![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 16, Issue 9, 4013-4023, September 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Biochemistry and Biophysics, Stockholm University, 10691 Stockholm, Sweden;
Department of Parasitology, Heidelberg University School of Medicine, 69120 Heidelberg, Germany
Submitted February 1, 2005;
Revised June 3, 2005;
Accepted June 9, 2005
Monitoring Editor: David Drubin
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Gliding motility and host cell entry are initiated by surface receptor binding to substrate or host cell ligands (Russell and Sinden, 1981). Backward distribution of the receptor–ligand complexes then propel the parasite forward and into the host cell (Kappe et al., 2003; Kappe et al., 2004; Sibley, 2004; Soldati and Meissner, 2004). Thus, rather than inducing endocytosis and hijacking the host cell's force transducing systems, apicomplexans actively cross cell barriers and translocate into the host cytoplasm under simultaneous formation of a replication-competent organelle, the parasitophorous vacuole.
Actin-dependent motility typically depends on the existence of polymers of actin (F-actin), either by interaction of F-actin with the motor protein myosin or through tightly regulated dynamic turnover of F-actin. Apicomplexan gliding motility and host cell invasion are inhibited by cytochalasins, suggesting that actin filaments of the parasite are required for these processes (Dobrowolski and Sibley, 1996). However, microfilaments cannot be visualized within the cytoplasm of parasites using either electron microscopy or fluorescent derivatives of the F-actin binding toxin phalloidin (Dobrowolski et al., 1997; Gantt et al., 2000), presumably because parasite microfilaments are very short (Schmitz et al., 2005). The cell-permeable drug jasplakinolide induced local filament formation at the apical ends of motile parasites, but it did not give rise to actin polymers within the parasite cytosol (Shaw and Tilney, 1999), suggesting the existence of a highly efficient monomer-sequestering mechanism.
Short microfilaments exist in the space between the parasite plasma membrane and the inner membrane complex, where they are thought to interact with transmembrane receptors on one hand and a myosin motor on the other hand (Kappe et al., 2004). The intrinsic properties of apicomplexan actin may partly explain the restricted turnover of these actin polymers, as recombinant Plasmodium actin forms polymers of low stability in vitro (Schüler et al., 2005). Localized and transient microfilament formation may be brought about by the action of actin monomer-binding proteins such as profilin, filament depolymerizing proteins such as ADF/cofilins, and filament nucleating and capping proteins (Pollard and Borisy, 2003). Several such proteins encoded by apicomplexan parasites have been identified and characterized (Allen et al., 1997; Tardieux et al., 1998a,b; Poupel et al., 2000; Matuschewski et al., 2002). Nevertheless, so far the unique turnover characteristics of microfilaments in apicomplexa have not been sufficiently explained.
The actin-depolymerizing factor (ADF)/cofilin family (AC proteins) are ubiquitous eukaryotic proteins that modulate the turnover of the microfilament system in vivo (reviewed in Bamburg, 1999; Carlier et al., 1999; Ono, 2003; Paavilainen et al., 2004). Although unicellular eukaryotes generally express one AC protein, multicellular organisms use several isoforms, some of which may be expressed in a tissue-specific manner. ADF/cofilins bind F-actin in a 1:1 stoichiometry per actin subunit, an interaction that drastically destabilizes the polymers (Carlier et al., 1997; McGough et al., 1997). The ADF/cofilin-induced acceleration of F-actin turnover is largely responsible for the rapid microfilament remodeling observed in vivo (Lappalainen and Drubin, 1997; Rosenblatt et al., 1997). AC proteins also bind monomeric actin (G-actin), thereby inhibiting nucleotide exchange and incorporation into F-actin. These activities are indispensable for the cell, because AC knockouts are not viable (Iida et al., 1993; McKim et al., 1994; Gunsalus et al., 1995) and tissue-specific cofilins are essential for morphogenesis (Gurniak et al., 2005).
The overall structure of ADF/cofilin proteins is a central mixed 
-sheet sandwiched in between short 
-helices, in most isoforms two on each side (Hatanaka et al., 1996; Fedorov et al., 1997; Leonard et al., 1997; Bowman et al., 2000; Pope et al., 2004). A comparison with other small actin binding proteins showed that a similar architecture is used for twinfilin and gelsolin subdomains (Hatanaka et al., 1996; Lappalainen et al., 1998; Paavilainen et al., 2002). The actin binding site in AC proteins involves a long, kinked -helix, and the specific F-actin binding residues are located to a central loop protruding from the -sheet as well as the C-terminal -helix (Yonezawa et al., 1989; Moriyama et al., 1992; Jiang et al., 1997; Lappalainen et al., 1997; Van Troys et al., 1997; Pope et al., 2000; Guan et al., 2002).
Here, we describe two ADF/cofilin isoforms from the genome of the malaria-causing protozoan Plasmodium falciparum. Both display a high degree of homology to known ADF/cofilin sequences. We show that ADF1 is essential for erythrocytic schizogony of the malaria parasite. The coding sequence for ADF1 was expressed in Escherichia coli, and the recombinant protein was purified. We describe a biochemical analysis of this protein, in comparison with Arabidopsis thaliana ADF1 and Saccharomyces cerevisiae cofilin. PfADF1 interacts with monomeric but not with filamentous actin. In addition, PfADF1 promotes nucleotide exchange on actin monomers and sequesters monomers inefficiently.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
PbADF1 Gene Targeting
For disruption of PbADF1, a 540-base pair fragment was amplified using primers ADF1for and ADF1rev1 using Plasmodium berghei genomic DNA as template. Cloning of this fragment into the P. berghei targeting vector that confers resistance to the antifolate pyrimethamine (Thathy and Menard, 2002) resulted in pINT. For the control integration construct, a 1115-base pairs fragment was amplified using primers ADF1for and ADF1rev2 (5'ATTTGCGGCCGCTTACGATTATCCTATTGGTTTATTC 3'; NotI site is underlined) and cloned into the targeting vector, resulting in pCONT. Transfection was done as described previously (Thathy and Menard, 2002) with 70 µg of XbaI-linearized plasmid and gradient-purified schizonts of the pyrimethamine-sensitive P. berghei strain NK65. Positive selection for stable integration was by daily injection of 25 mg/kg pyrimethamine. Resistant parasite populations were transferred to naive animals for propagation and genotyping. Genotyping was performed by integration-specific PCRs using primers ADF1test2 (5' TCAAAATGATAAGCGGTATTCGCG 3') and ADF1rev2 for the PbADF1 wild-type signal, and primers Tgfor (5' CCCGCACGGACGAATCCAGATGG 3') and ADF1rev2 for the INT disruptant locus. For the CONT control locus the primers Tgfor and ADF1test1 (5' GTGGAAATCGATATATGGATATAG 3') were used. The PbADF1 wild-type signal was detected through primers ADFtest2 and ADF1test1.
Cloning and Protein Purification
Poly(A)+ RNA was isolated from cultured P. falciparum mixed blood stages (strain HB3) using oligo(dT) columns (Invitrogen). The poly(A)+ RNA was used as a template for first-strand cDNA synthesis (Ambion). PfADF1 was amplified from this cDNA using sequence-specific primers (5' CGTGGATCCATAAGTGGTATTCGAGTTAATGAT 3' and 5' CCGCTCGAGTTATTTAAGATCAGCAACATCTTGT 3'; BamHI and XhoI sites are underlined). The S. cerevisiae cofilin expression vector was a gift from Pekka Lappalainen (Institute of Biotechnology, University of Helsinki, Helsinki, Finland).
PfADF1 and ScCof were expressed as glutathione S-transferase (GST)-fusion proteins using pGEX vectors (Amersham Biosciences, Piscataway, NJ). E. coli BL-21(DE-3)RIPL cells (Stratagene, La Jolla, CA) transformed with the expression constructs were grown to an OD600 of 0.7, and expression was induced with 0.1 mM isopropyl -D-thiogalactoside. Cells were harvested after 3 h of growth at 37°C, suspended in 20 mM Tris-HCl, pH 8.0, 50 mM NaCl containing 0.1 mM phenylmethylsulfonyl fluoride and Complete protease inhibitors (Roche Diagnostics, Indianapolis, IN), and lysed by freeze-thawing and sonication. The lysates were clarified by two 20-min centrifugations at 10, 000 and 50,000 x g, respectively, filtered, and applied to GSTrap columns (Amersham Biosciences). The columns were washed with 20 mM Tris-HCl, pH 8.0, 0.5 M NaCl before bound ADF or cofilin proteins were liberated from GST by cleavage with 20 U/ml thrombin overnight at room temperature, or with PreScission protease (Amersham Biosciences) according to the manufacturer's instructions. Contaminants were removed by passage over Q-Sepharose FF (Amersham Biosciences) in 20 mM HEPES, pH 7.1, 1 mM dithiothreitol (DTT). The material passing the Q-Sepharose was concentrated using Centricon devices (Millipore, Billerica, MA), snap-frozen in liquid N2, and stored at–80°C. The extinction coefficients for the unfolded proteins were calculated (Gill and von Hippel, 1989), and the extinction coefficients in buffer were determined as A280 = 0.68 mg–1ml–1 for PfADF1 and 0.97 mg–1ml–1 for ScCof.
A. thaliana ADF1 was expressed in E. coli BL-21(DE-3) and purified essentially as described previously (Carlier et al., 1997). Cytoplasmic -actin from bovine thymus was purified as described previously (Lindberg et al., 1988). Recombinant expression and purification of P. falciparum actin I was as described previously (Schüler et al., 2005).
Actin Binding of AC Proteins
The interaction of actin with the ADF/cofilin proteins was characterized at 25°C in 5 mM Tris-HCl, pH 7.6, 0.5 mM ATP, 0.1 mM CaCl2, 0.5 mM DTT (G-buffer), with the addition of 0.2 mM EGTA and 50 µM MgCl2 in the case of Mg2+-actin. Monomeric ADP-actin was made by changing to ATP-free G-buffer on PD-10 columns (Amersham Biosciences) and adding ADP to 0.5 mM. Polymerizing conditions were induced by addition of 1 mM MgCl2 + 0.1 M KCl to G-buffer.
Nucleotide Exchange
After addition of 1, N6-ethenoadenosine 5'-triphosphate (
ATP; Molecular Probes, Eugene, OR) to G-actin (8 µM; 7 µM in the case of PfAct1) in the absence of excess ATP, the fluorescence increase at >408 nm (excitation at 360 nm) was monitored. Observed rates were determined by curve fitting of the raw data to a first-order equation using MicroCal Origin (OriginLab, Northampton, MA).
Thermal Unfolding of Actin
Thermal stability of actin was assessed as described previously (Schüler et al., 2000). Briefly, actin solutions were incubated in a water bath, either at 50°C or at increasing temperatures at a heating rate of 40 K/h. At intervals, aliquots were removed from the sample and their content of native actin determined using the DNase I-inhibition assay (Blikstad et al., 1978).
Kinetics and Steady-State Levels of Polymerization
Filament formation was induced by addition of 1 mM MgCl2 + 0.1 M KCl, and monitored by the increase in fluorescence due to copolymerization of 2% pyrene-labeled bovine -actin (Kouyama and Mihashi, 1980).
Cosedimentation/Sequestering Assay
Samples of actin (8 µM) were induced to polymerize by addition of 1 mM MgCl2 + 0.1 M KCl in the presence of 0–24 µM ADF/cofilin proteins and incubated at room temperature for 6–8 h. After ultracentrifugation in a Beckman airfuge (30000 psi for 15 min), equal amounts of the supernatants and pellets were analyzed by SDS-PAGE. Coomassie-stained gels were scanned and bands quantified using Bio-Rad MultiImage equipment and QuantityOne software. Buffer conditions for the pH-dependence experiment were 10 mM Tris-HCl, 20 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 6.0, and 30 mM Tris-HCl, pH 8.5, respectively.
Electrophoresis
Denaturing gel electrophoresis was performed using NuPAGE 4–12% Bis-Tris gels and the MES buffer system (Invitrogen). For nondenaturing gel electrophoresis, actin-ADF mixtures were prepared in Mg-G-buffer containing 15% glycerol and either ADP or ATP and incubated for 15 min at 25°C. Mixtures were applied to gels containing 7.5% acrylamide, 80 mM Tris, pH 8.5, 50 µM MgCl2, 1 mM DTT, and 0.2 mM either ADP or ATP. Gels were mounted in Novex mini cells (Invitrogen) and run in 40 mM Tris, 30 mM Bicine, pH 8.5, 50 µM MgCl2, 1 mM DTT, and 0.2 mM either ADP or ATP at 5 W for 
2.5 h at 10°C. Incidentally, although these conditions were similar to those used by Chen et al. (2004), recombinant yeast cofilin migrated readily into our native gels, in contrast to observations by Chen et al. (2004).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
), we identified two sequences with ADF/cofilin homology, hereafter referred to as PfADF1 (PlasmoDB entry PFE0165w) and PfADF2 (PF13_0326). Sequence comparisons showed that both Plasmodium ADFs share roughly 20–30% identity with yeast, plant, and animal ADF/cofilins (Figure 1A). The PfADF1 gene encodes one of the shortest AC proteins known, a polypeptide of 122 residues, and the PfADF2 gene encodes a 143-amino acid protein.
|
|
-sheets 2 and 3 and between putative -sheets 4 and 5. In addition, the short C terminus may possibly not fold into an -helix, nor pack against the 4/5-loop (the F-loop) as in other ADF/cofilins. Yeast cofilin residues involved in actin binding have been identified by site-specific mutagenesis (Lappalainen et al., 1997) and synchrotron protein footprinting (Guan et al., 2002). Interestingly, the PfADF1 sequence diverges in positions shown to be specific for binding to filamentous actin (ScCof residues R80 in the F-loop and E134/R135/R138 in the C terminus), whereas retaining the general actin binding sequences (Figure 1B). In this respect, PfADF1 resembles the ADF isoform expressed by Toxoplasma (Allen et al., 1997) and the ADF homology domains of the G-actin binding protein twinfilin (Figure 1C). The second isoform, PfADF2, resembles conventional ADFs in placement and composition of key sequences.
|
Plasmodium ADF1 Plays an Essential Role during Erythrocytic Schizogony
To test whether Plasmodium ADF1 is an essential gene, we used reverse genetics in the rodent malaria model parasite P. berghei (Thathy and Menard, 2002). Using an integration strategy, we constructed a targeting vector (pINT) that, upon a single crossover event during homologous recombination, would disrupt the endogenous PbADF1 locus (Figure 3A). To control for gene targeting at the desired locus, we included an integration control plasmid (pCONT). After transfection the control plasmid results in a pseudodiploid allele with one functional PbADF1 copy (Figure 3A). As expected, the latter resulted in viable recombinant parasites after a single transfection attempt (Figure 3B). In marked contrast, disruption of the PbADF1 locus was not successful in four independent transfection attempts (Figure 3B). Together, these results indicate that ADF1 performs vital functions during asexual development of the malaria parasite.
Recombinant PfADF1 Binding to G-Actin
We expressed PfADF1 in E. coli and purified the protein using GST-affinity chromatography (Figure 4A). Most ADF/cofilins bind preferentially to ADP-bound monomeric actin (summarized in Chen et al., 2004) and raise the thermal stability of this otherwise unstable form of actin (Schüler, unpublished data). Therefore, as a test for actin binding activity of the recombinant PfADF1 protein, its effect on G-ADP-actin during heat denaturation was assessed. As illustrated in Figure 4, B and C, Arabidopsis ADF1 substantially stabilized monomeric ADP-actin against thermal unfolding. This was manifested by a shift of the midpoint of the thermal transitions (Tm) from 50.5 to 57°C for CaADP-actin and from 46.5 to 56°C for MgADP-actin. The Plasmodium ADF also stabilized monomeric actin, with a shift in Tm to 52°C for CaADP-actin and to 48.5°C for MgADP-actin (Figure 4, B and C). This PfADF1 effect was moderate but significant (Schüler et al., 2000). Thus, PfADF1 clearly interacted with monomeric actin.
|
). This allowed us to reconstitute homologous binding partners in the form of recombinant proteins. Here, the effects of Plasmodium ADF and yeast cofilin on the unfolding rates of MgADP-actins, incubated at a constant temperature of 50°C, were determined (Figure 5). A threefold molar excess of Plasmodium ADF slowed down denaturation of bovine -actin by a factor of two (unfolding rates of 0.23 and 0.12 min–1, respectively; Figure 5A), whereas yeast cofilin resulted in a fourfold slower unfolding (0.054 min–1). Recombinant Plasmodium MgADP-actin unfolded with the same kinetics as the bovine cytoplasmic isoform (unfolding rates of 0.25 and 0.23 min–1, respectively; Figure 5B and Schüler et al., 2005). Surprisingly, three-fold molar excess of Plasmodium ADF1 accelerated the unfolding of Plasmodim actin, whereas yeast cofilin had no effect.
|
), thereby accumulating pools of unpolymerized monomeric actin at sites of rapid filament disassembly. We used the fluorescence increase of ATP upon binding to actin to measure the effect of PfADF and ScCof on nucleotide exchange in -actin (Figure 6). Yeast cofilin inhibited nucleotide exchange on CaATP-actin as expected. PfADF1, however, accelerated the rate of nucleotide exchange on -actin in a concentration-dependent manner. This makes PfADF the first known member of ADF/cofilin proteins to accelerate rather than delay nucleotide exchange on actin monomers.
|
-actin (observed exchange rates of 1.88 x 10–3 and 1.18 x 10–3 s–1, respectively).
Using the AC protein-dependent effect on nucleotide exchange, we estimated the affinity of yeast cofilin for monomeric -actin to be 0.67 ± 0.07 µM, in good agreement with values determined with other isoforms (Hawkins et al., 1993; Hayden et al., 1993). Plasmodium ADF1 bound -actin with an apparent affinity of 10.7 ± 3.9 µM, in the range of the weakest actin affinities determined for AC proteins (Chen et al., 2004).
PfADF1 Binds Preferentially to Monomeric ADP-Actin
We studied the interaction of PfADF1 with monomeric -actin with either MgADP or MgATP bound. A gel shift assay (Figure 7) showed that although PfADF1 formed complexes with ATP-actin, the majority of actin monomers did not migrate as a complex (Figure 7A). In contrast, already at low concentrations PfADF shifted the migration of a considerable portion of ADP-actin monomers to the complex (Figure 7B). Yeast cofilin had a similar preference for ADP-bound actin monomers, although complex formation was efficient at lower ScCof concentrations compared with PfADF1, indicating that PfADF1 had a lower affinity for actin monomers than ScCof also under these conditions.
|
PfADF1 Does Not Modulate Actin Filament Formation In Vitro
AC proteins have several effects on actin polymers, all resulting in a faster turnover of microfilaments in the cell. ADF/cofilins can bind to actin filaments and promote their disassembly. ADF/cofilins probably also sever existing filaments, thereby promoting polymerization onto free filament ends. In addition, although increasing filament numbers, ADF/cofilins decrease the concentration of actin filaments by binding monomeric ADP-actin (Bamburg, 1999; Carlier et al., 1999). Alignments of Plasmodium ADF1 with sequences of other ADF/cofilins suggested that PfADF1 lacks the typical conserved F-actin binding sites (Figure 1). We studied the interaction of PfADF1 with actin under physiological salt conditions using either spectrofluorimetry of pyrene-labeled actin or sedimentation assays.
When MgCl2 and KCl at physiological concentrations were added to 8 µM monomeric -actin, polymer formation proceeded to completion within 10 min (Figure 8A). A two-fold molar excess of PfADF1 had no effect on these kinetics. Under the same conditions, AtADF1 accelerated filament formation dramatically, an effect which is often attributed to severing of existing polymers thus creating new polymerization nuclei (Du and Frieden, 1998). Additionally AtADF1 limited the level of steady-state fluorescence, indicating a lower steady-state concentration of F-actin by sequestering actin monomers.
|
). Here, it was interesting to see whether also Plasmodium ADF could stimulate polymerization of Plasmodium actin. However, a twofold molar excess of PfADF1 did not affect the pyrenyl signal in 4 µM Plasmodium actin, and actin polymer formation was not detected (Schüler, unpublished data). Thus, this corroborates our results established with bovine nonmuscle actin and suggests that the inability of PfADF1 to interfere with actin polymerization is not an artifact caused by combining heterologous binding partners.
For a more stringent measure of the ability of these ADF/cofilins to sequester monomeric actin under polymerizing conditions, serial dilutions of pyrene-labeled F-actin in the presence of either PfADF1 or AtADF1 were made and their fluorescence was determined (Figure 8B). This experiment showed that Plasmodium ADF1 (at either 4 or 8 µM) left both the steady-state pyrene fluorescence of F-actin and the critical concentration of actin polymerization virtually unaffected. On the other hand, Arabidopsis ADF1 (at either 2 or 3 µM) induced a considerable shift in the critical concentration of filament formation. We determined the dissociation constant for AtADF1 and actin to 0.34 ± 0.03 µM (n = 3), in good agreement with published values for AC proteins and skeletal muscle actin measured using the same method (Hawkins et al., 1993; Hayden et al., 1993; Carlier et al., 1997).
PfADF1 Does Not Bind to F-Actin
As a further means to assess the interactions between PfADF1 or yeast cofilin and actin, cosedimentation assays were used. Samples of actin at 8 µM were incubated under polymerizing conditions with increasing concentrations of either ScCof or PfADF1. High-speed supernatants and pellets were analyzed by SDS-PAGE. The amount of actin in the supernatants was only slightly affected by PfADF1 at a two- to threefold molar excess, suggesting a weak sequestering activity (Figure 9A). In contrast, ScCof efficiently sequestered actin already at an equimolar ratio. PfADF1 did not cosediment with actin polymers at any molar ratio (Figure 9B). ScCof cosedimented efficiently at low ratios, and when cofilin was added at a 3 M ratio, all F-actin in the pellet was cofilin decorated (Figure 9B). The ability of PfADF1 to sequester actin monomers was not affected by the state of the actin-bound nucleotide: when polymers were formed in the presence of ADP instead of ATP, PfADF1 did not significantly raise the concentration of actin in the supernatants (Schüler, unpublished data). In combination with its homologous binding partner, PfADF1 did not affect the low polymerizability of recombinant Plasmodium actin, and both PfAct1 and PfADF1 remained in the supernatants (Figure 9C).
|
The monomer sequestering and polymer cosedimentation activities of many AC proteins (especially from vertebrates) are known to vary with pH (Hawkins et al., 1993; Hayden et al., 1993). We tested whether PfADF1 would display the typical AC protein activities at either lower or higher pH compared with the conditions used above. As shown in Figure 9D, PfADF1 cosedimented neither at pH 6 nor at pH 8.5, and its sequestering activity was equally weak over this pH range. As expected (Du and Frieden, 1998), yeast cofilin was more efficient at sequestering actin monomers at the higher pH, whereas we did not observe a pH dependence in its F-actin binding activity.
A prominent effect of AC proteins on actin filaments is the 25-fold increase in off-rates at the minus end (Carlier et al., 1997). Therefore, it was important to study the turnover kinetics of actin filaments in the presence of Plasmodium ADF1. Yeast cofilin strongly accelerated the loss of ATP-actin subunits from the ends of filaments, whereas PfADF1 had no effect (Schüler, unpublished data).
In conclusion, our experimental results show that actin-depolymerizing factor-1 is an essential protein in pathogenic red blood cell stages of Plasmodium. Recombinant PfADF1 binds to actin monomers under low salt conditions but has only a slight sequestering effect under physiological salt conditions. Most importantly, PfADF1 does not interact with actin polymers.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
; Lappalainen and Drubin, 1997; Rosenblatt et al., 1997). However, our biochemical analysis revealed that the essential in vivo function for Plasmodium ADF1 is not filament depolymerization. Instead, PfADF1 interacts exclusively with monomeric actin. Sequence alignments of the apicomplexan ADFs and other AC family members provide a plausible explanation for this finding. The conserved general actin binding residues of AC proteins are retained in the PfADF1 sequence, whereas the actin polymer binding positions clearly diverge (Figure 1). Thus, we propose that the main function of PfADF1 is not the acceleration of micro-filament turnover through a direct interaction. This conclusion can likely be extended to ADF orthologues in Toxo-plasma and other apicomplexan parasites and functionally separates these proteins from previously known ADF/cofilins.
Apicomplexan ADF sequences resemble twinfilins in that both show similar deviations from the ADF homology consensus, which can explain their inability to bind actin polymers. However, PfADF1 and twinfilins do not share other prominent features in their sequences, such as the C-terminal extension that mediates twinfilin binding to capping protein (Falck et al., 2004). Thus, it seems unlikely that PfADF1 and twinfilin share their functions and regulatory mechanisms. An attractive hypothesis is that apicomplexan ADFs and twinfilins may share a common ancestor, namely, an AC protein with lost F-actin binding capacity. Twinfilin may have arisen by a gene duplication event from this ancestor protein. Indeed, the apicomplexan ADFs have been placed near the evolutional split of twinfilin from ADF/cofilins (Lappalainen et al., 1998).
We found some striking similarities between PfADF1 and profilins. Both proteins influence microfilament turnover without interacting with polymeric actin. Unexpectedly, PfADF1 seems to catalyze the conversion of ADP-actin monomers into readily polymerizable ATP-actin monomers, another feature shared with profilin. Possibly apicomplexan ADF is used as an additional, differentially regulated monomer sequesterer besides profilin, a function that may be needed for the unusual dynamics of actin filaments in the parasites (Sibley, 2004). However, we found PfADF1 to be an inefficient sequesterer. AC proteins, although inhibiting the regeneration of actin-bound nucleotide, increase the pool of polymerizable actin because they bind monomers with high off-rates (Carlier et al., 1999). Thus, provided that the kinetics of the interaction between PfADF1 and actin is fast, the major physiological effect of PfADF1 will most likely be the generation of rapidly polymerizable ATP-actin monomers.
The properties of PfADF1 are also reminiscent of CAP/Srv2 (cyclase-associated protein; Moriyama and Yahara, 2002a). Interestingly, Plasmodium contains a CAP-like protein (PlasmoDB entry PFA0260c) that is homologous to the C-terminal, actin binding domain of conventional CAP/Srv2 proteins, whereas lacking the N-terminal domain that mediates interaction with both adenylate cyclase and cofilin–actin complexes. The characterization of this protein and its relation to PfADF1 will be an important future goal.
F-actin severing activity of cofilin is essential for cell survival in yeast (Moriyama and Yahara, 2002b). However, the intrinsic instability of Plasmodium actin polymers (Schüler et al., 2005) may eliminate the need for both the F-actin severing and the depolymerizing activities of AC proteins. We propose that apicomplexan ADFs are promoters of actin dynamics like typical AC proteins, albeit acting only on monomeric actin.
Because interactions of physiological binding partners may differ somewhat from the interactions of heterologous partners, it seems likely that PfADF1 binds Plasmodium and bovine -actin differently. Yet, our results show that PfADF1 is unable to sever either -actin or Plasmodium actin polymers. We noted that PfADF1 stabilized -actin against thermal unfolding but destabilized recombinant Plasmodium actin. Plasmodium and bovine -actin may differ in their binding of nucleotide and divalent cation. This is indicated by the fact that Plasmodium actin exchanged nucleotide faster than bovine -actin (Figure 6). Because PfADF1 also stimulated nucleotide exchange, our results probably reflect differences in the PfADF1 effects on the actin-bound nucleotide, a strong determinant of the solution structure of actin (Schüler et al., 2000).
Many ADF/cofilins bind to actin in a pH-dependent manner (Hawkins et al., 1993; Hayden et al., 1993). The structural basis for this regulation may be shifts in the position of the F-site (Pope et al., 2004) and/or a pH-dependent conformational change in the actin molecule (Zimmerle and Frieden, 1988), which is recognized by AC proteins (Blondin et al., 2002). As shown here PfADF1, which lacks the F-site, is not pH dependent in its actin monomer binding activity. We conclude that pH-dependent changes in actin are either not involved in the regulation of AC binding to actin monomers or that PfADF1 is unable to react to such changes. AC proteins of most species are negatively regulated by phosphorylation (Morgan et al., 1993) on an N-terminal serine (Ser3 in vertebrates, Ser6 in plants). Although ADFs of api-complexan parasites preserve serines in the corresponding positions their genomes do not encode orthologues of all metazoan genes involved in regulation of this modification: LIM kinases and slingshot phosphatases (reviewed in Soosairajah et al., 2005) are lacking, whereas the phosphocofilin regulator 14-3-3
(Gohla and Bokoch, 2002) and the cofilin phosphatase chronophin (Gohla et al., 2004) seem to be represented in Plasmodium genome databases (Gardner et al., 2002). The ADF/cofilin family also is negatively regulated by phosphatidylinositol 4,5-bisphosphate binding (Yonezawa et al., 1990), providing a third means of regulation. The ability to turn off ADF/cofilin activity is essential for cell cycle progression in Xenopus oocytes (Abe et al., 1996). However, it is possible that quick down-regulation of ADF function (through local pH changes or phosphorylation) is dispensable in the absence of F-actin binding in apicomplexan ADFs. Clearly, final assignment of the cellular function of these proteins in the parasites will have to await our understanding of their regulation. Nonetheless, our study establishes that a member of the apicomplexan subfamily of actin-depolymerizing factors exerts its vital physiological function through binding to actin monomers.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Footnotes |
|---|
Abbreviations used: AC, ADF/cofilin; ADF, actin-depolymerizing factor.
Present address: Department of Medical Biochemistry and Biophysics, SGC, Karolinska Institutet, 17177 Stockholm, Sweden. 
Address correspondence to: Herwig Schüler (herwig.schuler{at}mbb.ki.se).
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Allen, M. L., Dobrowolski, J. M., Muller, H., Sibley, L. D., and Mansour, T. E. ((1997). ). Cloning and characterization of actin depolymerizing factor from Toxoplasma gondii. Mol. Biochem. Parasitol. 88, , 43–52.[CrossRef][Medline]
Bamburg, J. R. ((1999). ). Proteins of the ADF/cofilin family: essential regulators of actin dynamics. Annu. Rev. Cell Dev. Biol. 15, , 185–230.[CrossRef][Medline]
Blikstad, I., Markey, F., Carlsson, L., Persson, T., and Lindberg, U. ((1978). ). Selective assay of monomeric and filamentous actin in cell extracts, using inhibition of deoxyribonuclease I. Cell 15, , 935–943.[CrossRef][Medline]
Blondin, L., Sapountzi, V., Maciver, S. K., Lagarrigue, E., Benyamin, Y., and Roustan, C. ((2002). ). A structural basis for the pH-dependence of cofilin. F-actin interactions. Eur. J. Biochem. 269, , 4194–4201.[Medline]
Bowman, G. D., Nodelman, I. M., Hong, Y., Chua, N.-H., Lindberg, U., and Schutt, C. E. ((2000). ). A comparative structural analysis of the ADF/cofilin family. Proteins 41, , 374–384.[CrossRef][Medline]
Carlier, M. F., Laurent, V., Santolini, J., Melki, R., Didry, D., Xia, G. X., Hong, Y., Chua, N. H., and Pantaloni, D. ((1997). ). Actin depolymerizing factor (ADF/cofilin) enhances the rate of filament turnover: implication in actin-based motility. J. Cell Biol. 136, , 1307–1322.
Carlier, M. F., Ressad, F., and Pantaloni, D. ((1999). ). Control of actin dynamics in cell motility. Role of ADF/cofilin. J. Biol. Chem. 274, , 33827–33830.
Chen, H., Bernstein, B. W., Sneider, J. M., Boyle, J. A., Minamide, L. S., and Bamburg, J. R. ((2004). ). In vitro activity differences between proteins of the ADF/cofilin family define two distinct subgroups. Biochemistry 43, , 7127–7142.[CrossRef][Medline]
Dobrowolski, J. M., Niesman, I. R., and Sibley, L. D. ((1997). ). Actin in the parasite Toxoplasma gondii is encoded by a single copy gene, ACT1 and exists primarily in a globular form. Cell Motil. Cytoskeleton 37, , 253–262.[CrossRef][Medline]
Dobrowolski, J. M., and Sibley, L. D. ((1996). ). Toxoplasma invasion of mammalian cells is powered by the actin cytoskeleton of the parasite. Cell 84, , 933–939.[CrossRef][Medline]
Du, J., and Frieden, C. ((1998). ). Kinetic studies on the effect of yeast cofilin on yeast actin polymerization. Biochemistry 37, , 13276–13284.[CrossRef][Medline]
Falck, S., Paavilainen, V. O., Wear, M. A., Grossmann, J. G., Cooper, J. A., and Lappalainen, P. ((2004). ). Biological role and structural mechanism of twinfilin-capping protein interaction. EMBO J. 23, , 3010–3019.[CrossRef][Medline]
Fedorov, A. A., Lappalainen, P., Fedorov, E. V., Drubin, D. G., and Almo, S. C. ((1997). ). Structure determination of yeast cofilin. Nat. Struct. Biol. 4, , 366–369.[CrossRef][Medline]
Gantt, S., Persson, C., Rose, K., Birkett, A. J., Abagayan, R., and Nussenzweig, V. ((2000). ). Antibodies against thrombospondin-related anonymous protein do not inhibit Plasmodium sporozoite infectivity in vitro. Infect. Immun. 68, , 3667–3673.
Gardner, M. J., et al. ((2002). ). Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, , 498–511.[CrossRef][Medline]
Gill, S. C., and von Hippel, P. H. ((1989). ). Calculation of protein extinction coefficients from amino acid sequence data. Anal. Biochem. 182, , 319–326.[CrossRef][Medline]
Gohla, A., Birkenfeld, J., and Bokoch, G. M. ((2004). ). Chronophin, a novel HAD-type serine protein phosphatase, regulates cofilin-dependent actin dynamics. Nat. Cell Biol. 7, , 21–29.
Gohla, A., and Bokoch, G. M. ((2002). ). 14–3-3 regulates actin dynamics by stabilizing phosphorylated cofilin. Curr. Biol. 12, , 1704–1710.[CrossRef][Medline]
Guan, J. Q., Vorobiev, S., Almo, S. C., and Chance, M. R. ((2002). ). Mapping the G-actin binding surface of cofilin using synchrotron protein footprinting. Biochemistry 41, , 5765–5775.[CrossRef][Medline]
Gunsalus, K. C., Bonaccorsi, S., Williams, E., Verni, F., Gatti, M., and Goldberg, M. L. ((1995). ). Mutations in twinstar, a Drosophila gene encoding a cofilin/ADF homologue, result in defects in centrosome migration and cytokinesis. J. Cell Biol. 131, , 1243–1259.
Gurniak, C. B., Perlas, E., and Witke, W. ((2005). ). The actin depolymerizing factor n-cofilin is essential for neural tube morphogenesis and neural crest migration. Dev. Biol. 278, , 231–241.[CrossRef][Medline]
Hatanaka, H., Ogura, K., Moriyama, K., Ichikawa, S., Yahara, I., and Inagaki, F. ((1996). ). Tertiary structure of destrin and structural similarity between two actin-regulating protein families. Cell 85, , 1047–1055.[CrossRef][Medline]
Hawkins, M., Pope, B., Maciver, S. K., and Weeds, A. G. ((1993). ). Human actin depolymerizing factor mediates a pH-sensitive destruction of actin filaments. Biochemistry 32, , 9985–9993.[CrossRef][Medline]
Hayden, S. M., Miller, P. S., Brauweiler, A., and Bamburg, J. R. ((1993). ). Analysis of the interactions of actin depolymerizing factor with G- and F-actin. Biochemistry 32, , 9994–10004.[CrossRef][Medline]
Iida, K., Moriyama, K., Matsumoto, S., Kawasaki, H., Nishida, E., and Yahara, I. ((1993). ). Isolation of a yeast essential gene, COF1, that encodes a homologue of mammalian cofilin, a low-M(r) actin-binding and depolymerizing protein. Gene 124, , 115–120.[CrossRef][Medline]
Jiang, C. J., Weeds, A. G., Khan, S., and Hussey, P. J. ((1997). ). F-actin and G-actin binding are uncoupled by mutation of conserved tyrosine residues in maize actin depolymerizing factor (ZmADF). Proc. Natl. Acad. Sci. USA 94, , 9973–9978.
Kappe, S. H., Buscaglia, C. A., Bergman, L. W., Coppens, I., and Nussenzweig, V. ((2004). ). Apicomplexan gliding motility and host cell invasion: overhauling the motor model. Trends Parasitol. 20, , 13–16.[CrossRef][Medline]
Kappe, S. H., Kaiser, K., and Matuschewski, K. ((2003). ). The Plasmodium sporozoite journey: a rite of passage. Trends Parasitol. 19, , 135–143.[CrossRef][Medline]
Kouyama, T., and Mihashi, K. ((1980). ). Pulse-fluorometry study on actin and heavy meromyosin using F-actin labelled with N-(1-pyrene)maleimide. Eur. J. Biochem. 105, , 279–287.[Medline]
Lappalainen, P., and Drubin, D. G. ((1997). ). Cofilin promotes rapid actin filament turnover in vivo. Nature 388, , 78–82.[CrossRef][Medline]
Lappalainen, P., Fedorov, E. V., Fedorov, A. A., Almo, S. C., and Drubin, D. G. ((1997). ). Essential functions and actin-binding surfaces of yeast cofilin revealed by systematic mutagenesis. EMBO J. 16, , 5520–5530.[CrossRef][Medline]
Lappalainen, P., Kessels, M. M., Cope, M. J., and Drubin, D. G. ((1998). ). The ADF homology (ADF-H) domain: a highly exploited actin-binding module. Mol. Biol. Cell 9, , 1951–1959.
Leonard, S. A., Gittis, A. G., Petrella, E. C., Pollard, T. D., and Lattman, E. E. ((1997). ). Crystal structure of the actin-binding protein actophorin from Acanthamoeba. Nat. Struct. Biol. 4, , 369–373.[CrossRef][Medline]
Lindberg, U., Schutt, C. E., Hellsten, E., Tjader, A. C., and Hult, T. ((1988). ). The use of poly(L-proline)-Sepharose in the isolation of profilin and profilactin complexes. Biochim. Biophys. Acta 967, , 391–400.[Medline]
Matuschewski, K., Ross, J., Brown, S. M., Kaiser, K., Nussenzweig, V., and Kappe, S. H. ((2002). ). Infectivity-associated changes in the transcriptional repertoire of the malaria parasite sporozoite stage. J. Biol. Chem. 277, , 41948–41953.
McGough, A., Pope, B., Chiu, W., and Weeds, A. ((1997). ). Cofilin changes the twist of F-actin: implications for actin filament dynamics and cellular function. J. Cell Biol. 138, , 771–781.
McKim, K. S., Matheson, C., Marra, M. A., Wakarchuk, M. F., and Baillie, D. L. ((1994). ). The Caenorhabditis elegans unc-60 gene encodes proteins homologous to a family of actin-binding proteins. Mol. Gen. Genet. 242, , 346–357.[CrossRef][Medline]
Morgan, T. E., Lockerbie, R. O., Minamide, L. S., Browning, M. D., and Bamburg, J. R. ((1993). ). Isolation and characterization of a regulated form of actin depolymerizing factor. J. Cell Biol. 122, , 623–633.
Moriyama, K., and Yahara, I. ((2002a). ). Human CAP1 is a key factor for the recycling of cofilin and actin for rapid actin turnover. J. Cell Sci. 115, , 1591–1601.
Moriyama, K., and Yahara, I. ((2002b). ). The actin-severing activity of cofilin is exerted by the interplay of three distinct sites on cofilin and essential for cell viability. Biochem. J. 365, , 147–155.[CrossRef][Medline]
Moriyama, K., Yonezawa, N., Sakai, H., Yahara, I., and Nishida, E. ((1992). ). Mutational analysis of an actin-binding site of cofilin and characterization of chimeric proteins between cofilin and destrin. J. Biol. Chem. 267, , 7240–7244.
Nishida, E. ((1985). ). Opposite effects of cofilin and profilin from porcine brain on rate of exchange of actin-bound adenosine 5'-triphosphate. Biochemistry 24, , 1160–1164.[CrossRef][Medline]
Ono, S. ((2003). ). Regulation of actin filament dynamics by actin depolymerizing factor/cofilin and actin-interacting protein 1, new blades for twisted filaments. Biochemistry 42, , 13363–13370.[CrossRef][Medline]
Paavilainen, V. O., Merckel, M. C., Falck, S., Ojala, P. J., Pohl, E., Wilmanns, M., and Lappalainen, P. ((2002). ). Structural conservation between the actin monomer-binding sites of twinfilin and actin-deploymerizing factor (ADF)/cofilin. J. Biol. Chem. 277, , 43089–43095.
Paavilainen, V. O., Bertling, E., Falck, S., and Lappalainen, P. ((2004). ). Regulation of cytoskeletal dynamics by actin-monomer-binding proteins. Trends Cell Biol. 14, , 386–394.[CrossRef][Medline]
Pollard, T. D., and Borisy, G. G. ((2003). ). Cellular motility driven by assembly and disassembly of actin filaments. Cell 112, , 453–465.[CrossRef][Medline]
Pope, B. J., Gonsior, S. M., Yeoh, S., McGough, A., and Weeds, A. G. ((2000). ). Uncoupling actin filament fragmentation by cofilin from increased subunit turnover. J. Mol. Biol. 298, , 649–661.[CrossRef][Medline]
Pope, B. J., Zierler-Gould, K. M., Kuhne, R., Weeds, A. G., and Ball, L. J. ((2004). ). Solution structure of human cofilin: actin binding, pH sensitivity, and relationship to actin-depolymerizing factor. J. Biol. Chem. 279, , 4840–4848.
Poupel, O., Boleti, H., Axisa, S., Couture-Tosi, E., and Tardieux, I. ((2000). ). Toxofilin, a novel actin-binding protein from Toxoplasma gondii, sequesters actin monomers and caps actin filaments. Mol. Biol. Cell 11, , 355–368.
Rosenblatt, J., Agnew, B. J., Abe, H., Bamburg, J. R., and Mitchison, T. J. ((1997). ). Xenopus actin depolymerizing factor/cofilin (XAC) is responsible for the turnover of actin filaments in Listeria monocytogenes tails. J. Cell Biol. 136, , 1323–1332.
Russell, D. G., and Sinden, R. E. ((1981). ). The role of the cytoskeleton in the motility of coccidian sporozoites. J. Cell Sci. 50, , 345–359.[Abstract]
Schmitz, S., Grainger, M., Howell, S., Calder, L. J., Gaeb, M., Pinder, J. C., Holder, A. A., and Veigel, C. ((2005). ). Malaria parasite actin filaments are very short. J. Mol. Biol. 349, , 113–125.[CrossRef][Medline]
Schüler, H., Lindberg, U., Schutt, C. E., and Karlsson, R. ((2000). ). Thermal unfolding of G-actin monitored with the DNase I-inhibition assay: stabilities of actin isoforms. Eur. J. Biochem. 267, , 476–486.[Medline]
Schüler, H., Mueller, A. K., and Matuschewski, K. ((2005). ). Unusual properties of Plasmodium falciparum actin: new insights into microfilament dynamics of apicomplexan parasites. FEBS Lett. 579, , 655–660.[CrossRef][Medline]
Shaw, M. K., and Tilney, L. G. ((1999). ). Induction of an acrosomal process in Toxoplasma gondii: visualization of actin filaments in a protozoan parasite. Proc. Natl. Acad. Sci. USA 96, , 9095–9099.
Sibley, L. D. ((2004). ). Intracellular parasite invasion strategies. Science 304, , 248–253.
Soldati, D., and Meissner, M. ((2004). ). Toxoplasma as a novel system for motility. Curr. Opin. Cell Biol. 16, , 32–40.[CrossRef][Medline]
Soosairajah, J., Maiti, S., Wiggan, O., Sarmiere, P., Moussi, N., Sarcevic, B., Sampath, R., Bamburg, J. R., and Bernard, O. ((2005). ). Interplay between components of a novel LIM kinase-slingshot phosphatase complex regulates cofilin. EMBO J. 24, , 473–486.[CrossRef][Medline]
Tardieux, I., Baines, I., Mossakowska, M., and Ward, G. E. ((1998a). ). Actin-binding proteins of invasive malaria parasites and the regulation of actin polymerization by a complex of 32/34-kDa proteins associated with heat shock protein 70kDa. Mol. Biochem. Parasitol. 93, , 295–308.[CrossRef][Medline]
Tardieux, I., Liu, X., Poupel, O., Parzy, D., Dehoux, P., and Langsley, G. ((1998b). ). A Plasmodium falciparum novel gene encoding a coronin-like protein which associates with actin filaments. FEBS Lett. 441, , 251–256.[CrossRef][Medline]
Thathy, V., and Menard, R. ((2002). ). Gene targeting in Plasmodium berghei. Meth. Mol. Med. 72, , 317–331.
Van Troys, M., Dewitte, D., Verschelde, J. L., Goethals, M., Vandekerckhove, J., and Ampe, C. ((1997). ). Analogous F-actin binding by cofilin and gelsolin segment 2 substantiates their structural relationship. J. Biol. Chem. 272, , 32750–32758.
Yonezawa, N., Nishida, E., Iida, K., Yahara, I., and Sakai, H. ((1990). ). Inhibition of the interactions of cofilin, destrin, and deoxyribonuclease I with actin by phosphoinositides. J. Biol. Chem. 265, , 8382–8386.
Yonezawa, N., Nishida, E., Ohba, M., Seki, M., Kumagai, H., and Sakai, H. ((1989). ). An actin-interacting heptapeptide in the cofilin sequence. Eur. J. Biochem. 183, , 235–238.[Medline]
Zimmerle, C. T., and Frieden, C. ((1988). ). Effect of pH on the mechanism of actin polymerization. Biochemistry 27, , 7766–7772.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  J. Bosch, C. A. Buscaglia, B. Krumm, B. P. Ingason, R. Lucas, C. Roach, T. Cardozo, V. Nussenzweig, and W. G. J. Hol Aldolase provides an unusual binding site for thrombospondin-related anonymous protein in the invasion machinery of the malaria parasite PNAS, April 24, 2007; 104(17): 7015 - 7020. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
