Originally published as MBC in Press, 10.1091/mbc.E05-01-0028 on June 15, 2005
Vol. 16, Issue 9, 4046-4060, September 2005
Genetic, Genomic, and Functional Analysis of the Granule Lattice Proteins in Tetrahymena Secretory Granules
Andrew T. Cowan * 
,
Grant R. Bowman * ,
Kyle F. Edwards *,
J. J. Emerson 
, and
Aaron P. Turkewitz *
* Department of Molecular Genetics and Cell Biology, The University of Chicago, Chicago, IL 60637;
Department of Ecology and Evolution, The University of Chicago, Chicago, IL 60637
Submitted January 18, 2005;
Revised April 27, 2005;
Accepted June 3, 2005
Monitoring Editor: Randy Schekman
 |
ABSTRACT
|
|---|
In some cells, the polypeptides stored in dense core secretory granules condense as ordered arrays. In ciliates such as Tetrahymena thermophila, the resulting crystals function as projectiles, expanding upon exocytosis. Isolation of granule contents previously defined five Granule lattice (Grl) proteins as abundant core constituents, whereas a functional screen identified a sixth family member. We have now expanded this screen to identify the nonredundant components required for projectile assembly. The results, further supported by gene disruption experiments, indicate that six Grl proteins define the core structure. Both in vivo and in vitro data indicate that core assembly begins in the endoplasmic reticulum with formation of specific hetero-oligomeric Grl proprotein complexes. Four additional GRL-like genes were found in the T. thermophila genome. Grl2p and Grl6p are targeted to granules, but the transcripts are present at low levels and neither is essential for core assembly. The 
GRL6 cells nonetheless showed a subtle change in granule morphology and a marked reduction in granule accumulation. Epistasis analysis suggests this results from accelerated loss of GRL6 granules, rather than from decreased synthesis. Our results not only provide insight into the organization of Grl-based granule cores but also imply that the functions of Grl proteins extend beyond core assembly.
|
INTRODUCTION
|
|---|
Dense core granules (DCGs) are vesicles specialized for storage of highly concentrated proteins, which can be secreted via exocytic fusion with the plasma membrane in response to extracellular stimuli (Arvan and Castle, 1992
; Arvan and Castle, 1998). The cargo itself, rather than functioning as a mere passenger in this pathway, seems to play a central role in driving granule formation (Arvan et al., 2002). The mechanisms involved may involve biophysical properties of DCG proteins, including reversible aggregation in response to changes in the ionic composition between successive compartments of the secretory pathway (Chanat and Huttner, 1991). In addition to such conditional solubility, some DCG cargo proteins may interact with the lipid bilayer in noncanonical ways that also may be important for sorting (Dhanvantari and Loh, 2000; Tooze et al., 2001). For these reasons, simply identifying the DCG cargo is an important first step in analyzing granule biogenesis in any specific cell type.
An additional motivation for defining granule cargo exists in the ciliates, single-celled protists that as a group synthesize a variety of DCGs (Rosati and Modeo, 2003). DCG formation in ciliates involves the organization of lumenal cargo proteins as large crystals, which have the remarkable property of undergoing spring-like expansion upon exocytosis in a way that ensures rapid content release (Hausmann, 1978). The assembly of such reproducible crystalline structures within the secretory pathway poses interesting regulatory questions, for example, with regard to nucleation and size control. Molecular analysis of DCGs in ciliates has been chiefly limited to two organisms, Tetrahymena thermophila and Paramecium tetraurelia (Vayssie et al., 2000; Turkewitz, 2004). In the latter, biochemical isolation of granules and protein microsequencing led to cloning of the trichocyst matrix proteins (tmps). These fell into three families that together may include >100 members and that may all adopt a similar overall structure (Madeddu et al., 1995; Gautier et al., 1996). Localization and gene silencing studies provided evidence that Paramecium granule cores were multilayered constructs in which distinct tmp families independently assembled into concentric zones (Vayssie et al., 2001). For example, cells in which the T1 tmp family members were silenced still formed an ordered, central core plug, but they lacked the overlying structure found in wild-type granules.
DCGs in Tetrahymena seem morphologically and chemically less complex than those in Paramecium. The tmp homologues in T. thermophila were named granule lattice (Grl) proteins, and five members were initially identified starting with isolation of the most abundant DCG contents (Chilcoat et al., 1996). Biochemical analysis of Grl1p indicated that conformational changes could underlie the crystalline expansion noted above, whereas gene disruption suggested that Grl1p itself might be present throughout the entire core, because no visibly ordered structure was formed in its absence (Verbsky and Turkewitz, 1998). Granules formed in such GRL1 cells did not undergo rapid expansion upon exocytosis (Chilcoat et al., 1996). This defect, due to the absence of a single granule protein, facilitated an entirely different approach to identifying granule contents based on screening for exocytosis-defective mutants among cells transformed with an antisense library, a technique allowing phenotype-based gene cloning in this organism (Sweeney et al., 1996). This identified a sixth family member, initially called NDC1 (for nondischarge) but here renamed GRL8 for simplicity (Chilcoat et al., 2001). Granules lacking Grl8p, like those lacking Grl1p, had no discernibly organized structure. The tmp/Grl family of proteins have no identified homologues outside of ciliates, but they are nonetheless similar to abundant dense core granule proteins in animal cells, called chromogranins, in having a preponderance of acidic amino acids, which endow them with the capacity to bind calcium (Chanat et al., 1991).
In the work presented here, we have extended the initial genetic screening to ask whether other genes were required for core formation. The results provided strong evidence that the family of six Grl proteins represents the essential structural core components in this organism. At the same time, searching the T. thermophila macronuclear genome revealed four additional paralogs, named GRL2, 6, 9, and 10. We have undertaken functional analysis of a large subset of the GRL family. The results confirm that six GRL genes (GRL1, 3, 4, 5, 7, and 8) each play a nonredundant role in core formation. The assembly defects associated with individual disruption of GRL1, 3, 4, 7, and 8 are similar, suggesting that each may contribute to a common structural unit. In support of this, we present evidence that some Grl proteins assemble into hetero-oligomeric complexes in the endoplasmic reticulum (ER) and that assembly may be required for ER exit. The products of GRL2 and 6 are much less abundant and not essential for lattice formation. Nonetheless, disruption of GRL6 had effects on both granule morphology and number, indicating a novel role for this gene product.
|
MATERIALS AND METHODS
|
|---|
Cell Strains and Culture
Strain CU428.1, MPRR/MPRR (6-methylpurine-sensitive, VII) bears a dominant allele conferring 6-methylpurine resistance in the micronucleus and the corresponding sensitive allele in the macronucleus; strain B2086, mprS/mprS (6-methylpurine-sensitive, II) has the drug-sensitive allele in both nuclei. Both were provided by Peter Bruns (Cornell University, Ithaca, NY). Cells were grown at 30°C with agitation in 2% proteose peptone, 0.2% yeast extract (both from Difco, Detroit, MI), with 0.009% ferric EDTA. For viewing of green fluorescent protein (GFP)-tagged proteins, cells were grown in 0.2% yeast extract with 0.009% ferric EDTA, to reduce autofluorescence. Unless stated otherwise, reagents were obtained from Sigma-Aldrich (St. Louis, MO).
Gene Disruption
Genes were disrupted by first using a selectable marker to replace a large region of a cloned copy. The marker consisted of the NEO gene on an autonomous expression cassette (Gaertig et al., 1994). The cloned interrupted copy was then introduced into Tetrahymena, to integrate via homologous recombination. GRL3 was disrupted by replacement by the NEO2 cassette of the sequences –154 to 1526 (these junctions determined by convenient restriction sites) relative to the start codon. Similarly, GRL4 was disrupted by replacement of the sequences –310 to 727 with NEO2. GRL7 was disrupted by replacement of the sequences 1–2402 with a similar cassette, MTT-NEO. The difference between NEO2 and MTT-NEO is that the former uses a histone H4 promoter, whereas the latter uses an inducible metallothionein (MTT1) promoter, to drive expression of the gene responsible for drug resistance (Shang et al., 2002). Disruptions were accomplished by biolistic transformation of CU428.1, as described previously (Chilcoat et al., 1996). Initial drug selection was with 120 µg/ml paromomycin, added 6 h after transformation. Cells transformed with the GRL7 disruption construct were grown in 0.5 µg/ml CdCl2 immediately after transformation and during the entire period of drug selection to induce the MTT1 promoter. Because only some of the macronuclear copies of the target gene are replaced initially, cells were cultured with increasing concentrations of paromomycin (up to 800 µg/ml) and allowed to grow for >60 generations for stringent selection of the disrupted allele.
Western Blotting
To make whole cell lysates, 
8 x 105 cells were pelleted for 30 s in a clinical centrifuge and reduced to a volume of 250 µl before adding an equal volume of 100°C 2 x SDS-PAGE sample buffer (final concentration 100 mM sucrose, 3% SDS, 2 mM Na2EDTA, and 62.5 mM Tris, pH 6.9) and boiled for 3 min. For Western blots, 12 µl of lysate was electrophoresed using SDS-PAGE and transferred to 0.45-µm nitrocellulose (Osmonics, Westborough, MA). Immunoblots with polyclonal antisera were blocked, probed, and washed with 5% milk in tris-buffered saline (TBS). The anti-Grl1p, anti-Grl3p, anti-Grl4p, and anti-Grl8p antibodies were used at 1:1000, 1:400, 1:250, and 1:1500, respectively. Detection of primary antibodies was with horseradish peroxidase-conjugated goat anti-rabbit antibody at 1:2000 (Jackson ImmunoResearch Laboratories, West Grove, PA); blots were developed with Pierce Supersignal (Pierce Chemical, Rockford, IL) and exposed to film.
Immunofluorescence and Microscopy
Fixation and immunolabeling using monoclonal antibody (mAb) 5E9 were as in Bowman and Turkewitz (2001) with two exceptions: the entire procedure was done at room temperature, and the primary incubation was with a 20% (vol/vol) solution of 5E9 hybridoma supernatant. Immunolabeling with 4D11 was as described previously (Bowman and Turkewitz, 2001). 4D11 and 5E9 were the gift of Marlo Nelson and Joseph Frankel (University of Iowa) and recognize p80 and Grl3p, respectively (Turkewitz and Kelly, 1992; Bowman et al., 2005). For live cell microscopy, cells were immobilized in 1% (vol/vol) methyl cellulose (Carolina Biological, Burlington, NC). Samples were viewed under a Zeiss Axiovert microscope interfaced with a Zeiss LSM 510 confocal laser system and software.
Flow Cytometry
Granule content of wild-type and GRL6 lines were analyzed by flow cytometry. For these experiments, cells (1.5 x 105/sample) from stationary phase (grown overnight, to 106/ml) or overnight starved cultures were fixed with paraformaldehyde, permeabilized with Triton X-100, and immunostained in 1% bovine serum albumin in TBS, as described above. Cells were incubated with saturating concentrations (1:3 dilution of in vitro hybridoma culture supernatant, to a total volume of 0.4 ml) of either mAb 4D11 or 5E9. After washing, cells were suspended in 200 µl with 1% fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Molecular Probes, Eugene, OR), an amount that was also found empirically to be saturating. Negative controls had no primary antibody. Cells were analyzed on an LSR II flow cytometer (BD Biosciences, San Jose CA) using FACSDiVa software. Excitation was done using a 488-nm solid state Sapphire Laser (Coherent, Santa Clara, CA), and the collection filter was a 530/30 band pass filter.
RNA Isolation, In Vitro Transcription, and Northern Blotting
CU428.1 RNA was isolated from exponentially growing cultures or from cells starved in a one-tenth dilution of Dryl's (1.7 mM sodium citrate, 1 mM NaH2PO4, 1.5 mM CaCl2) supplemented with an additional 0.1 mM MgCl2 and 0.5 mM CaCl2 (DMC) for 6 h by using the RNeasy kit (QIAGEN, Valencia, CA). For in vitro transcription reactions, template open reading frames (ORFs) were each amplified from a cDNA library using the following primer pairs: GRL1, 5'-ATGAATAAGAAATTATTAGTTGTCCTTTT-3' and 5'-TCAGTTAATGAAGTCAATATTGGG-3'; GRL2, 5'-ATGCGCTTAACTGTTATTGTCAC-3' and 5'-TCAGAATCCACCAGAACTAGCA-3'; GRL6, 5'-ATGAAAATAATTATTATTTTTTTAGCCTC-3' and 5'-TCATTGGGATTATTCGTCTGAT-3'; and GRL7, 5'-ATGAGAAAAGTCTTCGTTGCTT-3' and 5'-TCAAGCGCTTTCAGCACTT-3'. The PCR products were directionally cloned into pCRII (Invitrogen, Carlsbad, CA), and the resulting plasmids were linearized for run-off transcription with SP6 (sense) or T7 (antisense) RNA polymerase (Fermentas, Hanover, MD). These transcription products were ethanol precipitated and quantified for use as standards (sense) or as probe templates (antisense). RNA electrophoresis and Northern blotting were performed as per Farrell (1993). After electrophoresis on 1% agarose gels with formaldehyde, RNA was transferred and UV cross-linked to Magna (MSI, Westboro, MA) nylon membranes. Blots were visualized using a PhosphorImager (Amersham Biosciences, Sunnyvale, CA).
Construction of Antisense Libraries
Three antisense libraries were used in this screen. They were constructed using a PCR-based protocol, with one of two cDNA libraries as template. The first antisense library was constructed from the cDNA library described in Chilcoat et al. (2001). After digestion of the cDNA library with SacI and XhoI (to excise it from its pBluescriptvector backbone), we executed a single cycle of PCR with the primer 5'-TGCTAGCCACGGTCCGAGCGGGTACCNNNNNN-3'. The six random nucleotides at the 3' end of this primer allowed it to anneal randomly within the library inserts, producing truncated copies with an added KpnI site. PCR conditions for this step were 95°C, 3:00; 15°C, 0:30; 70°C, 0:30; and 95°C, 2:00. The product of this reaction was diluted 10-fold and used as template with primers 5'-TGCTAGCCACGGTCCGAGCG-3' (contained within the above-mentioned primer) and 5'-biotin/ACCGCGGTGGCGGCCGCTCTA-3' (containing a NotI site, and complementary to the vector backbone adjacent to the 5' ends of the cDNA inserts). PCR conditions for this step were 95°C, 2:00; 25 cycles of (95°C, 0:45; 53°C, 0:30; 70°C, 0:30); and 70°C, 10:00. After addition of fresh reagents and another cycle of PCR (95°C, 3:00; 50°C, 1:00; and 72°C, 3:00), the final PCR product was digested with KpnI before binding on a streptavidin plate (Pierce Chemical). After washing off unbound products, antisense inserts were eluted by digestion with NotI. After ethanol precipitation, the inserts were ligated into the ribosomal antisense vector 5318DNmod (Chilcoat et al., 2001). The cDNA library used as template for the second and third antisense libraries was constructed using the Creator SMART cDNA Library Construction Kit (BD Biosciences Clontech, Palo Alto, CA). Predigestion was with SmaI and XhoIor EcoRI, XhoI, NotI, ClaI, and AscI to excise the inserts from their pDNRlib vector backbone. PCR reactions were as described above, except that the biotinylated primer used was 5'-biotin/ATGCTCAGATCTATTGCATAGCGGCCGCAATTCGGCCATTACGGCCGGG-3'.
View larger version (24K):
[in this window]
[in a new window]
|
Figure 1. Whole cell PCR analysis of antisense transformants defective in capsule formation. (A) Schematic of the segment of the antisense library vector 5318Dnmod5 that flanks the antisense cloning site. Vector primers 5318f1 and 5318r2 (labeled F and R, respectively) were used to amplify antisense inserts with flanking vector sequence. (B) Representative 4% agarose gel of whole cell PCR reactions. Each lane represents the products of a single clone, the majority of which show more than one amplified insert.
|
|
Transformation with Antisense Libraries and Screening
Mating pairs of B2086 and CU428.1 were transformed by electroporation using the ECM 600 (BTX, San Diego, CA) as described previously (Gaertig and Gorovsky, 1995). Initial drug selection was with 100 µg/ml paromomycin, added 16–24 h after transformation. After 3 d at 30°C, the transformants were screened to enrich for those with defects in exocytosis, as follows. After starvation overnight in DMC at 22°C, 50 ml of cells (at a density of 1 x 106cells/ml) was stimulated with one-fourth volume of 0.1% Alcian Blue 8GX, added forcefully via syringe; after 30 s, an equal volume of 2% proteose peptone was added, and the cells were transferred to two 50-ml clear conical centrifuge tubes (Nalgene, Rochester, NY). The cells were pelleted in a clinical centrifuge for 1 min. Most of the supernatant was aspirated to leave 6–8 ml of fluid, in which the pelleted cells were gently resuspended. Over the next 5–10 min, encapsulated cells settled by gravity to the tube bottom, whereas free-swimming (exocytosis-deficient) cells migrated toward the air–water interface and concentrated at the meniscus. The latter were collected and transferred to 50 ml of fresh medium and grown for 8 h at 22°C, at which time the enrichment procedure was repeated. The free-swimming cells collected after this second step were diluted into fresh medium for distribution into 96-well plates (25 µl/well) at a density of 30 single cells per plate. After 4 d at 30°C, the cells were starved by addition of 125 µl/well DMC and incubation at 30°C for an additional 4 d. Wells were then screened for the absence of capsules after stimulation with 25 µl of 0.1% Alcian Blue, followed by rescue with 25 µl of 2% proteose peptone. Initially, all encapsulation-deficient wells were confirmed by retesting, but this step was later omitted because of the negligible number of encapsulation-positive wells identified during rescreening, i.e., the assay results were highly reproducible.
Whole Cell PCR
Wells bearing encapsulation-deficient cells were replicated to master plates and grown to stationary phase. The antisense inserts harbored by the cells in each well were identified by whole cell PCR. Briefly, 50 µl of cells were mixed with 12.5 µl of K buffer (50 mM Tris-HCl, pH 8.8, 250 mM KCl, and 0.4% Nonidet P-40) and incubated for 1 h at 55°C and 10 min at 100°C. Then, 25 µl of this cell lysate was mixed with 25 µl of PCR mix (10 mM Tris-HCl, pH 8.8, 50 mM KCl, 0.08% Nonidet P-40, 2 mM MgCl2, 2 mM of each nucleotide, 1 µM of the primers 5318f1 [5'-AAAAGGTCGATGAGTAAGGAAATG-3') and 5318r2 (5'-CAATCTCAGGGTACGCGG-3'], and 3 U of TaqDNA polymerase [Fermentas]) and subjected to the following: 95°C, 3:00; 30 cycles of (94°C, 0:30; 55°C, 0:30; and 72°C, 1:00); and 72°C, 10:00. Products were visualized on 4% agarose gels, and those showing a single band were purified for sequencing. Products yielding antisense sequences of interest were digested with KpnI and NotI and ligated into the ribosomal antisense vector 5318DNmod for retransformation of Tetrahymena by electroporation, as described above.
Expression of GFP-tagged Proteins
Grl2p-GFP and Grl6p-GFP were expressed in Tetrahymena from the vector pVGF.MTT, a modified version of pVGF.1 (Haddad et al., 2002). pVGF.MTT was created by replacing the ribosomal RPL29 promoter in pVGF.1 (flanked by NotI and PmeI restriction sites) with the MTT1 promoter (amplified from cDNA using primers 5'-CCGGTCACCTTTTTTATTTAGTAAAAATT-3' and 5'-CCGTTTAAACTATTTTAAGTTTAGTATTAT-3') after replacing the NotI site with one for BstEII. The GRL2, GRL6, and GRL7 coding sequences were amplified from cDNA using primer pairs 5'-AAGTTTAAACATGCGCTTAACTGTTATTGTCAC-3' and 5'-TTGTCAGCTGAAGAATCCACCAGAACTAGCACTT-3', 5'-ATGTTTAAACATGAAAATAATTATTATTTTTTTAG-3' and 5'-TTAACAGCTGAATTGGGATTATTCGTCTGATC-3', and 5'-ACGTTTAAACATGAGAAAAGTCTTCGTTGCTT-3' and 5'-TATCAGCTGAAAGCGCTTTCAGCACTTCC-3', respectively; these pairs provide restriction sites for blunt ligation into pVGF.MTT at its PmeI site. The second primer of each pair removes the stop codon from the end of the coding sequence, allowing for insertion in frame with an enhanced GFP tag (BD Biosciences Clontech) in the vector. Correct ligation was verified by direct sequencing. After transformation into Tetrahymena, protein expression was induced by growth in 0.2% yeast extract, 0.009% ferric EDTA with 0.1 µg/ml CdCl2 for 24 h at 30°C. Grl1p-GFP was expressed from the ncvB vector (Bowman et al., 2005), which results in the expression of protein from the endogenous chromosomal MTT1 locus. The Grl1p-GFP coding sequence was produced by creating the GFP fusion protein in pVGF.MTT (as above, using primers 5'-GTTTAAACATGAATAAGAAATTATTA-3' and 5'-TTGTCAGCTGAAGTTAATGAAGTCAATATTGG-3'), and shuttling this fusion into ncvB using the flanking PmeI and ApaI restriction sites. The Igr1p-GFP coding sequence was produced by shuttling the IGR1 ORF from the pVGF.1 vector (Haddad et al., 2002) into the pVGF.MTT vector (using PmeI and XhoI restriction sites), followed by the insertion of the GFP tag and transfer into ncvB, as described above. Grl1p-GFP expression was induced by growth in SPP with 2 µg/ml CdCl2 for 6–8 h at 30°C.
High Level Expression of GRL1
The GRL1 coding sequence was amplified from cDNA using the primers 5'-GTTTAAACATGAATAAGAAATTATTA-3' and 5'-CTCGAGTCAGTTAATGAAGTCAAT-3', which provide restriction sites for insertion into pVGF.MTT between the PmeI and XhoI sites. This ligation step removes the GFP sequence from the vector, resulting in the expression of full-length untagged GRL1. Protein expression was induced by growth in SPP with up to 3 µg/ml CdCl2 for 4–5 h at 30°C.
Expression of GRL1–6xHis
The endogenous GRL1 coding sequence was replaced with GRL1-6xHis by modifying a vector used by Bradshaw et al. (2003) to replace the endogenous GRL1 gene with genes that contain altered GRL1 coding sequences. Starting with a template vector that encodes the wild-type Grl1p sequence, the primers 5'-CACCACCACCACCACCACTGAAAAATGATGTGATTT-3' and 5'-GTTAATGAAGTCAATATTGG-3' (MWG, High Point, NC) were used to amplify the vector by inverse PCR. The amplified product was blunted with T4 DNA polymerase and then digested with DpnI to destroy the template before self-ligation (New England Biolabs, Beverly, MA). The modified coding sequence (full length GRL1 plus six histidine codons placed immediately upstream of the stop codon) was confirmed by sequencing, and the construct was used for biolistic transformation of CU428.1.
Purification of proGrl1p–His Complexes
Purification followed Bowman et al. (2005) except that the lysis, wash, and elution buffers did not contain urea or guanidine.
Production of Polyclonal Anti-Grl4p Antibodies
To obtain immunogen for the production of anti-Grl4p antibodies, secretory granule contents were purified from wild-type cells (Turkewitz et al., 2000). Approximately 1 mg of this material was resolved on a 20% polyacrylamide gel in SDS and then stained with Coomassie Blue. Guided by previous identification of polypeptides in such samples (Verbsky and Turkewitz, 1998), Grl4p was excised with a scalpel. Rabbit antiserum against this band was then produced commercially (Zymed Laboratories, South San Francisco, CA).
Exocytosis Testing of GRL Strains
Strains were tested for Alcian Blue-induced capsule formation by using cultures starved overnight in DMC and for dibucaine-induced flocculent release by using stationary cultures (0.8–1 x 106 cells/ml in SPP medium) as described previously (Turkewitz and Kelly, 1992; Melia et al., 1998). To quantify dibucaine-stimulated release from GRL6 cells relative to wild-type, 6 x 106 cells were suspended in 1 ml of 10 mM Na-HEPES, pH 7.0, 0.5 mM CaCl2, and stimulated for 15 s by addition of 110 µl of 25 mM dibucaine. Cells were then diluted with buffer to 15 ml and pelleted for 5 min at 300 x g. The released granule contents, which form a distinct flocculent layer above the cell pellet, were removed with a transfer pipette and transferred to a graduated conical tube for repelleting and volume measurement. Protein concentrations in the flocculent layer were measured using the Pierce protein assay.
View larger version (10K):
[in this window]
[in a new window]
|
Figure 2. Schematic of all GRL antisense sequences isolated from exocytosis-deficient transformants. Sequences, which are represented as arrows, fall into six groups that correspond to the known GRLs. Nucleotide positions indicated at the top of each group are relative to the start codon of the indicated GRL. In cases where identical sequences were obtained from multiple clones arising from a single transformation, only a single arrow is shown. Six sequences (marked with an asterisk) were used to transform wild-type cells, and each of these antisense sequences conferred an exocytosis-deficient phenotype. All antisense sequences contain a portion of the 5' untranslated region of their respective genes.
|
|
Analysis of Functionality through Evolutionary Constraint
The translations of the sequences were first aligned using ClustalW using default parameters. Afterward the codons were mapped directly onto the peptide alignments to produce a multiple alignment with gaps in multiples of three. For estimating rates of evolution, an unrooted phylogeny for the three genes was assumed. The substitution rates at amino acid changing sites (KA) and at synonymous sites (KS) were calculated using the codeml software (Yang 1997). KA is the ratio of number of nucleotide substitutions that result in an amino acid change to the total possible number of amino acid changing nucleotide substitutions. KS is a similar ratio corresponding to synonymous changes within codons. The ratio KA/KS (also called 
) reflects the nature evolutionary constraint between sequences. Because silent substitutions do not affect the peptide, the KS ratio is used as a neutral standard. If KA = KS ( = 1), this indicates a lack of constraint at the amino acid level. If, however, KA < KS ( < 1), then the rate of protein evolution is constrained, indicating selection against amino acid substitution and implying protein functionality. Finally, if KA > KS ( > 1), then protein evolution is accelerated, indicating natural selection for amino acid substitution. Evolutionary constraint was evaluated by testing four separate models of protein evolution. In the first model (H0), the rates of all branches were estimated from the data. In the remaining three models, in the branch leading to each sequence was fixed at a value of 1 (neutrality), whereas the other branches were estimated. The models are described as follows: H0) Estimate for all branches; H1) Set for GRL5 = 1, and estimate the others; H2) Set for GRL9 = 1, and estimate the others; and H3) Set for GRL10 = 1, and estimate the others.
To evaluate the probability that a given sequence differed from the neutral rate of = 1, a likelihood ratio test (Yang, 1998) between H0 and each model was conducted as follows. The X2 statistic is calculated as
where L represents the likelihood of the model H1. The X2 statistic is 
2 distributed with 1 degree of freedom.
|
RESULTS
|
|---|
Screening for Antisense Ribosomes That Confer Exocytosis Defects
To identify genes required for regulated exocytosis of secretory granules in T. thermophila, we transformed cells with both existing as well as new libraries of antisense ribosomes. We screened transformants to identify the subset with defects in exocytosis, as judged by the inability to form capsules when stimulated with the secretagogue Alcian Blue. Such cells were obtained first by physical enrichment and then by visual screening of individual clones in 96-well plates. Clones that failed to undergo visible exocytosis when challenged with Alcian Blue were expanded, and the antisense inserts were then amplified by whole cell PCR using primers directed against the insert flanking sites at the rDNA locus. As can be seen in a representative agarose gel, multiple PCR products were obtained for many transformant lines (Figure 1). These were due to multiple antisense inserts within individual cells, rather than to nonclonality among the transformant lines, because we obtained the same result when single cells were again isolated and clonally expanded (our unpublished data). For practical purposes, we focused on the subset of cells seeming to have a single major insert.
We obtained sequences of 304 antisense inserts associated with strong defects in exocytosis in the primary screen. From these sequences, we then identified the corresponding genes by querying the expressed sequence tag (EST) database, in which a large fraction of entries include sequence from the 5' untranslated region. Of these 304, 237 had previously been identified in T. thermophila, and 67 were novel. Among the former were all six of the known GRL family (GRL1, 3, 4, 5, and 7, and NDC1/GRL8, and multiple independent inserts were obtained corresponding to each family member; Figure 2). For the sake of simplicity, we henceforth refer to NDC1 as GRL8. In fact, inserts corresponding to GRL genes comprised 181 of these inserts (Figure 2). We confirmed the significance of a subset of these inserts by reinserting them into the empty rDNA vector and generating new transformants for testing. In all cases, inserts corresponding to GRL genes regenerated exocytosis-deficient transformants. The remaining 56 previously identified genes all fell into the class of "housekeeping" genes, particularly corresponding to ribosomal proteins, whose suppression would be predicted to impair cell viability. Because housekeeping genes were unlikely to have roles specific for granule synthesis, they were not further examined.
View larger version (63K):
[in this window]
[in a new window]
|
Figure 3. Disruption of GRL3, GRL4, and GRL7 through homologous recombination. (A) GRL3/4 genomic locus, showing the replacement by the NEO2 cassette of the first 508 aa of the GRL3 ORF. In A, B, and C, noncoding regions are shown in gray. (B) GRL3/4 locus, showing the replacement by the NEO2 cassette of the first 242 aa of the GRL4 ORF. (C) GRL7 genomic locus, showing replacement by the MTT-NEO cassette of the entire GRL7 ORF. (D) Southern blot of genomic DNA from GRL3 and GRL4 knockout lines, with probes generated from the cDNAs of the respective genes as described in Materials and Methods. An additional XbaI site in the NEO2 cassette results in hybridization of the probe to two smaller fragments; the remaining material at the size of the wild-type locus is transcriptionally silent micronuclear DNA, present 2N relative to the 45N of the transcriptionally active macronuclear DNA (a 22.5-fold decrease in signal, as shown). (E) Southern blot of a GRL7 knockout line, using a probe generated from the GRL7 cDNA. In this case, none of the GRL7 ORF remains for hybridization with the probe; the remaining signal is from detection of micronuclear DNA. (F) Electron micrographs of wild-type, GRL3, GRL4, and GRL7 granules, showing the aberrant morphology and lack of a crystalline lattice in the knockout lines. Bars, 0.2, 0.25, 0.2, and 0.2 µm, respectively.
|
|
To begin analyzing the set of novel genes, we first tested the ability of the inserts to regenerate the exocytosis deficiencies, as described above. However, in contrast to the GRL gene inserts, in no case did retransformation regenerate the exocytosis deficiency. In such cases, the primary transformants may have harbored one or more additional rDNA inserts, not detected by whole cell PCR, that were responsible for the deficiencies. Previous work has demonstrated that an antisense ribosome constituting just a small minority of the total ribosome population in a given cell can produce a null or hypomorphic phenotype (Sweeney et al., 1996). Alternatively, the deficiencies may have been due to mutations unrelated to the rDNA locus, induced as a result of the transformation process. The genes corresponding to these inserts were not analyzed further.
Testing GRL Function by Individual Gene Disruption
Although this functional screen did not succeed in identifying new genes involved in regulated secretion, the results strongly suggested that each of the GRL gene products, previously identified by isolation of DCG contents, plays an essential, nonredundant role in regulated exocytosis. To test this directly and to evaluate the function of individual Grl proteins, we disrupted each of three GRL genes (GRL3, GRL4, and GRL7) in independent cell lines (Figure 3). We did not target GRL5 for disruption because Southern blotting indicated that multiple gene copies might be present. This issue was clarified when the T. thermophila genomic sequence became available and is discussed in a later section. As expected, the GRL3, GRL4, and GRL7 lines were each completely defective in Alcian Blue-stimulated capsule formation (our unpublished data; Figure 11). The deficiencies were due to defects in DCG synthesis and specifically in the assembly of the core structure. As revealed by electron microscopy, each of the GRL lines accumulated aberrant DCGs that differed from the wild type in shape, being spherical rather than elongated (Figure 3F). In addition, the spherical granules lacked any visibly ordered core structure. There were no discernible differences between the granules formed in these different strains; moreover, we also found similar granules in a double-disruption GRL3, GRL4 cell line (our unpublished data). At this level of analysis, the granules in strains lacking GRL3, GRL4, or GRL7 seemed structurally and functionally identical to those previously characterized in GRL1 or GRL8 cells (Chilcoat et al., 1996; Chilcoat et al., 2001). These results differed markedly from those in Paramecium, in which distinct granule assembly defects were induced by silencing of specific tmp families (Vayssie et al., 2001). Instead, our results suggested that the Tetrahymena Grl proteins all play similar roles during core formation. To account for these results, we hypothesized that each protein is present throughout the elongated lattice found in wild-type cells. One possibility is that each contributes to a Grl hetero-oligomeric complex, which could function as an assembly subunit.
View larger version (33K):
[in this window]
[in a new window]
|
Figure 4. Affinity chromatography of proGrl1p complexes. (A) Identification of proGrl4p and Grl4p by Western blotting. Whole cell lysates of wild-type, GRL4, and UC623 cells were resolved on a 17.5% gel and probed with the anti-Grl4p antibody on Western blots. Compared with GRL4, the wild-type lane has two extra bands. The more abundant species, at 12 kDa, corresponds to the mature product generated from the amino-terminal half of proGrl4p (Verbsky and Turkewitz, 1998), whereas the lighter band at 47 kDa corresponds to proGrl4p. Consistent with these assignments, the latter is much more abundant, and the former absent, in a lysate from the UC623 mutant line that accumulates unprocessed proGrl proteins (Bowman et al., 2005). (B) proGrl4p and proGrl8p physically interact with proGrl1p. In wild-type cells, the endogenous GRL1 gene was replaced by a construct that adds a C-terminal 6His-tag to the GRL1 open reading frame and maintains expression from the endogenous promoter. Transformed cells were lysed as described in Materials and Methods, and proGrl1p-6His-containing complexes were purified from a high speed supernatant by affinity chromatography. The purified material (+His) was run on a 12.5% gel and probed with the anti-Grl1p, anti-Grl4p, and anti-Grl8p antibodies by Western blot. The control lanes (–) contain material purified from wild-type cells that were not transformed with the His-tag construct and contain material that was nonspecifically bound by the column. Specifically bound species, corresponding to Grl proproteins, are indicated by arrowheads. The electrophoretic positions of molecular weight standards are indicated on the right of each panel.
|
|
In Vitro Evidence for proGrl Hetero-oligomeric Complexes
To determine whether such hetero-oligomers exist, we began with a biochemical approach. Attempts to dissociate mature granule cores into putative subunits were foiled by the striking stability of the assembled lattice under all but strongly denaturing conditions (our unpublished data). On the other hand, before proteolytic processing and core assembly, the Grl proteins are fully soluble (Turkewitz et al., 1991). To ask whether Grl proproteins assemble as hetero-oligomers, we engineered GRL1 with a carboxy-terminal hexahistidine extension. This was recombined at the native GRL1 locus as a gene replacement, to achieve a wild-type pattern and level of expression. ProGrl1p-6His was isolated from nondenaturing detergent cell lysates by nickel affinity chromatography, and antibodies against other Grl proteins were used to ask whether these coeluted with proGrl1p-6His. Mature processed Grl1p is entirely insoluble under these conditions, and was therefore discarded before the chromatography step. Western blotting, after SDS-PAGE and transfer to nitrocellulose, revealed that at least two other proGrl proteins were bound to the nickel-Sepharose, in a manner that depended on the presence of proGrl1p-6His (Figure 4). Although these data do not establish whether one or more of these proteins directly contacts proGrl1p or whether such contacts are specific, they are consistent with assembly of a set of Grl proproteins as an early step in core formation. Because we do not possess antibodies against the remaining Grl proteins, we could not determine whether these were also present.
View larger version (42K):
[in this window]
[in a new window]
|
Figure 6. Overexpression of GRL1 results in the retention and crystallization of proGrl1p in the ER. (A) The accumulated proGrl1p in cadmium-induced cells constitutes a significant percentage of total cellular protein. Cells were transformed with the cadmium-inducible GRL1 expression vector. Whole cell lysates from either uninduced or 3.0 µg/ml cadmium-stimulated cells were analyzed by Coomassie Blue staining (12.5% polyacrylamide gel). A pronounced band at 60 kDa, corresponding to proGrl1p, is exclusively present in the induced sample (arrow). (B) ProGrl1p crystallizes in the ER. Cells overexpressing proGrl1p, induced as in A, were fixed and prepared for electron microscopy. Left, at low magnifications, a large number of straight-edged inclusions are visible. The asterisk indicates an inclusion that has formed in the envelope of endoplasmic reticulum that separates the nucleus (labeled N) from the cytosol. Bar, 1 µm. Right, high-magnification view reveals striated patterning in the inclusion bodies, indicating that the contents are crystalline. Docked ribosomes can be seen along the cytoplasmic membrane surface. Bar, 0.2 µm. (C) The extent of proGrl1p processing is independent of proGrl1p expression level. Expression of GRL1 from the inducible GRL1 expression vector was induced with the indicated cadmium concentrations for 6 h, and whole cell lysates of these cultures were resolved on a 12.5% gel and probed by Western blotting with anti-Grl1p antibody. The positions of proGrl1p and Grl1p are indicated. A cross-reactive band, marked by the asterisk, serves as a loading control.
|
|
In Vivo Evidence for Hetero-oligomer Formation
To understand the in vivo significance of such oligomers, we analyzed Grl proteins in a subset of the GRL null lines described previously. The logic of these experiments was that specific oligomer formation, if it occurred at the level of the ER, could be a prerequisite for ER exit. This has been observed for multimeric complexes in many other systems, including at least one complex targeted to secretory granules (Chanat et al., 1999). We therefore asked whether the absence of other Grl proteins blocks ER exit of proGrl1p. As a first measure, we assessed the extent of proGrl1p processing, a step that occurs in a post-trans-Golgi network (TGN) compartment and which therefore requires exit from the ER. The processing of proGrl1p was significantly inhibited in GRL4 cells (Figure 5A). That this reflected a specific interaction between proGrl1p and proGrl4p was supported by the observation that only a partial inhibition was seen in GRL3 and GRL8 cells. The results suggested that proGrl1p, when expressed in the absence of proGrl4p, failed to reach the post-TGN processing compartment due to its retention in the ER. To assess this more directly, we expressed a GFP-tagged variant of GRL1 in wild-type, GRL3, GRL4, and GRL8 cells. In wild-type cells, the protein localized as expected to the docked DCGs (Figure 5B). In GRL4 cells, on the other hand, Grl1p-GFP was found primarily in a subcortical reticular pattern, distinct from the punctate pattern of docked DCGs. This reticular pattern is likely to reflect the cortical endoplasmic reticulum but also may overlap with alveoli, which are flattened cisternae underlying the plasma membrane (Frankel, 2000). Alveoli are involved in calcium-based signaling and may represent a specialized ER subcompartment. We observed identical patterns in cells transformed to express GFP (with an N-terminal signal sequence), fused at the C terminus to carboxy-terminal tetrapeptides that confer ER localization in other species (KDEL or HDEL) (our unpublished data) (Andres et al., 1991). This localization depended upon the ER retention signal, because signal sequence GFP, without any ER-retention signal, localizes to small cytoplasmic vesicles in these cells or is found in the medium (Haddad et al., 2002; Bowman et al., 2005). Importantly, mislocalization of proGrl1p-GFP to the cortical reticulum in GRL4 cells was specific, because Grl1p-GFP expressed in GRL3 and GRL8 cells accumulated primarily in the DCGs. Unlike in wild-type cells, GRL3 and GRL8 cells also showed a low level of proGrl1p-GFP labeling of non-DCG structures, consistent with the partial inhibition of processing (Figure 5B).
GRL1 Overexpression Leads to ER Accumulation
These results suggested that proGrl1p and proGr4p associate at the level of the ER, as a prerequisite to ER exit. This may regulate the stoichiometry of subunit assembly in the multicomponent lattice. A prediction was that overexpression of GRL1 would lead to its partial retention in the ER, because the amount of proGrl4p or other potential binding partners would be limiting under such circumstances. To test this, we expressed GRL1 from a multicopy rDNA-based vector, under the control of the MTT1 promoter. Grl1p accumulated in the cells in the proprotein form, at a level so high that it was visible as a prominent Coomassie Blue-staining band after SDS-PAGE of whole cell lysates (Figure 6A). Analysis of these cells by thin sectioning and electron microscopy revealed that the cytoplasm contained abundant ER filled with a visible aggregate, organized in some regions as a geometric lattice (Figure 6B). This crystallization was probably widespread, because many ER lumena were distended in distinctly angular shapes. Such distended ER is not seen in wild-type cells. Interestingly, cells overexpressing GRL1 also had a normal complement of docked DCGs with wild-type morphology, suggesting that the endogenous level of proGrl1p still exits the ER even while most of the proGrl1p is retained (our unpublished data). Consistent with this, Western blotting of whole cell lysates, derived from cultures induced over a range of cadmium concentrations, showed that a constant amount of mature Grl1p was generated, irrespective of the GRL1 expression level (Figure 6C).
View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Four new members of the GRL family. (A) Predicted structural features of Grl1p and of the four newly identified family members. (B) A phylogenetic tree displaying the evolutionary relationship between the Grlps. After aligning the protein sequences using the ClustalW algorithm, a phylogenetic tree was calculated using the maximum likelihood algorithm in the PHYLIP software suite. The branching pattern reveals two clusters of relatively closely-related paralogs (GRL1 and 2, and GRL5, 9, and 10) within a tree that is otherwise made up of deep lineages. (C) Alignment of the Grlps and a member of the Paramecium tmps, illustrating a tetrapeptide motif (boxed) that lies amino-terminal to the central basic stretch and to the carboxy-terminal basic stretch of Grl8p (shown in gray). With its substitution of a charged residue (Asp) within the motif, Grl2p deviates from the pattern established by the other family members.
|
|
It is also noteworthy that the proGrl1p in such overexpressing cells did not seem aggregated by biochemical criteria. When cells were solubilized in nondenaturing detergent (1% Triton X-100), essentially all of proGrl1p was soluble (350,000 x g; 20 min) (our unpublished data). These results suggest that ER retention of proGrl1p is not due to misfolding.
Genome Analysis Reveals Four Novel GRL Genes
Previous biochemical analysis as well as the functional screen reported here converged on a set of six GRL genes. In particular, the results of the latter suggest that no other genes play essential roles in granule assembly. However, genes with redundant functions would have been invisible. The same may be true for genes with nonredundant functions that are transcribed at a low level, because representation in the antisense libraries depends in part on relative mRNA abundance. We took advantage of the recent completion of the sequencing of the T. thermophila macronuclear genome, in addition to establishment of an EST database, to ask whether these six genes represent the entire GRL family. Homology searches with each of the six genes revealed the likely existence of four novel related genes in the macronuclear genome, which we have named GRL2, 6, 9, and 10 (Figure 7A). The relationship between the GRLs is shown in Figure 7B. The predicted new family members all bear characteristic Grl protein features, including their overall length, highly acidic character, and a wealth of predicted short 
-helical coiled coils. The extent of amino acid identity between the six previously identified GRL genes is low, on the order of 20% (Verbsky and Turkewitz, 1998). This is also true for GRL6, but the other three newly detected GRL genes show a pattern indicating a different evolutionary history. GRL9 and 10 are very closely related (
85% identity) to GRL5, and their hybridization with a GRL5 probe can account for the Southern blotting results mentioned previously. GRL2 is most closely related (>40% identity) to GRL1. The genes seem to represent relatively recent duplications in an otherwise deeply branched phylogeny. Grl2p is unusual in having a nonconservative substitution within a four-amino acid motif that is the most highly conserved 1° structural feature in the Grl/tmp family (Figure 7C) (Verbsky and Turkewitz, 1998).
The fact that these four hypothetical genes eluded previous detection suggested that some of their products might have roles distinct from the six established members. Functional analysis was confined to GRL2 and 6, because the similarity of GRLs 5, 9, and 10 made it challenging to target those genes individually. GRL9 and 10 are likely to be transcribed at relatively low levels, because many independent GRL5 clones, but no GRL9 or 10 clones, were identified in the EST library (all EST sequences available through standard public databases). However, neither GRL9 nor 10 seems to be a pseudogene, based on direct and indirect evidence. The GRL9 product was unambiguously detected in mass spectrometric analysis of isolated granules (our unpublished data). The argument for GRL10 is based on analysis presented below, indicating that this gene is evolving under natural selection for amino acid substitution. Because pseudogenes are expected to evolve neutrally, this is evidence against GRL10 being a pseudogene.
To test for the presence or absence of functional constraint during evolution of GRL5, GRL9, and GRL10, we measured the divergence between the sequences. Some nucleotide substitutions in a codon do not change the peptide sequence (synonymous substitutions), whereas others result in the substitution of one amino acid residue for another (replacement substitutions). The ratio of synonymous substitutions to total number of synonymous sites is called KS, whereas the ratio for replacement substitutions is called KA. Under the assumption that synonymous substitutions are invisible to natural selection and thus represent the mutation rate in the absence of selection, the ratio of KA to KS, or , measures the selective constraint on amino acid substitutions in a sequence. Table 1 shows the results of testing the rates of evolution on the unrooted phylogeny between GRL5, GRL9, and GRL10. These results indicate that the rates of nonsynonymous substitution for GRL5 and GRL9 do not differ significantly from the rates of synonymous substitution, because the ratio does not differ significantly from 1. However, for GRL10 in particular the rate of replacement substitution is significantly elevated with respect to synonymous substitution, because its value of is significantly greater than 1. This suggests that GRL10 is not evolving as would be expected for a pseudogene, i.e., neutrally.
View larger version (59K):
[in this window]
[in a new window]
|
Figure 8. Northern analysis of two novel GRLs. (A) Cellular RNA (9.4 µg) from growing (G) and starved (S) wild-type cells, labeled with a probe generated from the GRL1 (left blot) or GRL2 (right blot) open reading frames. At right on each blot is GRL1 (left blot) or GRL2 (right blot) RNA from in vitro transcription reactions, in loadings of 1 pg, 10 pg, 100 pg, and 1 ng. (B) For each of the blots in A, the 100-pg and 1-ng in vitro products were used to construct a linear scale. These scales were used to quantitate the amount of GRL1 and GRL2 RNA in G and S cells. (C) Northern blots as for A, probing for GRL7 and GRL6. (D) Analysis of the GRL7 and GRL6 blots as in B.
|
|
In Vivo Analysis of GRL2 and GRL6
GRL2 was present as a single clone in the EST library, and both GRL2 and 6 could be amplified by PCR as full-length copies from cDNA libraries, indicating that these genes are transcribed. As shown by Northern blotting, however, the mRNAs are present at levels much lower than those of the previously described GRL genes (Figure 8). The regulation of expression also seems to be different, because GRL1 and 7, but not 2 and 6, show greater accumulation (as a fraction of total mRNA) in starvation versus growth conditions. To characterize GRL2 and 6, we first asked whether the gene products localize to DCGs by engineering them as GFP-tagged copies. As shown in Figure 9, expression of either Grl2p-GFP or Grl6p-GFP from the MTT1 promoter produced a fluorescent array of cortical puncta, indicating that these proteins accumulate in docked granules. Nonetheless, neither GRL2 nor 6 is essential for DCG assembly and exocytic capsule formation, as shown via gene disruption (Figure 10). Both GRL2 and GRL6 cells were indistinguishable from wild type in Alcian Blue-stimulated capsule formation, which is a qualitative measure of exocytosis (Figure 11A). Exocytosis seemed to be as efficient as wild type, because GRL2 and GRL6 cells underwent complete degranulation after exposure to Alcian Blue as judged by immunofluorescence (our unpublished data). Consistent with this, electron microscopy (EM) analysis of fixed thin sections revealed docked DCGs with crystalline cores (Figure 11B). Based on these observations, we tentatively concluded that neither Grl2p nor Grl6p plays an important role in granulogenesis.
View larger version (150K):
[in this window]
[in a new window]
|
Figure 9. Localization of Grl2p and Grl6p to dense core granules by GFP chimeras. GRL2 and GRL6 were fused to GFP and expressed in growing cells. Shown for comparison are fusions of GFP with signal sequence alone (sig seq) or with a known granule content protein (GRL7). Bar, 10 µm.
|
|
View larger version (24K):
[in this window]
[in a new window]
|
Figure 10. Disruption of GRL2 and GRL6 through homologous recombination. (A) GRL2 genomic locus, showing the replacement by the MTT-NEO cassette of the entire GRL2 ORF. (B) Southern blot of a GRL2 knockout line, with a probe generated from the GRL2 cDNA. The remaining material at the size of the wild-type locus is transcriptionally silent micronuclear DNA. (C) GRL6 locus, showing the replacement by the MTT-NEO cassette of the entire GRL6 ORF. (D) Southern blot of a GRL6 knockout line, with a probe generated from the GRL6 cDNA; the remaining signal is from detection of micronuclear DNA. We used Southern blotting, with a probe generated from the NEO marker, to confirm that GRL6 cells contained NEO at a single locus (our unpublished data).
|
|
We were therefore surprised to observe that GRL6 cells showed a large quantitative deficiency in exocytosis. When Tetrahymena are treated with the local anesthetic dibucaine, granule contents are released via exocytosis but do not form a capsule, as they do in the presence of Alcian Blue. Instead, the expanded granule lattices dissociate from the cells and form a sedimentable flocculent whose volume is many times greater than that of the cells themselves (Satir, 1977). Cell lines disrupted in GRL1, 3, 4, 7, or 8, or bearing a GRL5 antisense insert, do not produce any visible flocculent when stimulated, because the granule cores in such cells do not expand upon exocytosis (Chilcoat et al., 1996; our unpublished data). When GRL6 cells were stimulated with dibucaine, the volume of the flocculent was reduced 40–70% relative to wild type (n = 10) (our unpublished data). This smaller volume could result from the release of a smaller number of DCGs, or from DCGs containing cores that undergo more limited expansion than those in wild type. The latter was ruled out by measuring the protein content of the flocculent: GRL6 cells not only released a smaller volume of flocculent than wild type, but it contained a correspondingly smaller amount of protein (n = 2) (our unpublished data). In fact, visualization of four independent GRL6 lines by immunofluorescence of fixed cells demonstrated that they contain significantly fewer docked DCGs than in wild-type cells or other GRL lines (Figure 12A).
The DCGs also seemed wider, when viewed en face, than those in wild type. To be certain that this was not a fixation artifact, we transformed wild-type, GRL1, GRL2, and GRL6 cells with Igr1p-GFP, a fluorescent marker for DCGs (Haddad et al., 2002). Analysis of docked DCGs in living cells confirmed that the GRL6 DCGs are both shorter and wider than those in wild type, although clearly different from the spherical DCGs in GRL1 (Figure 12B). GRL2 DCGs were not distinguishable from wild type.
The difference in DCG accumulation also was supported by immunodetection of granule contents in whole cell lysates, because the amounts of several Grl proteins, in their processed forms, seemed reduced in GRL6 cells relative to wild type or GRL2 (Figure 12C). Unexpectedly, the GRL6 cells also showed increased accumulation of the corresponding Grl proproteins. As discussed above, this could reflect either a transport or an assembly defect. Immunolocalization of Grl3p in these cells, using mAb 5E9, demonstrated that all detectible protein was present in the docked secretory granules, suggesting the latter (our unpublished data). It is important to note that these Western blots cannot be used to judge the relative levels of pro- and processed versions of each species, because some antibodies seem to be far more reactive on Western blots against the proprotein forms (Bowman and Turkewitz, unpublished). These results indicate that Grl6p plays an important role in DCG biogenesis. Given the fact that its absence alters core dimensions without eliminating lattice formation, and results in decreased granule accumulation, we conclude that this role is different from that of the six major Grl proteins. Table 2 summarizes the phenotypes associated with the set of GRL disruptions.
Epistasis Analysis of GRL6 Function
The reduction in granule accumulation in GRL6 cells could reflect a decreased rate of synthesis, if this relatively low abundance core protein normally acts as a master regulator. Alternatively, GRL6 granules could be synthesized at the same rate as wild type, but lost at an accelerated pace. Because we saw no indications of cytoplasmic granule degradation in light or electron micrographs of GRL6 cells, we hypothesized that such accelerated loss could occur by an increase in nonstimulated exocytosis. To explore this idea, we disrupted GRL6 in a mutant cell line, MN173, in which granule transport to the plasma membrane is impaired (Figure 13A) (Melia et al., 1998). As a result, MN173 cells accumulate secretory granules in the cytoplasm, rather than docking them at the plasma membrane. If GRL6 is required for granule synthesis per se, MN173 GRL6 double mutants would be expected to accumulate fewer granules than MN173 itself. However, if GRL6 granules are lost from cells by premature exocytosis, this defect might be suppressed in the MN173 background, because such exocytosis requires that the granules first be docked at the plasma membrane.
View larger version (18K):
[in this window]
[in a new window]
|
Figure 13. Epistasis analysis of GRL6 function. (A) Southern blotting of whole cell DNA from wild type, GRL6 in the CU428 (WT) background (same strain as in Figure 10), and two clones of MN173 GRL6, using probes against GRT2 (loading control) and GRL6. Clone 7 has maintained GRL6 at wild-type levels, whereas clone 10 is equivalent to the established GRL6 strain. The remaining signal is due to the micronuclear GRL6 copies, which are not expressed. (B) Flow cytometry of wild-type and GRL6 cells to quantify Grl3p, a granule marker. Shown are two trials. In the first, wild-type (WT) cells are compared with GRL6 cells, and the latter show a leftward shift representing a decrease in mean fluorescence per cell. In the second, wild-type cells are compared with MN173 clone 7 (wild-type level of GRL6) and clone 10 (GRL6). Mean fluorescence in the two clones is similar. In both panels, the left-most curve represents cells with no 1° antibody. Identical results were obtained using mAb 4D11, which recognizes granule marker Grt2p. (C) Effect of GRL6 disruption on granule content. Shown is the ratio (mean, with SD) of FITC fluorescence in cells without GRL6 versus with GRL6. Mean FITC fluorescence was measured by flow cytometry, as in B, in cells labeled with mAbs 4D11 or 5E9. On the left, the ratio of fluorescence in GRL6 cells versus wild type (n = 7). Disrupting GRL6 results in a decrease in mean fluorescence. On the right, the ratio of fluorescence in MN173GRL6 versus MN173 (clone 10 vs. clone 7) (n = 5). In the MN173 background, disruption of GRL6 results in an increase in mean fluorescence.
|
|
Neither microscopy nor dibucaine-stimulated protein release could be readily used to assess granule abundance in the MN173 background, because granules are not docked at the cell surface. Instead, we used flow cytometry of fixed permeabilized cells that were immunostained with antibodies against either of two granule contents proteins, Grt1p and Grl3p. Using this approach, we first confirmed that GRL6 cells contain fewer granules than wild type (Figure 13B). Similar results were obtained using either antibody, and with cells from either stationary or starved cultures. For the double mutant analysis, we selected two lines derived from a single transformation in which we introduced a NEO-disrupted copy of GRL6. Drug-resistant clones derived from this transformation are expected to contain a variable number of the wild-type versus disrupted allele, during the several week interval during which the latter is driven to fixation (Turkewitz et al., 2002). Southern analysis of these two lines shows that, in clone 7, the wild-type allele is still present at wild-type levels, whereas complete replacement by the null allele has occurred in clone 10 (Figure 13A). We measured granule content in these two clones. In striking contrast to the results of GRL6 disruption in a wild-type background, the GRL6 MN173 cells (clone 10) showed no decrease in the accumulation of Grl3p, relative to clone 7 (Figure 13B). Interestingly, on average, MN173 cells lacking GRL6 accumulated a somewhat higher level of both granule markers than MN173 cells with wild-type levels of GRL6 (Figure 13C). Immunofluorescence visualization of Grl3p in these cells showed the expected pattern of cytoplasmic granules, and identical flow cytometric results were obtained using either mAb 4D11 or 5E9, which recognize two different, unrelated granule markers (our unpublished data). These results do not support the idea that GRL6 is required for efficient granule synthesis, because MN173GRL6 cells show no deficiency in granule accumulation. Instead, they suggest that absence of Grl6p in an otherwise wild-type cell causes accelerated granule loss. This loss is likely to be via a process requiring transport to the plasma membrane, because the reduction in granule accumulation is suppressed in the MN173 background.
|
DISCUSSION
|
|---|
Ciliate DCG formation is driven by protein self-assembly into ordered multisubunit structures (Adoutte et al., 1984
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
TOP
ABSTRACT
INTRODUCTION
