Biol. 130, , 1527.
Starr, D. A., and Han, M. ((2002). ). Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science 298, , 406409.
Starr, D. A., and Han, M. ((2003). ). ANChors away: an actin based mechanism of nuclear positioning. J. Cell Sci. 116, , 211216.
Sullivan, T., Escalante-Alcalde, D., Bhatt, H., Anver, M., Bhat, N., Nagashima, K., Stewart, C. L., and Burke, B. ((1999). ). Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol. 147, , 913920.
Tsuchiya, Y., Hase, A., Ogawa, M., Yorifuji, H., and Arahata, K. ((1999). ). Distinct regions specify the nuclear membrane targeting of emerin, the responsible protein for Emery-Dreifuss muscular dystrophy. Eur. J. Biochem. 259, , 859865.[Medline]
Vaughan, O. A., Alvarez-Reyes, M., Bridger, J. M., Broers, J.L.V., Ramaekers, F.C.S., Wehnert, M., Morris, G. E., Whitfield, W.G.F., and Hutchison, C. J. ((2001). ). Both emerin and lamin C depend on lamin A for localization at the nuclear envelope. J. Cell Sci. 114, , 25772590.
Venables, R. S., McLean, S., Luny, D., Moteleb, E., Morley, S., Quinlan, R. A., Lane, E. B., and Hutchison, C. J. ((2001). ). Expression of individual lamins in basal cell carcinomas of the skin. Br. J. Cancer 84, , 512519.[CrossRef][Medline]
Worman, H. J., and Courvalin, J. C. ((2002). ). The nuclear lamina and inherited disease. Trends Cell Biol. 12, , 591598.[CrossRef][Medline]
Ye, Q., and Worman, H. J. ((1995). ). Protein-protein interactions between human nuclear lamins expressed in yeast. Exp. Cell Res. 219, , 292298.[CrossRef][Medline]
Zhang, Q., Skepper, J. N., Yang, F., Davies, J. D., Hegyi, L., Roberts, R. G., Weissberg, P. L., Ellis, J. A., and Shanahan, C. N. ((2001). ). Nesprins: a novel family of spectrin-repeat-containing proteins that localize to the nuclear membrane in multiple tissues. J. Cell Sci. 114, , 44854498.
Zhang, Q., Ragnauth, C., Greener, M. J., Shanahan, C. M., and Roberts, R. G. ((2002). ). The nesprins are giant actin-binding proteins, orthologous to Drosophila melanogaster muscle protein MSP-300. Genomics 80, , 473481.[CrossRef][Medline]
Zhang, Q., Ragnauth, C. D., Skepper, J. N., Worth, N. F., Warren, D. T., Roberts, R. G., Weissberg, P. L., Ellis, J. A., and Shanahan, C. M. ((2005). ). Nesprin-2 is a multi-isomeric protein that binds lamin and emerin at the nuclear envelope and forms a subcellular network in skeletal muscle. J. Cell Sci. 118, , 673687.
Zhen, Y. Y., Libotte, T., Munck, M., Noegel, A. A., and Korenbaum, E. ((2002). ). NUANCE, a giant protein connecting the nucleus and actin cytoskeleton. J. Cell Sci. 115, , 32073222.
This article has been cited by other articles:
![]() |
A. Mejat, V. Decostre, J. Li, L. Renou, A. Kesari, D. Hantai, C. L. Stewart, X. Xiao, E. Hoffman, G. Bonne, et al. Lamin A/C-mediated neuromuscular junction defects in Emery-Dreifuss muscular dystrophy J. Cell Biol., May 4, 2009; 184(1): 31 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Dahl, A. J.S. Ribeiro, and J. Lammerding Nuclear Shape, Mechanics, and Mechanotransduction Circ. Res., June 6, 2008; 102(11): 1307 - 1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Luke, H. Zaim, I. Karakesisoglou, V. M. Jaeger, L. Sellin, W. Lu, M. Schneider, S. Neumann, A. Beijer, M. Munck, et al. Nesprin-2 Giant (NUANCE) maintains nuclear envelope architecture and composition in skin J. Cell Sci., June 1, 2008; 121(11): 1887 - 1898. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, C. Bethmann, N. F. Worth, J. D. Davies, C. Wasner, A. Feuer, C. D. Ragnauth, Q. Yi, J. A. Mellad, D. T. Warren, et al. Nesprin-1 and -2 are involved in the pathogenesis of Emery Dreifuss muscular dystrophy and are critical for nuclear envelope integrity Hum. Mol. Genet., December 1, 2007; 16(23): 2816 - 2833. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kandert, Y. Luke, T. Kleinhenz, S. Neumann, W. Lu, V. M. Jaeger, M. Munck, M. Wehnert, C. R. Muller, Z. Zhou, et al. Nesprin-2 giant safeguards nuclear envelope architecture in LMNA S143F progeria cells Hum. Mol. Genet., December 1, 2007; 16(23): 2944 - 2959. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ketema, K. Wilhelmsen, I. Kuikman, H. Janssen, D. Hodzic, and A. Sonnenberg Requirements for the localization of nesprin-3 at the nuclear envelope and its interaction with plectin J. Cell Sci., October 1, 2007; 120(19): 3384 - 3394. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salpingidou, A. Smertenko, I. Hausmanowa-Petrucewicz, P. J. Hussey, and C. J. Hutchison A novel role for the nuclear membrane protein emerin in association of the centrosome to the outer nuclear membrane J. Cell Biol., September 7, 2007; 178(6): 897 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Ji, R. T. Lee, L. Vergnes, L. G. Fong, C. L. Stewart, K. Reue, S. G. Young, Q. Zhang, C. M. Shanahan, and J. Lammerding Cell Nuclei Spin in the Absence of Lamin B1 J. Biol. Chem., July 6, 2007; 282(27): 20015 - 20026. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Morris, H. Hofemeister, and P. O'Hare Herpes Simplex Virus Infection Induces Phosphorylation and Delocalization of Emerin, a Key Inner Nuclear Membrane Protein J. Virol., May 1, 2007; 81(9): 4429 - 4437. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, M. Ketema, H. Truong, and A. Sonnenberg KASH-domain proteins in nuclear migration, anchorage and other processes J. Cell Sci., December 15, 2006; 119(24): 5021 - 5029. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. V. Broers, F. C. S. Ramaekers, G. Bonne, R. B. Yaou, and C. J. Hutchison Nuclear lamins: laminopathies and their role in premature ageing. Physiol Rev, July 1, 2006; 86(3): 967 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. McGee, R. Rillo, A. S. Anderson, and D. A. Starr UNC-83 Is a KASH Protein Required for Nuclear Migration and Is Recruited to the Outer Nuclear Membrane by a Physical Interaction with the SUN Protein UNC-84 Mol. Biol. Cell, April 1, 2006; 17(4): 1790 - 1801. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Crisp, Q. Liu, K. Roux, J.B. Rattner, C. Shanahan, B. Burke, P. D. Stahl, and D. Hodzic Coupling of the nucleus and cytoplasm: role of the LINC complex J. Cell Biol., January 3, 2006; 172(1): 41 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, S. H.M. Litjens, I. Kuikman, N. Tshimbalanga, H. Janssen, I. van den Bout, K. Raymond, and A. Sonnenberg Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin J. Cell Biol., December 5, 2005; 171(5): 799 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pederson and U. Aebi Nuclear Actin Extends, with No Contraction in Sight Mol. Biol. Cell, November 1, 2005; 16(11): 5055 - 5060. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lammerding, J. Hsiao, P. C. Schulze, S. Kozlov, C. L. Stewart, and R. T. Lee Abnormal nuclear shape and impaired mechanotransduction in emerin-deficient cells J. Cell Biol., August 29, 2005; 170(5): 781 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
V.C. Padmakumar, T. Libotte, W. Lu, H. Zaim, S. Abraham, A. A. Noegel, J. Gotzmann, R. Foisner, and I. Karakesisoglou The inner nuclear membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nuclear envelope J. Cell Sci., August 1, 2005; 118(15): 3419 - 3430. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||