![]() |
|
|
Vol. 16, Issue 8, 3501-3510, August 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(TGF
) Pathway by Interleukin-1
Is Mediated through TGF
-activated Kinase 1 Phosphorylation of SMAD3



* Developmental Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, 9751 NN Haren, The Netherlands;
Department of Hematology, University Hospital Groningen, 9713 GZ Groningen, The Netherlands
Submitted November 30, 2004;
Revised May 9, 2005;
Accepted May 17, 2005
Monitoring Editor: William Tansey
| ABSTRACT |
|---|
|
|
|---|
is the prototype of a large family of secreted factors that regulate multiple biological processes. In the immune system, TGF
acts as an anti-inflammatory and immunosuppressive molecule, whereas the cytokine interleukin (IL)-1
is a crucial mediator of inflammatory responses and induces proinflammatory genes and acute phase proteins. Here, we present evidence for the existence of a direct inhibitory interaction between the IL-1
and TGF
signaling cascades that is not dependent on IL-1
induced SMAD7 expression. IL-1
and its downstream mediator TAK1 inhibit SMAD3-mediated TGF
target gene activation, whereas SMAD3 nuclear translocation and DNA binding in response to TGF
are not affected. IL-1
transiently induces association between TAK1 and the MAD homology 2 domain of SMAD3, resulting in SMAD3 phosphorylation. Furthermore, IL-1
alleviates the inhibitory effect of TGF
on in vitro hematopoietic myeloid colony formation. In conclusion, our data provide evidence for the existence of a direct inhibitory effect of the IL-1
-TAK1 pathway on SMAD3-mediated TGF
signaling, resulting in reduced TGF
target gene activation and restored proliferation of hematopoietic progenitors. | INTRODUCTION |
|---|
|
|
|---|
and the anti-inflammatory secreted factor transforming growth factor
(TGF
). TGF
signaling is mediated through transmembrane receptors with Ser/Thr kinase activity (Massague, 1998
to its type II receptor (T
RII), a type I TGF
receptor is recruited and activated by T
RII. The activated receptor complex activates intracellular mediators of TGF
signaling, receptor-regulated SMAD proteins (R-SMADs). These activated R-SMADs form a complex with coSMADs (SMAD4) and translocate to the nucleus where the activated SMAD complex, often in cooperation with (DNA-binding) cofactors, modulates transcriptional activity of target genes (Wrana, 2000
/SMAD signaling and other cascades has been demonstrated to target nuclear translocation of SMADs as well as SMAD interaction with cofactors (reviewed in Moustakas et al., 2001
responses (de Caestecker et al., 1998
Whereas TGF
inhibits inflammatory and immune responses and reduces stem cell cycle activity (Fortunel et al., 2000b
), IL-1
is the prototype of a proinflammatory cytokine, involved in inflammation and host defense (O'Neill, 2000
). On activation of the cell surface type I IL-1
receptor by IL-1
, a cascade of signaling events is initiated, leading to c-Jun NH2-terminal kinase (JNK) and nuclear factor-
B (NF-
B) activation, ultimately resulting in transcriptional activation of proinflammatory genes (O'Neill, 2000
). Recently, the mitogen-activated protein kinase kinase kinase homologue TGF
activated kinase 1 (TAK1), which was originally identified as a mediator of TGF
(Yamaguchi et al., 1995
) and bone morphogenetic protein (BMP) (Shibuya et al., 1998
) signaling, also has been shown to function as a key intermediate in the IL-1
cascade, providing a link between TRAF6 and downstream effectors NF-
B and JNK-1(Ninomiya-Tsuji et al., 1999
; Takaesu et al., 2000
; Jiang et al., 2002
).
Inhibition of TGF
signaling by the proinflammatory cytokines interferon-
, tumor necrosis factor (TNF)-
, and IL-1
has been described, which all inhibit TGF
signaling by up-regulating expression of the inhibitory SMAD7 gene (Topper et al., 1997
; Ulloa et al., 1999
; Bitzer et al., 2000
). In human umbilical cord vein cells, however, SMAD7 gene expression is not induced by either TGF
, TNF-
, or IL-1
, indicating that the SMAD7 transcriptional response to these secreted factors is subject to cell type-dependent constraints (Topper et al., 1997
). Inhibitory interactions between IL-1
and TGF
also have been described; for example, IL-1
-induced production of cytokines involved in hematopoietic cell proliferation is inhibited by TGF
(Ruscetti et al., 1992
) and similar results have been described in T lymphocytes (Espevik et al., 1987
; Chantry et al., 1989
).
Here, we provide evidence for a direct, SMAD7-independent, inhibitory interaction between the IL-1
and TGF
signaling cascades. IL-1
stimulation inhibits SMAD3 transcriptional activity as a result of IL-1
induced complex formation between TAK1 and the MAD homology (MH) 2 domain of SMAD3. In addition we show that IL-1
inhibits TGF
-induced target gene expression and that IL-1
neutralizes the inhibitory effect of TGF
on in vitro myeloid colony formation. The results presented in this manuscript describe a molecular mechanism underlying IL-1
inhibition of TGF
signaling that is SMAD7 independent and indicate that this cross-talk has implications for TGF
target gene expression and cellular responses of hematopoietic progenitor cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(1 ng/ml; R&D Systems, Minneapolis, MN), IL-1
(200 U/ml; Roche Diagnostics, Almere, The Netherlands) or TNF-
(500 U/ml; Boehringer Ingelheim, Vienna, Austria) by using TRIzol, according to the supplied protocol (Invitrogen, Carlsbad, CA). When both IL-1
and TGF
were added, IL-1
was added 30 min before TGF
. RNA (3 µg) was reverse transcribed with Moloneymurine leukemia virus (Invitrogen) by using random hexamers and subjected to PCR analysis (Taq polymerase; Invitrogen). Real-time PCR analyses were performed on serially diluted cDNA samples with a Sybr Green kit and a Lightcycler (Roche Diagnostics). The specificity of the PCR reactions was verified by generation of a melting curve and by agarose gel electrophoresis of the amplified products. The sequences of the PCR primers used were SMAD7: forward (F), GCCTCGGACAGCTCAATTCG and reverse (R), CGTCCACGGCTGCTGCATAA; SKI: F, CTCATCCGAGACAGCTTCTA and R, AGGACAAGGAGGAGGTGAAT; MMP-2: F, GGCCCTGTCACTCCTGAGAT and R, GGCATCCAGGTTATCGGGGA; and PAI-1: F, AGACCTTGGCCTCTCCTTGG and R, TGGCAGGCAGTACAAGAGTG.
Cell Lines and Transfections
A549 (ATTC CCL-185) cells were maintained in RPMI 1640 medium containing 10% fetal calf serum (FCS), and HepG2 (ATCC HB-8065) cells were maintained in DMEM containing 10% FCS and 1x minimal essential medium nonessential amino acids. Both media were further supplemented with 100 IU/ml penicillin, 1 mg/ml streptomycin, and 2 mM L-glutamine (Invitrogen). For transient transfections, 100,000 cells were seeded per 35-mm dish and transfected using either the calcium phosphate coprecipitation method (HepG2) or FuGENE (Roche Diagnostics) when A549 cells were used. The following day, the media were changed, and 48 h after transfection the cells were harvested in reporter lysis buffer (Promega, Madison, WI). Luciferase activity was determined using the Promega luciferase assay system. In all transfections, a
-galactosidase expression plasmid (pDM2LacZ; Boer et al., 1990
) was included to normalize luciferase activities.
-Galactosidase activity was determined in 100 mM Na2HPO4/NaH2PO4, 1 mM MgCl2, 100 mM 2-mercaptoethanol, and 0.67 mg/ml O-nitrophenylgalactopyranoside. All transfections were carried out in triplicate and repeated at least twice in independent experiments by using different batches of plasmid DNA.
Plasmids
The SBE-Luc reporter contains four copies of the JunB SMAD binding element, as described previously (Jonk et al., 1998
). Deleting a 3' PstI fragment from the HA-TAK1 construct generated the HA-TAK1 (1-402) construct. SMAD2-3 chimeric constructs were generated using PCR and sequenced for integrity.
We are grateful to Drs. D. Melton for SMAD1 and SMAD2; R. Derynck for SMAD3; M. Schutte for SMAD4; A. Moustakas and P. ten Dijke for SMAD3-MH1, -linker, and -MH2 constructs; and K. Matsumoto for TAK1, TAB1, and TAK1-K63W.
Nuclear Fractionation
A549 nuclear extracts were prepared according to the "mini extracts" method described in Schreiber et al. (1989
). Nuclear extracts were separated using SDS-PAGE and analyzed using Western blotting and enhanced chemiluminescence (ECL) (Amersham Biosciences UK, Little Chalfont, Buckinghamshire, United Kingdom).
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear extracts were prepared from A549 cells as described in Dignam et al. (1983
). Annealed oligonucleotides (forward, TCGAGAGCCAGACAAAAAGCCAGACATTTAGCCAGACAC and reverse, TCGAGTGTCTGGCTAAATGTCTGGCTTTTTGTCTGGCTC) were labeled using Klenow fragment 1 and [
-32P]dATP and purified with Sephadex G-50 columns. Binding reactions were carried out for 30 min at room temperature in 10 mM Tris, pH 8.0, 1 mM EDTA pH 8.0, 2 mM MgCl2, 5% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 0.01% NP-40 containing 5 µg of extract, 1 µg of poly(dI-dC), 0.1 ng of probe, and where appropriate, 100-fold molar excess competitor oligos. Preincubation with SMAD3 antibodies was carried out at room temperature, 30 min before probe addition. Before loading onto 5% polyacrylamide gels (0.5x Tris borate-EDTA), 20% Ficoll was added to the reactions, and after electrophoresis gels were dried and autoradiographed.
Immunoprecipitation
For immunoprecipitations, cells were harvested, washed with ice-cold phosphate-buffered saline, and subsequently lysed in 500 µl of lysis buffer (20 mM Tris-HCl, pH 7.6, 100 mM NaCl, 10 mM EDTA, 1% NP-40, 10% glycerol, 2 mM Na3VO4, 2 mM PMSF, 1 µM pepstatin, and 1 mM dithiothreitol) for 15 min on ice. Cell lysates were incubated with
-myc agarose conjugate (9E10 sc-40 AC; Santa Cruz Biotechnology, Santa Cruz, CA) rotating O/N at 4°C. The immune complex was washed three times with lysis buffer and heated in sample buffer, separated by SDS-PAGE, and analyzed using western blotting and ECL.
In Vivo Labeling
A549 cells (1 x 106), seeded in 60-mm plates, were transiently transfected with myc-SMAD3, myc-SMAD3A3, and myc-SMAD2 expression plasmids by using FuGENE (Roche Diagnostics). Forty-eight hours after transfection, the cells were starved in serum- and phosphate-free DMEM for 4 h, [32P]orthophosphate was added to the medium (0.5 Ci/ml) for 2 h, and the cells were stimulated with TGF
or IL-1
for 20 min. Myc-tagged proteins were precipitated from cell lysates as described under "Immunoprecipitation." The precipitated proteins were resolved on 10% SDS-PAGE, blotted onto polyvinylidene difluoride membrane, and quantified using a PhosphorImager (STORM 860; Amersham Biosciences UK). After detection of radioactive proteins, the blots were rehydrated, and myc-tagged proteins were detected using
-myc antibodies, followed by ECL.
In Vitro Myeloid Colony Assay
Colony-forming unit granulocyte/macrophage assays were essentially performed as described previously (Vellenga et al., 1990
). Bone marrow mononuclear cells were obtained from healthy controls undergoing cardiac surgery after informed consent. Mononuclear cells were isolated by discontinuous gradient centrifugation by using Lymphoprep (Nycomed, Asker, Norway). Cells (105) were plated in 1 ml of semisolid medium, consisting of 1.2% methylcellulose (Fluka, Buchs, Switzerland) in DMEM, supplemented with 20% FCS (Invitrogen), 1% deionized bovine serum albumin (Invitrogen), 0.001%
-thioglycerol, 10 ng/ml granulocyte/macrophage-colony stimulating factor (GM-CSF) (Genetics Institute, Cambridge, MA) and 10 ng/ml IL-3 (Genetics Institute). When appropriate, 200 U/ml IL-1
or 1 ng/ml TGF
1 was added to the medium. Cell cultures were incubated in duplicate for 14 d at 37°C and 5% CO2, after which the number of colonies was counted using an inverted microscope; only colonies consisting of >50 cells were scored.
| RESULTS |
|---|
|
|
|---|
Signaling by IL-1
Is Mediated through TAK1
targets SMAD-mediated TGF
signaling, the effect of IL-1
on transcriptional activation of a SMAD-dependent reporter construct by TGF
was determined. HepG2 and A549 cells were transfected with a SMAD-specific reporter, SBE-Luc, containing multimerized SMAD binding elements (SBEs) from the JunB gene, driving the expression of the luciferase gene (Jonk et al., 1998
stimulation of HepG2 and A549 cells, transfected with SBE-Luc reporter constructs, resulted in a 7-(HepG2) to 18-fold (A549) increase in reporter activity. Although IL-1
treatment had little effect on basal SBE reporter activity, it reduced TGF
-induced activity of the SBE-reporter by approximately two- to threefold (Figure 1A). Next, we asked whether TAK1 was involved in IL-1
inhibition of TGF
signaling. A catalytically inactive TAK1 construct, TAK1-K63W, was overexpressed, and the effect on SBE-Luc reporter activity was determined. Cotransfection of SBE reporters with a TAK1-K63W expression plasmid restored TGF
signaling in the presence of IL-1
, indicating that IL-1
inhibition of TGF
signaling requires a functional TAK1 kinase (Figure 1A). Basal or TGF
-induced SBE-Luc reporter activity was not affected by TAK1-K63W overexpression (Figure 1A). The same results were obtained using the promoter of the SMAD7 gene: overexpression of TAK1-K63W reduced the sensitivity of the SMAD7 promoter to IL-1
and restored TGF
responsiveness (Figure 1B). These results indicate that a catalytically active TAK1 is required for the inhibitory effect of IL-1
on TGF
signaling. To gain more insight into the kinetics of IL-1
inhibition of TGF
signaling (also see Figure 6A), IL-1
was either added 120 min before TGF
or added 120 min before TGF
and removed after 30 min (90 min before TGF
stimulation). If IL-1
was continuously present, SBE-Luc activation by TGF
was reduced, but when IL-1
was removed 90 min before TGF
stimulation, activation levels are completely restored, suggesting that reactivation of the IL-1
pathway occurs when IL-1
is continuously present (Figure 1C).
|
|
IL-1
Inhibits Target Gene Activation by TGF
To determine whether this inhibitory effect of IL-
on TGF
-reporter gene activation also occurs at the level of endogenous gene activation, the effect of IL-1
on the transcriptional activation of target genes by TGF
was determined in A549 cells by using quantitative RT-PCR (qPCR) analyses. A549 cells were treated with either TGF
, IL-1
, or both, and SMAD7 (a SMAD3-specific TGF
target gene), SKI (a TGF
target gene activated by SMAD2 and/or SMAD3), MMP-2 (a SMAD2-specific TGF
target gene), and PAI-1 (a SMAD3-dependent TGF
target) mRNA expression levels were determined (Datto et al., 1999
; Piek et al., 2001
). SMAD7 gene expression was induced eightfold after 1 h of TGF
stimulation, whereas after 3 h, induction levels were down to twofold and back to fourfold after 6 h. Pretreatment with IL-1
followed by TGF
stimulation significantly reduced SMAD7 gene induction to five-, one- and twofold, respectively. IL-1
treatment alone did reduce SMAD7 mRNA baseline levels. (Figure 2). IL-1
also reduced TGF
-mediated activation of the SKI gene, and this effect was most prominent after 6 h. IL-1
alone had a minor effect on SKI baseline mRNA levels (Figure 2). No significant effect of IL-1
on either TGF
-induced MMP-2 or PAI-1 mRNA levels could be detected. In conclusion, these results indicate that IL-1
negatively interferes with TGF
-induced target gene expression and most prominently with SMAD3-dependent TGF
target genes such as the SMAD7 and SKI gene.
|
and TAK1 Specifically Inhibit TGF
Receptor-regulated SMAD3
/TAK1, as suggested by the qPCR analyses, HepG2 (and A549; our unpublished data) cells were transfected with various SMAD-responsive reporters in combination with the appropriate R-SMADs and SMAD4, TAK1, and TAK1 activating binding protein (TAB1) (Shibuya et al., 1996
|
signaling.
TAK1 Sensitivity of SMAD3 Is Mainly Localized in the MH1 Domain
To determine the domains in SMAD3 that are targeted by TAK1, we made use of the observation that SMAD3 transcriptional activity was efficiently inhibited by TAK1, whereas SMAD2 activity was not affected, and generated SMAD2-3 chimeric constructs. The effect of TAK1 on transcriptional activation of SBE-Luc reporters by these SMAD23 chimeras was determined. The fold-repression of SMAD-mediated reporter gene activation by TAK1 is depicted as "TAK1 sensitivity" (Figure 4). SBE reporter activation by SMAD3 is inhibited by TAK1, a threefold reduction in activity, whereas transcriptional activation by SMAD2 is unaffected. Replacing the SMAD2-MH2 domain with the SMAD3-MH2 domain (compare the 2-2-2 and 2-2-3 constructs) had no effect on TAK1 sensitivity. Replacing the SMAD2 MH1 domain with a SMAD3 MH1 domain, however, increased TAK1 sensitivity by twofold (compare 2-2-2 with 3-2-2). The linker region of SMAD3 does not seem to be involved in TAK1 repression of SMAD3 transcriptional activity (compare the 2-2-3/2-3-3 and 3-3-2/3-2-2 constructs. It is clear that primarily the SMAD3 MH1 domain is targeted by TAK1; however, the observation that the sensitivity is highest in a 3-3-3 construct suggests that the SMAD3 linker and MH2 domains, at least in the context of a SMAD3 MH1 domain, contribute to TAK1 sensitivity of SMAD3.
|
Does Not Affect TGF
-induced Nuclear Translocation and DNA Binding of SMAD3
and TAK1 targets (one of) these steps. IL-1
does not interfere with the activation of the MMP-2 gene by TGF
, indicating that IL-1
does not target the TGF
signaling cascade at the level of the receptor. Furthermore, TAK1 specifically inhibits SMAD3, whereas SMAD2-mediated activation of the SBE-Luc reporter is not affected. Therefore, we decided to focus on downstream events. A549 and HepG2 cells were stimulated with TGF
for various time points, and nuclear fractions were made and analyzed on Western blots. After 15 min of TGF
treatment, a clear accumulation of SMAD3 in the nucleus, compared with unstimulated cells, was observed (Figure 5A). Treatment of the cells with IL-1
before TGF
stimulation had no effect on SMAD3 nuclear translocation, indicating that the inhibitory effect of IL-1
on SMAD3-TGF
signaling occurs at a downstream step. Next, we investigated the effect of IL-1
on the ability of SMAD3 to bind DNA. A549 cells were untreated, stimulated with TGF
, or pretreated with IL-1
before TGF
stimulation. Nuclear extracts were generated and analyzed for SMAD3 DNA binding activity by using a radiolabeled double-stranded SBE oligo as a probe. TGF
stimulation clearly resulted in the formation of complexes with decreased mobility (indicated with SMAD3 in Figure 5B). To validate that these complexes contain SMAD3, a supershift was performed using
-SMAD3 antibodies, which resulted in a further reduction in mobility of the observed complexes, verifying that these contained SMAD3 (indicated by s-SMAD3 in Figure 5B). To control for the specificity of the retarded complexes, 100x excess unlabeled competitor (self) or noncompetitor (nonself) oligos was added (Figure 5B, lanes 100x self and 100x nonself). Pretreatment with IL-1
had no effect on the ability of SMAD3 to bind DNA. In conclusion, these data show that IL-1
does not interfere with SMAD3 nuclear translocation or DNA binding, suggesting that IL-1
most likely interferes with the ability of SMAD3 to activate target gene transcription, as was observed in the qPCR analyses and reporter studies.
|
Association with TAK1 and Phosphorylation of SMAD3 in Response to IL-1
To determine the level of interaction between the IL-1
/TAK1 and TGF
/SMAD3 signaling cascades, HepG2 cells were transfected with a myc-tagged SMAD3 construct, and SMAD3-associated proteins were precipitated from untreated and IL-1
treated HepG2 cells. Western analysis of the immunoprecipitates indicated that TAK1 coprecipitated with SMAD3 in response to IL-1
(Figure 6A). In a time-course experiment, we determined that complex formation between SMAD3 and TAK1 occurs within 2 min of IL-1
stimulation and can be detected up to 30 min, indicating that IL-1
stimulation results in rapid, transient SMAD3 and TAK1 complex formation (Figure 6A).
To identify the interacting domains in SMAD3 and TAK1, deletion constructs were generated and analyzed in coimmunoprecipitation experiments. The MH1-, linker-, and MH2-domains of SMAD3 were tested for IL-1
induced interaction with TAK1 in coimmunoprecipitation experiments. TAK1 immunoreactivity was only detected in complexes precipitated from IL-1
stimulated cells transfected with the SMAD3-MH2 domain (Figure 6B). To determine the domain in TAK1 that interacts with SMAD3 and to test whether an intact catalytic domain is required for complex formation with SMAD3, deletion constructs and a TAK1-K63W mutant were tested in coimmunoprecipitations. The carboxy-terminal 177 amino acids of TAK1 [HA-TAK1(1-402)] are not required and can be deleted without affecting interaction with SMAD3 (Figure 6C). A functional catalytic domain of TAK1 is also not required for SMAD3 interaction because mutation of the ATP-binding site of the TAK1 kinase domain (HA-TAK1-K63W) did not affect interaction with SMAD3 (Figure 6C). Furthermore, coimmunoprecipitation experiments indicated that IL-1
stimulation does not lead to complex formation of SMAD3 with either Erk-1, Erk-2, p38, or JNK-1, all MAPK positioned downstream of TAK1 (our unpublished data). These results further support the observation that inhibition of SMAD3-TGF
signaling by IL-1
occurs at the level of TAK1 and is not mediated by downstream MAPK kinases or MAPKs.
To investigate whether IL-1
induces phosphorylation of SMAD3, A549 cells were transfected with SMAD2, SMAD3, or SMAD3AS (a mutant in which the C-terminal SSXS motif is mutated in AAXA to reduce SMAD3 phosphorylation levels) expression plasmids and cultured in the presence of inorganic 32P. Next, cells were treated with either TGF
or IL-1
, subjected to
-myc immunoprecipitations, SDS-PAGE, autoradiography, and Western analysis. TGF
treatment resulted in a dramatic (30-fold) increase in SMAD3 phosphorylation. IL-1
stimulation also resulted in an increase in SMAD3 phosphorylation (1.5-fold) both in the SMAD3 and SMAD3A3 construct. SMAD2 phosphorylation levels were not altered in response to IL-1
(Figure 6D).
Inhibition of Myeloid Progenitor Proliferation by TGF
Is Completely Restored by IL-1
Previous studies demonstrated that TGF
inhibits in vitro colony formation (Fortunel et al., 2000b
). This was further illustrated in experiments in which TGF
signaling was inhibited by either blocking antibodies (Fortunel et al., 2000a
) or by antisense TGF
oligonucleotides (Hatzfeld et al., 1991
) where a (partial) loss of an autocrine TGF
loop resulted in a release of primitive hematopoietic precursors from quiescence and stimulated in vitro colony formation.
In view of the observed inhibition of TGF
signaling by IL-1
, we investigated the effects of IL-1
and TGF
on in vitro colony formation by using human bone marrow cells. Myeloid colony formation was not affected if the cells were costimulated with IL-1
, whereas TGF
treatment, as was reported previously, reduced colony formation by
60%. This inhibitory effect of TGF
, however, was completely alleviated by the addition of IL-1
(Figure 7). These findings clearly demonstrate that IL-1
can counteract the inhibitory effect of TGF
on myeloid colony formation.
|
| DISCUSSION |
|---|
|
|
|---|
and TGF
signaling cascades are two pleiotropic signaling pathways that elicit a variety of biological responses. In the hematopoietic and immune system, these two signaling cascades essentially have opposite effects: IL-1
acts proinflammatory and stimulates (stem) cell cycling and cytokine production, whereas TGF
basically acts anti-inflammatory and inhibits (stem) cell cycling and cytokine production (Ruscetti et al., 1992
Here, we show that IL-1
negatively interferes with transcriptional activation of TGF
target genes and that IL-1
can counteract the inhibitory effect of TGF
on in vitro myeloid colony formation. Furthermore, we provide evidence for a direct, SMAD7-independent, inhibitory interaction between the IL-1
and TGF
signaling cascades. We show that IL-1
induces the formation of a TAK1SMAD3 complex and prevents transcriptional activation by SMAD3 in response to TGF
.
The effect of IL-1
on TGF
-induced target gene expression was analyzed using SMAD7, SKI, MMP-2, and PAI-1 as target genes. The inhibitory effect of IL-1
was the strongest on the rapidly TGF
-induced SMAD7 and SKI genes (Figure 1). Because the interaction between TAK1 and SMAD3 is transient (Figure 6A), it is possible that IL-1
treatment does not result in a complete, long-term block in SMAD3 signaling. Combined with the different transcriptional activation characteristics of the SMAD7 and SKI genes in response to TGF
(the transcriptional response of SKI is delayed and prolonged in comparison with SMAD7), this possibly explains the observed differences in IL-1
effectiveness in blocking TGF
target gene activation. Previous reports have shown that TGF
signaling can be inhibited by the cytokines interferon-
, TNF-
, and IL-1
, all through up-regulation of SMAD7 gene expression (Topper et al., 1997
; Ulloa et al., 1999
; Bitzer et al., 2000
). In the experiments depicted in Figure 1, up-regulation of SMAD7 gene expression in response to IL-1
(and TNF-
; our unpublished data) alone was not observed. Furthermore, RT-PCR analyses were performed 1, 3, and 6 h after TGF
stimulation, a time scale in which it is very unlikely (at least at the first 2 time points) that transcription and translation of the SMAD7 gene occur, and a clear inhibitory effect of IL-1
on SKI gene activation by TGF
was observed. These data indicate the existence of an alternative mechanism for IL-1
inhibition of TGF
signaling.
TGF
activation of the PAI-1 gene, shown by Datto and Piek (Datto et al., 1999
; Piek et al., 2001
) to be SMAD3 dependent, was not or only mildly inhibited by IL-1
(Figure 2). However, when the PAI-1 promoter was tested in transient transfection assays, SMAD3 activation of PAI-1 reporter was clearly inhibited by TAK1 (Figure 3). These data indicate that TAK1 inhibits SMAD3-mediated transcriptional activation but that IL-1
treatment does not result in reduced transcription of all TGF
-SMAD3 target genes, i.e., PAI-1. The PAI-1 reporter and the endogenous PAI-1 gene seem to respond differently to IL-1
/TAK1. It is possible that the PAI-1 reporter (-800-Luc; Keeton et al., 1991
) we used does not contain all the required sequence elements to completely mimic the transcriptional regulation of the endogenous gene. Alternatively, from different sets of experiments we have data showing that the PAI-1 promoter behaves differently as an episomal or as a stably integrated construct in terms of sensitivity to radiation, which also could explain the observed differences in responsiveness.
Studies in SMAD2- and SMAD3-deficient fibroblasts showed that TGF
induction of SMAD7 gene expression relies on SMAD3 and that SMAD2 is indispensable for MMP-2 activation (Datto et al., 1999
; Piek et al., 2001
). This possibly explains the strong effect of IL-1
on TGF
-induced SMAD7 mRNA levels. SMAD3 dependence of TGF
-mediated transcriptional activation of the SKI gene has not been determined, so residual SMAD2-mediated TGF
signaling could explain the inability of IL-1
to completely block TGF
-induced SKI expression. IL-1
does not interfere with TGF
-induced MMP-2 mRNA levels in A549 cells. MMP-2 is a SMAD2-specific TGF
target gene and SMAD2 is not inhibited by IL1
/TAK1. These observations showed that IL-1
/TAK1 specifically targets SMAD3, an observation validated in transient transfection assays with different R-SMADs.
The proposed proinflammatory effect of this inhibitory interaction in terms of cell biological functions is in agreement with the phenotypes displayed by the SMAD2 and SMAD3 null mice. Targeted deletion of SMAD2 results in an early embryonic lethal phenotype, indicating that SMAD2 is critical for early embryonic development (Weinstein et al., 1998
). SMAD3-deficient mice, however, survive up to 18 mo and eventually die of opportunistic infections due to a compromised immune system (Datto et al., 1999
; Yang et al., 1999
).
Besides a difference in biological function between SMAD2 and SMAD3, these SMADs also differ in their MH1 and MH2 domains and bind to different cofactors involved in transcriptional regulation by SMADs. Immunoprecipitations using SMAD3 deletion constructs and transfection assays using SMAD23 chimeric constructs indicated that TAK1 binds the SMAD3-MH2 domain and that both the MH1 and MH2 domains are involved in TAK1 repression of SMAD3 activity. TAK1 also binds the SMAD2-MH2 domain (Benus and Eggen, unpublished data), but transfection data using SMAD2-3 chimeras indicated that a 3-3-2 chimera is less TAK1 sensitive than SMAD3, indicating a difference in the SMAD2 and SMAD3-MH2 domains in terms of TAK1 repression. The most prominent inhibitory effect of TAK1 on SMAD3 can be allocated to the MH1 domain, a 3-2-2 chimera is 3 times more sensitive to TAK1 than SMAD2 and only twofold less sensitive than SMAD3. The linker region of R-SMADs has previously been shown to be a target for the MAPK extracellular signal-regulated kinase (Erk) to inhibit nuclear translocation (Kretzschmar et al., 1997
, 1999
). The SMAD3 linker does not seem to be involved in mediating TAK1 sensitivity because a 3-3-2 chimera is equally sensitive to TAK1 as a 3-2-2 chimera (Figure 4).
Several SMAD3-specific cofactors have been identified that bind to the MH1 and MH2 domains of SMAD3 (ATF2, AP-1 members, TFE3, VDR, and Evi-1; Moustakas et al., 2001
), so it is possible that TAK1 perturbs the interaction with one of them by phosphorylating SMAD3 on a yet unknown residue(s). The hypothesis that TAK1 phosphorylates SMAD3 is supported by the observation that TAK1SMAD3 interaction is transient and that a catalytically inactive TAK1 (TAK1-K63W) acts as a dominant negative TAK1.
In addition to IL-1
, TAK1 also has been positioned downstream of TGF
and BMPs (Yamaguchi et al., 1995
; Shibuya et al., 1998
). In the experiments described here, TAK1 acts as an inhibitor of TGF
signaling (downstream of IL-1
) and does not affect SMAD-mediated BMP signaling. It remains unclear how these cytokines exert (some of) their different biological effects by using the same mediator, TAK1. It could be context dependent in the sense that not all required components to link the cytokine to TAK1 activation are present in all cells. Alternatively, it is possible that TAK1 is localized in distinct signalosomes, resulting in ligand-specific activation of TAK1. A further understanding of how TGF
signaling can both be partly mediated by TAK1 and also inhibited by TAK1 is at present unclear.
TAK1 has been positioned upstream of various MAPK cascades, but these seem not to be involved in IL-1
/TAK1-mediated inhibition of SMAD3-mediated TGF
signaling. Interference with MAPK signaling by means of overexpression of dominant negative MKKs or use of chemical inhibitors did not affect inhibition of SMAD3 signaling by TAK1 (our unpublished data), further indicating that the TGF
and IL-1
signaling cascades interact at the level of TAK1-SMAD3.
The direct interaction between the IL-1
and TGF
signaling cascades might have important biological implications, which is illustrated by the observation that IL-1
restores the proliferative potential of hematopoietic precursors in the presence of TGF
in an in vitro myeloid colony formation assay. Although the role of TAK1 and SMAD3 in these assays remained elusive, these experiments demonstrated a clear biological effect of cross-talk between the IL-1
and TGF
signaling cascades on the proliferative response of hematopoietic cells. In the microenvironment of the bone marrow stroma, variations in the local concentrations of cytokines that modulate progenitor cell renewal, proliferation, and differentiation determines the cellular response of these cells. IL-1
has been extensively studied as a cytokine leading to increased stem cell cycling, whereas TGF
inhibits stem cell cycling (Ruscetti et al., 1992
; Fortunel et al., 2000b
). The observation that these two pathways converge provides novel insight in the mechanism of integration of these positively and negatively instructive signaling cascades at the intracellular level. The balance between IL-1
and TGF
might act as a switch between a quiescent and cycling state of these cells. The observations that a loss of SMAD3-mediated TGF
signaling by AML-Evi-1 (Kurokawa et al., 1998
) or AML-ETO (Jakubowiak et al., 2000
) translocations contribute to leukemogenesis and that spontaneous IL-1
secretion is observed in AML (Dokter et al., 1995
) suggests that perturbations in the inhibitory interaction between the IL-1
and TGF
cascades might promote uncontrolled cellular proliferation or even malignant transformation.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Address correspondence to: Bart J.L. Eggen (b.j.l.eggen{at}rug.nl).
| REFERENCES |
|---|
|
|
|---|
/SMAD signaling by NF-
B/RelA. Genes Dev. 14, , 187197.Boer, P. H., Potten, H., Adra, C. N., Jardine, K., Mullhofer, G., and McBurney, M. W. ((1990). ). Polymorphisms in the coding and noncoding regions of murine Pgk-1 alleles. Biochem. Genet. 28, , 299308.[CrossRef][Medline]
Chantry, D., Turner, M., Abney, E., and Feldmann, M. ((1989). ). Modulation of cytokine production by transforming growth factor-
. J. Immunol. 142, , 42954300.[Abstract]
Datto, M. B., Frederick, J. P., Pan, L., Borton, A. J., Zhuang, Y., and Wang, X. F. ((1999). ). Targeted disruption of Smad3 reveals an essential role in transforming growth factor
-mediated signal transduction. Mol. Cell. Biol. 19, , 24952504.
de Caestecker, M. P., Parks, W. T., Frank, C. J., Castagnino, P., Bottaro, D. P., Roberts, A. B., and Lechleider, R. J. ((1998). ). Smad2 transduces common signals from receptor serine-threonine and tyrosine kinases. Genes Dev. 12, , 15871592.
Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. ((1983). ). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, , 14751489.
Dokter, W. H., Tuyt, L., Sierdsema, S. J., Esselink, M. T., and Vellenga, E. ((1995). ). The spontaneous expression of interleukin-1
and interleukin-6 is associated with spontaneous expression of AP-1 and NF-
B transcription factor in acute myeloblastic leukemia cells. Leukemia 9, , 425432.[Medline]
Espevik, T., Figari, I. S., Shalaby, M. R., Lackides, G. A., Lewis, G. D., Shepard, H. M., and Palladino, M. A. ((1987). ). Inhibition of cytokine production by cyclosporin A and transforming growth factor
. J. Exp. Med. 166, , 571576.
Fortunel, N., Hatzfeld, J., Kisselev, S., Monier, M. N., Ducos, K., Cardoso, A., Batard, P., and Hatzfeld, A. ((2000a). ). Release from quiescence of primitive human hematopoietic stem/progenitor cells by blocking their cell-surface TGF-
type II receptor in a short-term in vitro assay. Stem Cells 18, , 102111.
Fortunel, N. O., Hatzfeld, A., and Hatzfeld, J. A. ((2000b). ). Transforming growth factor-
: pleiotropic role in the regulation of hematopoiesis. Blood 96, , 20222036.
Hatzfeld, J., Li, M. L., Brown, E. L., Sookdeo, H., Levesque, J. P., O'Toole, T., Gurney, C., Clark, S. C., and Hatzfeld, A. ((1991). ). Release of early human hematopoietic progenitors from quiescence by antisense transforming growth factor
1 or Rb oligonucleotides. J. Exp. Med. 174, , 925929.
Jakubowiak, A., Pouponnot, C., Berguido, F., Frank, R., Mao, S., Massague, J., and Nimer, S. D. ((2000). ). Inhibition of the transforming growth factor
1 signaling pathway by the AML1/ETO leukemia-associated fusion protein. J. Biol. Chem. 275, , 4028240287.
Jiang, Z., Ninomiya-Tsuji, J., Qian, Y., Matsumoto, K., and Li, X. ((2002). ). Interleukin-1 (IL-1) receptor-associated kinase-dependent IL-1-induced signaling complexes phosphorylate TAK1 and TAB2 at the plasma membrane and activate TAK1 in the cytosol. Mol. Cell. Biol. 22, , 71587167.
Jonk, L. J., Itoh, S., Heldin, C. H., ten Dijke, P., and Kruijer, W. ((1998). ). Identification and functional characterization of a Smad binding element (SBE) in the JunB promoter that acts as a transforming growth factor-
, activin, and bone morphogenetic protein-inducible enhancer. J. Biol. Chem. 273, , 2114521152.
Keeton, M. R., Curriden, S. A., van Zonneveld, A. J., and Loskutoff, D. J. ((1991). ). Identification of regulatory sequences in the type 1 plasminogen activator inhibitor gene responsive to transforming growth factor
. J. Biol. Chem. 266, , 2304823052.
Korchynskyi, O., and ten Dijke, P. ((2002). ). Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter. J. Biol. Chem. 277, , 48834891.
Kretzschmar, M., Doody, J., and Massague, J. ((1997). ). Opposing BMP and epidermal growth factor signalling pathways converge on the TGF-
family mediator Smad1. Nature 389, , 618622.[CrossRef][Medline]
Kretzschmar, M., Doody, J., Timokhina, I., and Massague, J. ((1999). ). A mechanism of repression of TGF
/Smad signaling by oncogenic Ras. Genes Dev. 13, , 804816.
Kurokawa, M., Mitani, K., Imai, Y., Ogawa, S., Yazaki, Y., and Hirai, H. ((1998). ). The t(3;21) fusion product, AML1/Evi-1, interacts with Smad3 and blocks transforming growth factor
-mediated growth inhibition of myeloid cells. Blood 92, , 40034012.
Massague, J. ((1998). ). TGF-
signal transduction. Annu. Rev. Biochem. 67, , 753791, 753791.[CrossRef][Medline]
Moustakas, A., Souchelnytskyi, S., and Heldin, C. H. ((2001). ). Smad regulation in TGF-
signal transduction. J. Cell Sci. 114, , 43594369.
Ninomiya-Tsuji, J., Kishimoto, K., Hiyama, A., Inoue, J., Cao, Z., and Matsumoto, K. ((1999). ). The kinase TAK1 can activate the NIK-I
B as well as the MAP kinase cascade in the IL-1 signalling pathway. Nature 398, , 252256.[CrossRef][Medline]
O'Neill, L. ((2000). ). The Toll/interleukin-1 receptor domain: a molecular switch for inflammation and host defence. Biochem. Soc. Trans. 28, , 557563.[Medline]
Piek, E., Ju, W., Heyer, J., Escalante-Alcalde, D., Stewart, C. L., Weinstein, M., Deng, C., Kucherlapati, R., Boettinger, E. P., and Roberts, A. B. ((2001). ). Functional characterization of TGF-
signaling in Smad2- and Smad3-deficient fibroblasts. J. Biol. Chem. 276, , 1994519953.
Ruscetti, F. W., Dubois, C. M., Jacobsen, S. E., and Keller, J. R. ((1992). ). Transforming growth factor
and interleukin-1, a paradigm for opposing regulation of haemopoiesis. Baillieres Clin. Haematol. 5, , 703721.[Medline]
Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. ((1989). ). Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells. Nucleic Acids Res. 17, , 6419
Shibuya, H., Iwata, H., Masuyama, N., Gotoh, Y., Yamaguchi, K., Irie, K., Matsumoto, K., Nishida, E., and Ueno, N. ((1998). ). Role of TAK1 and TAB1 in BMP signaling in early Xenopus development. EMBO J. 17, , 10191028.[CrossRef][Medline]
Shibuya, H., Yamaguchi, K., Shirakabe, K., Tonegawa, A., Gotoh, Y., Ueno, N., Irie, K., Nishida, E., and Matsumoto, K. ((1996). ). TAB 1, an activator of the TAK1 MAPKKK in TGF-
signal transduction. Science 272, , 11791182.[Abstract]
Takaesu, G., Kishida, S., Hiyama, A., Yamaguchi, K., Shibuya, H., Irie, K., Ninomiya-Tsuji, J., and Matsumoto, K. ((2000). ). TAB2, a novel adaptor protein, mediates activation of TAK1 MAPKKK by linking TAK1 to TRAF6 in the IL-1 signal transduction pathway. Mol. Cell 5, , 649658.[CrossRef][Medline]
Topper, J. N., et al. ((1997). ). Vascular MADs: two novel MAD-related genes selectively inducible by flow in human vascular endothelium. Proc. Natl. Acad. Sci. USA 94, , 93149319.
Ulloa, L., Doody, J., and Massague, J. ((1999). ). Inhibition of transforming growth factor-
/SMAD signalling by the interferon-gamma/STAT pathway. Nature 397, , 710713.[CrossRef][Medline]
Vellenga, E., de Wolf, J. T., Beentjes, J. A., Esselink, M. T., Smit, J. W., and Halie, M. R. ((1990). ). Divergent effects of interleukin-4 (IL-4) on the granulocyte colony-stimulating factor and IL-3-supported myeloid colony formation from normal and leukemic bone marrow cells. Blood 75, , 633637.
Weinstein, M., Yang, X., Li, C., Xu, X., Gotay, J., and Deng, C. X. ((1998). ). Failure of egg cylinder elongation and mesoderm induction in mouse embryos lacking the tumor suppressor smad2. Proc. Natl. Acad. Sci. USA 95, , 93789383.
Wrana, J. L. ((2000). ). Crossing Smads. Sci. STKE. 2000, , RE1.
Yamaguchi, K., Shirakabe, K., Shibuya, H., Irie, K., Oishi, I., Ueno, N., Taniguchi, T., Nishida, E., and Matsumoto, K. ((1995). ). Identification of a member of the MAPKKK family as a potential mediator of TGF-
signal transduction. Science 270, , 20082011.
Yang, X., Letterio, J. J., Lechleider, R. J., Chen, L., Hayman, R., Gu, H., Roberts, A. B., and Deng, C. ((1999). ). Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-
. EMBO J. 18, , 12801291.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J.-H. Zhou, Y.-G. Jiang, R.-W. Wang, S.-Z. Fan, T.-Q. Gong, Q.-Y. Tan, Z. Ma, Y.-P. Zhao, and B. Deng Prevention of stricture development after corrosive esophageal burn with a modified esophageal stent in dogs. J. Thorac. Cardiovasc. Surg., November 1, 2008; 136(5): 1336 - 1342.e7. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Lu, L. Tian, Y. Han, M. Vogelbaum, and G. R. Stark Dose-dependent cross-talk between the transforming growth factor-beta and interleukin-1 signaling pathways PNAS, March 13, 2007; 104(11): 4365 - 4370. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Behfar, C. Perez-Terzic, R. S. Faustino, D. K. Arrell, D. M. Hodgson, S. Yamada, M. Puceat, N. Niederlander, A. E Alekseev, L. V. Zingman, et al. Cardiopoietic programming of embryonic stem cells for tumor-free heart repair J. Exp. Med., February 19, 2007; 204(2): 405 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Jadrich, M. B. O'Connor, and E. Coucouvanis The TGF{beta} activated kinase TAK1 regulates vascular development in vivo. Development, April 1, 2006; 133(8): 1529 - 1541. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||