![]() |
|
|
Vol. 16, Issue 9, 4231-4242, September 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892
Submitted March 16, 2005;
Accepted June 20, 2005
Monitoring Editor: Suzanne Pfeffer
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Two different pathways, referred to as "direct" and "indirect," have been proposed to participate in the biosynthetic transport of Lamps to lysosomes (Kornfeld and Mellman, 1989
; Hunziker and Geuze, 1996
; Eskelinen et al., 2003
). The direct pathway is a completely intracellular route that involves transport of newly synthesized Lamps from the trans-Golgi network (TGN) to either early or late endosomes and then to lysosomes (Green et al., 1987
; Carlsson and Fukuda, 1992
; Harter and Mellman, 1992
; Höning and Hunziker, 1995
). In the indirect pathway, in contrast, Lamps are first transported from the TGN to the plasma membrane, after which they are internalized and sequentially delivered to early endosomes, late endosomes, and lysosomes (Lippincott-Schwartz and Fambrough, 1986
; Furuno et al., 1989a
,b
; Nabi et al., 1991
; Mathews et al., 1992
; Gough et al., 1999
). There is consensus that both pathways contribute to the delivery of the Lamps to lysosomes and that the fraction of the Lamps expressed at the cell surface at steady state is low (e.g., 03% of the total Lamp-1; Lippincott-Schwartz and Fambrough, 1986
; Lippincott-Schwartz and Fambrough, 1987
; Harter and Mellman, 1992
). However, estimates of the fraction of newly synthesized Lamps that traffic via the plasma membrane en route to lysosomes vary widely from 4 to 70% of the total (Nabi et al., 1991
; Höning and Hunziker, 1995
). Thus, the exact contribution of endocytic trafficking to the overall delivery of Lamps to lysosomes remains uncertain.
Equally uncertain are the physiological roles of the different AP complexes in the sorting of the Lamps to lysosomes. Although all four AP complexes bind GYXXØ signals in biochemical assays, to date it is not known which of these interactions are required for sorting of the Lamps in vivo. AP-1 is associated with the TGN and endosomes and was first proposed to mediate transport of the Lamps directly from the TGN to endosomes (Höning et al., 1996
). However, embryonic fibroblasts from mice deficient in the µ1A subunit isoform of AP-1 exhibit normal localization of Lamps to lysosomes (Meyer et al., 2000
). AP-2 is exclusively associated with the plasma membrane under normal conditions (Robinson, 1987
) and thus could in principle only participate in the indirect pathway. Its role in the lysosomal targeting of the Lamps in cells, however, has not yet been assessed. AP-3 is mainly associated with an early endosomal tubular network (Dell'Angelica et al., 1998
; Peden et al., 2004
), and cells from humans and mice deficient in AP-3 subunits display increased trafficking of Lamps via the plasma membrane (Le Borgne et al., 1998
; Dell'Angelica et al., 1999b
, 2000
; Peden et al., 2002
, 2004
; Rous et al., 2002
). This has led to the proposal that AP-3 functions to sort Lamps from early to late endosomes in either the direct or indirect pathways (Dell'Angelica et al., 1999b
; Peden et al., 2004
). The steady-state localization of the Lamps to lysosomes, however, is only slightly altered or unaltered in AP-3-deficient cells (Le Borgne et al., 1998
; Dell'Angelica et al., 1999b
, 2000
; Reusch et al., 2002
). Moreover, fibroblasts deficient in both AP-1 and AP-3 also exhibit largely normal distribution of Lamps to lysosomes, confirming that the roles of these two complexes in lysosomal targeting are nonessential (Reusch et al., 2002
). Finally, AP-4 is associated mainly with the TGN (Dell'Angelica et al., 1999a
; Hirst et al., 1999
; Simmen et al., 2002
), but antisense-RNA-mediated depletion of AP-4 showed no effect on the lysosomal transport of Lamp-2 (Simmen et al., 2002
). Adding to the puzzle, ablation of the gene encoding the clathrin heavy chain (CHC) in chicken DT40 cells was reported not to affect the cellular distribution of LEP100, the chicken ortholog of mammalian Lamp-1 (Wettey et al., 2002
). Thus, even the long-assumed role of clathrin in Lamp sorting (Kornfeld and Mellman, 1989
; Hunziker and Geuze, 1996
; Eskelinen et al., 2003
) has been questioned.
To address these issues, we have taken advantage of the ability to suppress expression of specific AP complexes or clathrin using small-interfering RNAs (siRNA) in HeLa cells. This approach allows comparison of the trafficking of the Lamps in cells deficient in the expression of one or more of these coat proteins in the same genetic background. The results of our study show that elimination of clathrin or AP-2, and to a lesser extent the other AP complexes, causes substantial accumulation of the Lamps at the plasma membrane and their decreased transport to lysosomes. These observations demonstrate a significant role for the endocytic machinery in the biosynthetic delivery of the Lamps to lysosomes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-adaptin (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA); CV-24 to LEP100 (gift of D. Fambrough, Johns Hopkins University, Baltimore, MD); DF 1513 to the transferrin receptor (TfR) (CD71), 100/3 to
1-adaptin (Sigma-Aldrich, St. Louis, MO); AP-6 to
-adaptin (Affinity Bioreagents, Golden, CO); X22 (American Type Culture Collection, Manassas, VA) and clone 23 (BD Biosciences, San Diego, CA) to the CHC; W6/32 to human major histocompatibility complex (MHC-I) and 7G7.B6 to human Tac (American Type Culture Collection) and HA.11 to the hemagglutinin (HA) tag (Covance, Princeton, NJ). The following polyclonal antibodies were used: rabbit RY/1 to µ1 (gift of L. Traub, University of Pittsburgh, Pittsburgh, PA); rabbit anti-µ2 (Aguilar et al., 1997); rabbit anti-µ3 (Dell'Angelica et al., 1997
4 (Dell'Angelica et al., 1999); rabbit TB4 anti-human Tac (Aguilar et al., 2001
Recombinant DNA Constructs
The HA-tagged CD63 construct was obtained by PCR amplification of CD63 cDNA and cloned in frame in the EcoRI-SalI sites of the pCI-HA3 vector described by Martina et al., 2003
. LEP100 cDNA in pCB6 vector was a gift of D. Fambrough (Johns Hopkins University, Baltimore, MD). The green fluorescent protein (GFP)-tagged histone H2B was generated as described previously (Dey et al., 2000
). The GFP-tagged Dynamin2 wild-type (WT) and K44A constructs were gifts from M. McNiven (Mayo Clinic, Rochester, MN).
Cell Culture and Transfections
HeLa cells (American Type Culture Collection) were grown in DMEM supplemented with 10% (vol/vol) fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Transfections were carried out using the Lipofectamine reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The cells were analyzed 20 h after transfection.
RNA-mediated Interference (RNAi)
RNAi of CHC and the µ subunits of the AP complexes was performed using siRNAs (QIAGEN, Valencia, CA) to the following human target sequences: GGCAUCAAGUAUCGGAAGA for µ1A, GUGGAUGCCUUUCGGGUCA for µ2, GGAGAACAGUUCUUGCGGC for µ3A, GUCUCGUUUCACAGCUCUG for µ4, GAGCAUGUGCACGCUGGCCA for
-adaptin, and UCCAAUUCGAAGACCAAUU for CHC. A nonfunctional siRNA for human Vps35p to the target sequence GGUCCAGUCAUUCCAAAUG was used as a control. Cells were transfected twice at 72-h intervals with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. The cells were analyzed 4872 h after the second round of transfection. Trypan blue exclusion assays showed the following percentages of viable cells for each RNAi treatment at the time of the experiments: mock, 90; µ1A, 87; µ2, 86; µ3A, 84; and µ4, 66.
RNA Purification and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA isolation was performed using the TRIzol reagent (Invitrogen). RNA concentration was quantified by spectrophotometry. The expression level of µ4 mRNA in mock- and µ4-siRNA-treated cells was determined by RT-PCR using appropriate primers and the SuperScript One Step RT-PCR with Platinum Taq kit (Invitrogen). PCR products were resolved on a 1% (wt/vol) agarose gel containing 5 µg/ml ethidium bromide.
Flow Cytofluorometry
For quantification of cell surface levels of TfR, MHC-I, Lamp-1, Lamp-2 and CD63, 106 transfected cells were harvested, washed in ice-cold 1% bovine serum albumin (BSA)-phosphate-buffered saline (PBS), and then labeled for 1 h at 4°C with the indicated antibody. After three washes in ice-cold BSA-phosphate-buffered saline, the cell surface-associated antibodies were revealed by incubation for 1 h at 4°C with PE-conjugated anti-IgG. The cells were washed three times, fixed in 1% formaldehyde in BSA-phosphate-buffered saline, and flow cytofluorometry was performed on a three-color FACSCalibur flow cytometer equipped with CellQuest prosoftware (BD Biosciences, San Jose, CA). Measurements of forward scatter were used to exclude dead cells and debris.
Antibody Uptake and Endocytosis Assays
Antibody uptake essays were carried out by incubation for 1 h at 37°C of HeLa cells grown on coverslips, in the presence of the indicated antibody diluted in DMEM, 1% BSA, and 25 mM HEPES, pH 7.4. The cells were washed three times in ice-cold PBS, fixed in 4% paraformaldehyde, and incubated for 1 h with Alexa 594-conjugated anti-mouse IgG diluted in 0.1% BSA, 0.1% saponin, PBS. The cells were then washed and mounted on glass slides using Fluoromount G. The rate of endocytosis of TfR and CD63 in mock- and siRNA-treated cells was analyzed using a fluorescence-activated cell sorter (FACS) assay (Schwartz et al., 1996
). The percentage of endocytosis was calculated as follows: [(mo - mx)/mo] 100, where mo is the mean fluorescence at time 0 and mx the mean fluorescence at each time point.
Immunofluorescence Microscopy
Indirect immunofluorescence staining of fixed, permeabilized cells and surface staining of intact cells were performed as described previously (Dell'Angelica et al., 1997
, 1999c). To analyze targeting to lysosomes of newly synthesized Lamps, mock- and µ2 siRNA-treated cells grown on coverslips were transfected with cDNAs encoding LEP100 or HA-CD63 for 6 h and then incubated with 2 µg/ml brefeldin A (BFA) (Sigma-Aldrich) for 12 h to accumulate the newly synthesized proteins in the endoplasmic reticulum (ER). The cells were then washed and incubated for different times at 37°C in regular culture medium. After fixation and permeabilization, the cells were stained using antibodies to LEP100 or HA. Images were acquired on a Zeiss LSM 510 laser scanning confocal microscope (Carl Zeiss, Thornwood, NY) and processed with Adobe Photoshop.
|
-Hexosaminidase activity was measured on 50 µl of each fraction by incubation with 10 mM 4-methylumbelliferyl-2-acetamido-2-deoxy-
-D-glucopyranoside (Sigma-Aldrich) as a substrate (Arighi et al., 2004| RESULTS |
|---|
|
|
|---|
|
1,
,
, and
4 subunits of AP-1, AP-2, AP-3, and AP-4, respectively (Figure 2C) (
1 is a ubiquitously expressed isoform of the
subunit of AP-1). This could be due to degradation of the remaining AP subunits or to their failure to associate with the corresponding target membranes (Dell'Angelica et al., 1999b
FACS analysis of the intact, siRNA-treated cells showed that depletion of clathrin caused a three to fourfold increase and depletion of AP-2 a 5- to 11-fold increase in the levels of Lamp-1, Lamp-2, and CD63 at the cell surface (Figure 3, A and B). For the AP-2-depleted cells, this corresponded to the accumulation of 2545% of the Lamps at the cell surface, as measured by FACS analysis of surface versus intracellular levels (our unpublished data). Similar results were obtained upon siRNA-mediated depletion of another subunit of AP-2,
-adaptin, from HeLa cells (Supplemental Figure 1) as well as depletion of CHC or µ2 from the melanoma cell line Mel JuSo (Supplemental Figure 2). The effects of depleting each of the other AP complexes were smaller (up to 2-fold increase; Figure 3, A and B). Simultaneous depletion of AP-2 and AP-1, or AP-2 and AP-3, however, showed a trend toward greater increases in the surface expression of some of the Lamps relative to the depletion of AP-2 alone (although not all the differences were statistically significant) (Figure 3, A and B). As controls, we showed that depletion of clathrin or AP-2, but not AP-3, increased the surface expression of the TfR and that depletion of either of these proteins had no effect on the expression levels of MHC-I (Figure 3, A and B; our unpublished data). From these experiments, we concluded that clathrin and AP-2 are both required to maintain low levels of the Lamps at the cell surface, whereas the other AP complexes are less important.
|
Inhibition of Lamp Endocytosis in Cells Depleted of AP-2
To determine whether the depletion of AP-1, AP-2, or AP-3 affected the endocytosis of surface Lamps, we performed microscopic antibody uptake experiments. Depletion of AP-1 caused either no increase or a slight increase in the uptake of the antibodies to the three Lamps (Figure 4, compare first and second row), in agreement with previous work using mouse embryonic fibroblasts from µ1A-deficient mice (Meyer et al., 2000
). Depletion of AP-3 caused a more appreciable increase in the uptake of anti-Lamp antibodies (Figure 4, fourth row), a finding that also was in accordance with previous studies on AP-3-deficient human and mouse cells (Le Borgne et al., 1998
; Dell'Angelica et al., 1999b
, 2000
; Meyer et al., 2000
; Peden et al., 2002
, 2004
; Rous et al., 2002
). In contrast, depletion of AP-2 resulted in accumulation of bound antibody on the cell surface (Figure 4, third row). We also used a FACS-based endocytosis assay to examine the effect of depleting AP-2 on the internalization of antibody to CD63, the only of the three Lamps that is expressed at high enough levels on the surface of untreated cells for quantitative analyses (Dell'Angelica et al., 1999b
; Peden et al., 2004
). In line with the microscopic assays, we found that CD63 was rapidly internalized in the mock-treated cells, but not in the AP-2-depleted cells (Supplemental Figure 3). From these experiments, we concluded that the increased expression of Lamps at the surface of AP-2-depleted cells was due to decreased internalization. These experiments also suggested that the small additional effects of AP-1 or AP-3 depletion result from increased Lamp trafficking via the plasma membrane.
|
|
Depletion of AP-2 Impairs the Delivery of Newly Synthesized Lamps to Lysosomes
The experimental results described thus far demonstrate that the endocytic machinery plays a role in the trafficking of Lamps, but they do not provide a measure of the relative importance of this machinery for the biosynthetic delivery of the Lamps to lysosomes. This is because immunofluorescent staining does not distinguish the population of newly synthesized Lamps affected by RNAi from the preexisting pool of Lamps. To examine the effect of AP-2 depletion on a cohort of newly synthesized Lamps, we used two types of "pulse-chase" protocols, one morphological and the other biochemical. The morphological approach consisted of transfecting mock-treated or AP-2-depleted HeLa cells with plasmids encoding LEP100 (i.e., chicken Lamp-1) or human CD63 tagged at the N terminus with the HA epitope (HA-CD63). The expression of these heterologous proteins allowed distinction of the newly synthesized from the preexisting, endogenous pools of Lamps. At 6 h after transfection, the cells were treated with 2 µg/ml BFA for 12 h to arrest export from the ER (Doms et al., 1989
; Lippincott-Schwartz et al., 1989
), while new synthesis of LEP100 and HA-CD63 took place. Proteins were then released from ER retention by removal of the BFA and the transport of LEP100 and HA-CD63 was monitored after different times of chase (Figure 6). Using immunofluorescence microscopy of fixed permeabilized cells, we observed that at the start of the chase both LEP100 and HA-CD63 were in the ER of the mock-treated cells (Figure 6). By 2 h, the presence of LEP100 and HA-CD63 in the Golgi complex was apparent, and from 4 to 11 h they were all in lysosomes (Figure 6). The pattern of staining was the same in the AP-2-depleted cells for up to 2 h; however, staining of the plasma membrane could be observed beginning at 4 h and lasting for up to 911 h (Figure 6). Intracellular vesicular staining also was apparent at 611 h of chase (Figure 6), suggesting that the block in the delivery of the newly synthesized Lamps to lysosomes was not complete.
|
-hexosaminidase activity (Figure 7A) and immunoblotting for Lamp-1 (Figure 7B). The plasma membrane was localized to fractions 1 and 2 by immunoblotting for the Tac antigen (Figure 7B). Other organelles such as the ER, Golgi, and endosomes also are known to band in these lighter fractions (Brown and Swank, 1983
|
| DISCUSSION |
|---|
|
|
|---|
Requirement of Clathrin and AP-2 for Delivery of the Lamps to Lysosomes
Depletion of clathrin caused a three- to fourfold increase in the levels of Lamps at the cell surface and altered the morphology of lysosomes. This role of clathrin is consistent with the localization of Lamp-1 to clathrin-coated areas of the TGN (Höning et al., 1996
) and the plasma membrane (Lippincott-Schwartz and Fambrough, 1987
). It contrasts, however, with a previous report that elimination of CHC expression in a chicken DT40 B cell clone does not alter the distribution of LEP100 (Wettey et al., 2002
). We think that this latter result may be explained by the selection of a rare DT40 clone that adapted to life without clathrin due to evolution of compensatory mechanisms, as is the case for yeast (Seeger and Payne, 1992
).
Because the function of clathrin in protein sorting relies on adaptor proteins that bind to signals in the cytosolic tails of transmembrane proteins, it was expected that a clathrin adaptor also would be required for biosynthetic targeting of the Lamps. Among the various clathrin adaptors that have now been identified (Traub, 2003
; Robinson, 2004
), the heterotetrameric AP complexes were the best candidates because of their ability to bind the YXXØ-type, lysosomal-targeting signals of the Lamps (Bonifacino and Traub, 2003
). The µ2 subunit of AP-2, in particular, binds this type of signal with the highest avidity and broadest specificity (Ohno et al., 1998
). Indeed, we found that depletion of AP-2 caused a 5- to 11-fold increase in the surface expression at steady state and a 4060% decrease in the biosynthetic targeting of three different Lamps to lysosomes. These numbers are likely underestimates given that the siRNA-treated cells still contained
5% of the normal levels of µ2. We do not know why depletion of AP-2 had more of an effect than depletion of clathrin. One possibility is that the residual amount of CHC (1015%) in the siRNA-treated cells may still be sufficient to support substantial targeting. Unlike depletion of AP-2, depletion of AP-1 or AP-3, or the nonclathrin-associated AP-4, singly or in combinations, had only modest effects on the expression of Lamps at the cell surface (
2-fold) and on the overall intracellular distribution of the Lamps. Moreover, in no case did the depletion of these intracellular AP complexes result in localization of the Lamps to the TGN or early endosomes, the two compartments where these complexes are normally located. These findings agree with previous observations made using other approaches to deplete cells of AP-1, AP-3, and/or AP-4 (Le Borgne et al., 1998
; Dell'Angelica et al., 1999b
, 2000
; Meyer et al., 2000
; Peden et al., 2002
, 2004
; Rous et al., 2002
; Simmen et al., 2002
). Together, these observations indicate that, of the four AP complexes, AP-2 is the singly most important one for targeting of the Lamps to lysosomes.
Transport of the Lamps via the Plasma Membrane
The requirement for AP-2 shown here lends support to the notion that a substantial fraction of newly synthesized Lamps are delivered to lysosomes via the plasma membrane. This is because, under normal conditions, AP-2 is exclusively associated with plasma membrane clathrin-coated pits and plasma-membrane-derived clathrin-coated vesicles (Robinson, 1987
), where it plays critical roles in the internalization of endocytic receptors (Conner and Schmid, 2003
; Hinrichsen et al., 2003
; Motley et al., 2003
; Huang et al., 2004
). Only under experimental conditions involving pharmacological perturbation of cells (Wang et al., 1993
) or in vitro recruitment assays (Seaman et al., 1993
; Traub et al., 1996
; West et al., 1997
) has AP-2 been found to associate with other organelles of the endosomal-lysosomal system. It also has been reported that internalized epidermal growth factor (EGF) receptor in A431 cells recruits AP-2 to endosomes in vivo (Sorkina et al., 1999
), but this could be due to the massive wave of internalization elicited by activation of the high number of EGF receptors on these cells (i.e., 24 million/cell) (Wiley, 1988
) and/or the ability of EGF to recruit the endocytic machinery through signaling (Wilde et al., 1999
). We considered the possibility that AP-2 remained associated with the internalized Lamps in endosomes, but immunofluorescence microscopy analyses failed to show any colocalization of AP-2 with an internalized Tac-Lamp-1 chimera in HeLa cells (our unpublished data). Thus, it is unlikely that the requirement of AP-2 for sorting of the Lamps reflects a role for this adaptor on endosomes or other intracellular compartments.
The above-mentioned considerations lead us to conclude that 4060% of Lamps pass through the plasma membrane at some point in their itinerary to lysosomes. This could correspond to the population of Lamps that follow the conventional indirect pathway (Lippincott-Schwartz and Fambrough, 1986
; Furuno et al., 1989a
,b
; Nabi et al., 1991
; Mathews et al., 1992
; Gough et al., 1999
). However, our results are equally consistent with other models that combine elements of the indirect and direct pathways. For example, the appearance of newly synthesized Lamps at the cell surface could be preceded by passage through an endosomal compartment, as shown previously for some plasma membrane proteins (Futter et al., 1995
; Leitinger et al., 1995
; Ang et al., 2004
). In addition, newly synthesized Lamps could undergo several rounds of cycling between the plasma membrane and endosomes before their delivery to lysosomes, as is the case for lysosomal acid phosphatase (Braun et al., 1989
; Prill et al., 1993
). Finally, exocytic fusion of lysosomes with the plasma membrane could generate a pool of surface Lamps that need to be retrieved to lysosomes (Reddy et al., 2001
). Any of these processes would lead to the accumulation of Lamps at the cell surface in the absence of AP-2.
Postendocytic Transport of the Lamps
Once internalized, how do Lamps proceed to lysosomes? AP-3 likely facilitates their transport from early to late endosomes, because AP-3 mutant cells exhibit enhanced recycling to the plasma membrane (Peden et al., 2004
). This role probably explains the additive effect caused by AP-3 depletion on top of AP-2 depletion. In any event, this function of AP-3 does not seem to be essential for the localization of the bulk of the Lamps to lysosomes at steady state (Dell'Angelica et al., 1999b
; Reusch et al., 2002
; Rous et al., 2002
). Similarly, depletion of AP-1 alone or in combination with AP-3 or of AP-4 has little or no effect on the overall distribution of the Lamps (Reusch et al., 2002
; Simmen et al., 2002
; Suppl. Figures 4 and 5). This also rules out these complexes as essential players in the sorting of the Lamps from early to late endosomes and lysosomes. What then accounts for the efficiency of this sorting? Several possibilities can be entertained. First, there could be other adaptor molecules distinct from the AP complexes that recognize GYXXØ signals in endosomes. In fact, about two dozen proteins are now known or presumed to function as clathrin adaptors (Traub, 2003
; Robinson, 2004
). This explanation would be consistent with the proposal that early-to-late endosomal transport of the Lamps is signal mediated (Rohrer et al., 1996
). Second, the extracellular or membrane spanning domains of the Lamps could participate in endosomal sorting. In this regard, the luminal domain of lgp120 (rat Lamp-1) has been shown to contribute to sorting (Reaves et al., 1998
). It also is intriguing that the transmembrane domain of Lamp-1 and Lamp-2 is the domain that exhibits the highest sequence conservation from chicken to mammals (our unpublished observations). Moreover, mutations in the transmembrane domain of the TfR divert this receptor to lysosomes (Zaliauskiene et al., 2000
). Finally, transport of the Lamps from early to late endosomes could occur by default, whereas recycling of endocytic receptors to the plasma membrane could be facilitated by coat proteins. In this regard, clathrin, dynamin, and AP-1 have all been proposed to increase the efficiency of recycling of internalized TfR to the plasma membrane (van Dam and Stoorvogel, 2002
).
Alternative Transport Pathways
Notwithstanding the significant impact of depleting AP-2, roughly half of the Lamps still reach lysosomes in AP-2-depleted cells. Some of this transport could be due to the small amount of AP-2 left in the siRNA-treated cells. It is more likely, however, that this residual transport occurs by a direct pathway (Green et al., 1987
; Carlsson and Fukuda, 1992
; Harter and Mellman, 1992
; Höning and Hunziker, 1995
), involving AP-1, AP-3, and/or AP-4. Indeed, the levels of Lamps at the cell surface increased between 10 and 110% upon depletion of each of these complexes. Moreover, at least for Lamp-1 and Lamp-2, depletion of AP-3 caused additional increases over those elicited by depletion of AP-2 alone. Therefore, intracellular sorting events mediated by these complexes do contribute to the overall delivery of Lamps to lysosomes, perhaps through their participation in the direct pathway. The limited effects caused by depletion of these complexes, however, raises the possibility that the AP-2-independent component of Lamp targeting is also independent of the other AP complexes. In this regard, it is noteworthy that mutation of the critical tyrosine residue in the cytosolic tail of lgp120 results in only 39% of the protein being displayed at the cell surface (Harter and Mellman, 1992
), which suggests the existence of a pathway that is GYXXØ-signal independent, and hence, AP-independent sorting. As discussed in the previous paragraph for sorting from early to late endosomes, AP-independent sorting could involve another type of adaptor or coat or could be dependent on luminal or transmembrane determinants.
Concluding Remarks
Because the depletion of AP complexes by RNAi takes place over several days in culture, our conclusions are subject to three important caveats. First, the effects of depleting clathrin or AP-2 on Lamp trafficking could be indirect, for instance by trapping at the cell surface a key protein (e.g., a SNARE) that is required for Lamp sorting at an intracellular site. The fact that the GYXXØ-signals from the Lamps bind directly and with highest avidity to AP-2, however, makes it likely that the effects are direct. Second, as discussed above for clathrin mutant cells, RNAi-treated cells could adapt to the loss of AP-1, AP-3, or AP-4, by up-regulating compensatory mechanisms. Simultaneous depletion of these complexes would address the question of whether adaptation to the loss of one AP complex involves enhancement of a pathway mediated by another AP complex. Unfortunately we have been unable to attain complete elimination of all three complexes without significant loss of cell viability, so addressing their potentially redundant role in Lamp trafficking will require more controlled approaches to interfere with their functions. Finally, depletion of AP-1, AP-3, or AP-4 could affect the kinetics of delivery of Lamps to lysosomes while having minimal effects on their steady-state distribution. Despite these caveats, our results do support the main conclusion of our study that clathrin and AP-2 play critical roles in Lamp trafficking, which emphasizes the importance of the endocytic machinery for efficient targeting of the Lamps to lysosomes.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Juan S. Bonifacino (bonifacinoj{at}mail.nih.gov).
| REFERENCES |
|---|
|
|
|---|
Aguilar, R. C., Boehm, M., Gorshkova, I., Crouch, R. J., Tomita, K., Saito, T., Ohno, H., and Bonifacino, J. S. ((2001). ). Signal-binding specificity of the µ4 subunit of the adaptor protein complex, AP-4. J. Biol. Chem. 276, , 13145-13152.
Altschuler, Y., Barbas, S. M., Terlecky, L. J., Tang, K., Hardy, S., Mostov, K. E., and Schmid, S. L. ((1998). ). Redundant and distinct functions for dynamin-1 and dynamin-2 isoforms. J. Cell Biol. 143, , 1871-1881.
Ang, A. L., Taguchi, T., Francis, S., Fölsch, H., Murrells, L. J., Pypaert, M., Warren, G., and Mellman, I. ((2004). ). Recycling endosomes can serve as intermediates during transport from the Golgi to the plasma membrane of MDCK cells. J. Cell Biol. 167, , 531-543.
Arighi, C. N., Hartnell, L. M., Aguilar, R. C., Haft, C. R., and Bonifacino, J. S. ((2004). ). Role of the mammalian retromer in sorting of the cation-independent mannose 6-phosphate receptor. J. Cell Biol. 165, , 123-133.
Barriocanal, J. G., Bonifacino, J. S., Yuan, L., and Sandoval, I. V. ((1986). ). Biosynthesis, glycosylation, movement through the Golgi system, and transport to lysosomes by an N-linked carbohydrate-independent mechanism of three lysosomal integral membrane proteins. J. Biol. Chem. 261, , 16755-16763.
Boll, W., Ohno, H., Songyang, Z., Rapoport, I., Cantley, L. C., Bonifacino, J. S., and Kirchhausen, T. ((1996). ). Sequence requirements for the recognition of tyrosine-based endocytic signals by clathrin AP-2 complexes. EMBO J. 15, , 5789-5795.[Medline]
Bonifacino, J. S., and Dell'Angelica, E. C. ((1998). ). Immunoprecipitation. In: Current Protocols in Cell Biology, ed. J. S. Bonifacino, M. Dasso, J. B. Harford, J. Lippincott-Schwartz, and K. Yamada, New York: John Wiley & Sons.
Bonifacino, J. S., and Traub, L. M. ((2003). ). Signals for Sorting of Transmembrane Proteins to Endosomes and Lysosomes. Annu. Rev. Biochem. 72, , 395-447.[CrossRef][Medline]
Braun, M., Waheed, A., and von Figura, K. ((1989). ). Lysosomal acid phosphatase is transported to lysosomes via the cell surface. EMBO J. 8, , 3633-3640.[Medline]
Brown, J. A., and Swank, R. T. ((1983). ). Subcellular redistribution of newly synthesized macrophage lysosomal enzymes. Correlation between delivery to the lysosomes and maturation. J. Biol. Chem. 258, , 15323-15328.
Carlsson, S. R., and Fukuda, M. ((1992). ). The lysosomal membrane glycoprotein lamp-1 is transported to lysosomes by two alternative pathways. Arch. Biochem. Biophys. 296, , 630-639.[CrossRef][Medline]
Conner, S. D., and Schmid, S. L. ((2003). ). Differential requirements for AP-2 in clathrin-mediated endocytosis. J. Cell Biol. 162, , 773-779.
Damke, H., Baba, T., Warnock, D. E., and Schmid, S. L. ((1994). ). Induction of mutant dynamin specifically blocks endocytic coated vesicle formation. J. Cell Biol. 127, , 915-934.
Dell'Angelica, E. C., Aguilar, R. C., Wolins, N., Hazelwood, S., Gahl, W. A., and Bonifacino, J. S. ((2000). ). Molecular characterization of the protein encoded by the Hermansky-Pudlak syndrome type 1 gene. J. Biol. Chem. 275, , 1300-1308.
Dell'Angelica, E. C., Klumperman, J., Stoorvogel, W., and Bonifacino, J. S. ((1998). ). Association of the AP-3 adaptor complex with clathrin. Science 280, , 431-434.
Dell'Angelica, E. C., Mullins, C., and Bonifacino, J. S. ((1999a). ). AP-4, a novel protein complex related to clathrin adaptors. J. Biol. Chem. 274, , 7278-7285.
Dell'Angelica, E. C., Ohno, H., Ooi, C. E., Rabinovich, E., Roche, K. W., and Bonifacino, J. S. ((1997). ). AP-3, an adaptor-like protein complex with ubiquitous expression. EMBO J. 15, , 917-928.[CrossRef]
Dell'Angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., and Bonifacino, J. S. ((1999b). ). Altered trafficking of lysosomal membrane proteins in Hermansky-Pudlak syndrome due to mutations in the
3A subunit of the AP-3 adaptor complex. Mol. Cell 3, , 11-21.[CrossRef][Medline]
Dey, A., Ellenberg, J., Farina, A., Coleman, A. E., Maruyama, T., Sciortino, S., Lippincott-Schwartz, J., and Ozato, K. ((2000). ). A bromodomain protein, MCAP, associates with mitotic chromosomes and affects G(2)-to-M transition. Mol. Cell. Biol. 20, , 6537-6549.
Doms, R. W., Russ, G., and Yewdell, J. W. ((1989). ). Brefeldin A redistributes resident and itinerant Golgi proteins to the endoplasmic reticulum. J. Cell Biol. 109, , 61-72.
Eskelinen, E. L., Tanaka, Y., and Saftig, P. ((2003). ). At the acidic edge: emerging functions for lysosomal membrane proteins. Trends Cell Biol. 13, , 137-145.[CrossRef][Medline]
Furuno, K., Ishikawa, T., Akasaki, K., Yano, S., Tanaka, Y., Yamaguchi, Y., Tsuji, H., Himeno, M., and Kato, K. ((1989a). ). Morphological localization of a major lysosomal membrane glycoprotein in the endocytic membrane system. J. Biochem. 106, , 708-716.
Furuno, K., Yano, S., Akasaki, K., Tanaka, Y., Yamaguchi, Y., Tsuji, H., Himeno, M., and Kato, K. ((1989b). ). Biochemical analysis of the movement of a major lysosomal membrane glycoprotein in the endocytic membrane system. J. Biochem. 106, , 717-722.
Futter, C. E., Connolly, C. N., Cutler, D. F., and Hopkins, C. R. ((1995). ). Newly synthesized transferrin receptors can be detected in the endosome before they appear on the cell surface. J. Biol. Chem. 270, , 10999-11003.
Gough, N. R., Zweifel, M. E., Martinez-Augustin, O., Aguilar, R. C., Bonifacino, J. S., and Fambrough, D. M. ((1999). ). Utilization of the indirect lysosome targeting pathway by lysosome-associated membrane proteins (LAMPs) is influenced largely by the C-terminal residue of their GYXXØ targeting signals. J. Cell Sci. 112, , 4257-4269.[Abstract]
Green, S. A., Zimmer, K. P., Griffiths, G., and Mellman, I. ((1987). ). Kinetics of intracellular transport and sorting of lysosomal membrane and plasma membrane proteins. J. Cell Biol. 105, , 1227-1240.
Harter, C., and Mellman, I. ((1992). ). Transport of the lysosomal membrane glycoprotein lgp120 (lgp-A) to lysosomes does not require appearance on the plasma membrane. J. Cell Biol. 117, , 311-325.
Hinrichsen, L., Harborth, J., Andrees, L., Weber, K., and Ungewickell, E. J. ((2003). ). Effect of clathrin heavy chain- and
-adaptin-specific small inhibitory RNAs on endocytic accessory proteins and receptor trafficking in HeLa cells. J. Biol. Chem. 278, , 45160-45170.
Hirst, J., Bright, N. A., Rous, B., and Robinson, M. S. ((1999). ). Characterization of a fourth adaptor-related protein complex. Mol. Biol. Cell 10, , 2787-2802.
Höning, S., Griffith, J., Geuze, H. J., and Hunziker, W. ((1996). ). The tyrosine-based lysosomal targeting signal in lamp-1 mediates sorting into Golgi-derived clathrin-coated vesicles. EMBO J. 15, , 5230-5239.[Medline]
Höning, S., and Hunziker, W. ((1995). ). Cytoplasmic determinants involved in direct lysosomal sorting, endocytosis, and basolateral targeting of rat lgp120 (lamp-I) in MDCK cells. J. Cell Biol. 128, , 321-332.
Huang, F., Khvorova, A., Marshall, W., and Sorkin, A. ((2004). ). Analysis of clathrin-mediated endocytosis of epidermal growth factor receptor by RNA interference. J. Biol. Chem. 279, , 16657-16661.
Hunziker, W., and Geuze, H. J. ((1996). ). Intracellular trafficking of lysosomal membrane proteins. Bioessays 18, , 379-389.[CrossRef][Medline]
Jones, S. M., Howell, K. E., Henley, J. R., Cao, H., and McNiven, M. A. ((1998). ). Role of dynamin in the formation of transport vesicles from the trans-Golgi network. Science 279, , 573-577.
Kasai, K., Shin, H. W., Shinotsuka, C., Murakami, K., and Nakayama, K. ((1999). ). Dynamin II is involved in endocytosis but not in the formation of transport vesicles from the trans-Golgi network. J. Biochem. 125, , 780-789.
Kirchhausen, T. ((1999). ). Adaptors for clathrin-mediated traffic. Annu. Rev. Cell Dev. Biol. 15, , 705-732.[CrossRef][Medline]
Kornfeld, S., and Mellman, I. ((1989). ). The biogenesis of lysosomes. Annu. Rev. Cell Biol. 5, , 483-525.[CrossRef][Medline]
Le Borgne, R., Alconada, A., Bauer, U., and Hoflack, B. ((1998). ). The mammalian AP-3 adaptor-like complex mediates the intracellular transport of lysosomal membrane glycoproteins. J. Biol. Chem. 273, , 29451-29461.
Leitinger, B., Hille-Rehfeld, A., and Spiess, M. ((1995). ). Biosynthetic transport of the asialoglycoprotein receptor H1 to the cell surface occurs via endosomes. Proc. Natl. Acad. Sci. USA 92, , 10109-10113.
Lippincott-Schwartz, J., and Fambrough, D. M. ((1986). ). Lysosomal membrane dynamics: structure and interorganellar movement of a major lysosomal membrane glycoprotein. J. Cell Biol. 102, , 1593-1605.
Lippincott-Schwartz, J., and Fambrough, D. M. ((1987). ). Cycling of the integral membrane glycoprotein, LEP100, between plasma membrane and lysosomes: kinetic and morphological analysis. Cell 49, , 669-677.[CrossRef][Medline]
Lippincott-Schwartz, J., Yuan, L. C., Bonifacino, J. S., and Klausner, R. D. ((1989). ). Rapid redistribution of Golgi proteins into the ER in cells treated with brefeldin A: evidence for membrane cycling from Golgi to ER. Cell 56, , 801-813.[CrossRef][Medline]
Martina, J. A., Moriyama, K., and Bonifacino, J. S. ((2003). ). BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4. J. Biol. Chem. 278, , 29376-29384.
Mathews, P. M., Martinie, J. B., and Fambrough, D. M. ((1992). ). The pathway and targeting signal for delivery of the integral membrane glycoprotein LEP100 to lysosomes. J. Cell Biol. 118, , 1027-1040.
Meyer, C., Zizioli, D., Lausmann, S., Eskelinen, E. L., Hamann, J., Saftig, P., von Figura, K., and Schu, P. ((2000). ). mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. EMBO J. 19, , 2193-2203.[CrossRef][Medline]
Motley, A., Bright, N. A., Seaman, M. N., and Robinson, M. S. ((2003). ). Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162, , 909-918.
Nabi, I. R., Le Bivic, A., Fambrough, D., and Rodriguez-Boulan, E. ((1991). ). An endogenous MDCK lysosomal membrane glycoprotein is targeted basolaterally before delivery to lysosomes. J. Cell Biol. 115, , 1573-1584.
Naslavsky, N., Weigert, R., and Donaldson, J. G. ((2003). ). Convergence of non-clathrin- and clathrin-derived endosomes involves Arf6 inactivation and changes in phosphoinositides. Mol. Biol. Cell 14, , 417-431.
Ohno, H., Aguilar, R. C., Yeh, D., Taura, D., Saito, T., and Bonifacino, J. S. ((1998). ). The medium subunits of adaptor complexes recognize distinct but overlapping sets of tyrosine-based sorting signals. J. Biol. Chem. 273, , 25915-25921.
Ohno, H., Fournier, M. C., Poy, G., and Bonifacino, J. S. ((1996). ). Structural determinants of interaction of tyrosine-based sorting signals with the adaptor medium chains. J. Biol. Chem. 271, , 29009-29015.
Ohno, H., Stewart, J., Fournier, M. C., Bosshart, H., Rhee, I., Miyatake, S., Saito, T., Gallusser, A., Kirchhausen, T., and Bonifacino, J. S. ((1995). ). Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science 269, , 1872-1875.
Peden, A. A., Oorschot, V., Hesser, B. A., Austin, C. D., Scheller, R. H., and Klumperman, J. ((2004). ). Localization of the AP-3 adaptor complex defines a novel endosomal exit site for lysosomal membrane proteins. J. Cell Biol. 164, , 1065-1076.
Peden, A. A., Rudge, R. E., Lui, W. W., and Robinson, M. S. ((2002). ). Assembly and function of AP-3 complexes in cells expressing mutant subunits. J. Cell Biol. 156, , 327-336.
Prill, V., Lehmann, L., von Figura, K., and Peters, C. ((1993). ). The cytoplasmic tail of lysosomal acid phosphatase contains overlapping but distinct signals for basolateral sorting and rapid internalization in polarized MDCK cells. EMBO J. 12, , 2181-2193.[Medline]
Reaves, B. J., Banting, G., and Luzio, J. P. ((1998). ). Lumenal and transmembrane domains play a role in sorting type I membrane proteins on endocytic pathways. Mol. Biol. Cell 9, , 1107-1122.
Reddy, A., Caler, E. V., and Andrews, N. W. ((2001). ). Plasma membrane repair is mediated by Ca(2+)-regulated exocytosis of lysosomes. Cell 106, , 157-169.[CrossRef][Medline]
Reusch, U., Bernhard, O., Koszinowski, U., and Schu, P. ((2002). ). AP-1A and AP-3A lysosomal sorting functions. Traffic 3, , 752-761.[CrossRef][Medline]
Robinson, M. S. ((1987). ). 100-kD coated vesicle proteins: molecular heterogeneity and intracellular distribution studied with monoclonal antibodies. J. Cell Biol. 104, , 887-895.
Robinson, M. S. ((2004). ). Adaptable adaptors for coated vesicles. Trends Cell Biol. 14, , 167-174.[CrossRef][Medline]
Rohrer, J., Schweizer, A., Russell, D., and Kornfeld, S. ((1996). ). The targeting of Lamp1 to lysosomes is dependent on the spacing of its cytoplasmic tail tyrosine sorting motif relative to the membrane. J. Cell Biol. 132, , 565-576.
Rous, B. A., Reaves, B. J., Ihrke, G., Briggs, J. A., Gray, S. R., Stephens, D. J., Banting, G., and Luzio, J. P. ((2002). ). Role of adaptor complex AP-3 in targeting wild-type and mutated CD63 to lysosomes. Mol. Biol. Cell 13, , 1071-1082.
Schwartz, O., Marechal, V., Le Gall, S., Lemonnier, F., and Heard, J. M. ((1996). ). Endocytosis of major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nat. Med. 2, , 338-342.[CrossRef][Medline]
Seaman, M. N., Ball, C. L., and Robinson, M. S. ((1993). ). Targeting and mistargeting of plasma membrane adaptors in vitro. J. Cell Biol. 123, , 1093-1105.
Seeger, M., and Payne, G. S. ((1992). ). A role for clathrin in the sorting of vacuolar proteins in the Golgi complex of yeast. EMBO J. 11, , 2811-2818.[Medline]
Simmen, T., Höning, S., Icking, A., Tikkanen, R., and Hunziker, W. ((2002). ). AP-4 binds basolateral signals and participates in basolateral sorting in epithelial MDCK cells. Nat. Cell Biol. 4, , 154-159.[CrossRef][Medline]
Sorkina, T., Bild, A., Tebar, F., and Sorkin, A. ((1999). ). Clathrin, adaptors and eps15 in endosomes containing activated EGF receptors. J. Cell Sci. 112, , 317-327.[Abstract]
Traub, L. M. ((2003). ). Sorting it out: AP-2 and alternate clathrin adaptors in endocytic cargo selection. J. Cell Biol. 163, , 203-208.
Traub, L. M., Bannykh, S. I., Rodel, J. E., Aridor, M., Balch, W. E., and Kornfeld, S. ((1996). ). AP-2-containing clathrin coats assemble on mature lysosomes. J. Cell Biol. 135, , 1801-1814.
van Dam, E. M., and Stoorvogel, W. ((2002). ). Dynamin-dependent transferrin receptor recycling by endosome-derived clathrin-coated vesicles. Mol. Biol. Cell 13, , 169-182.
Wang, L.-H., Rothberg, K. G., and Anderson, R.G.W. ((1993). ). Mis-assembly of clathrin lattices on endosomes reveals a regulatory switch for coated pit formation. J. Cell Biol. 123, , 1107-1117.
West, M. A., Bright, N. A., and Robinson, M. S. ((1997). ). The role of ADP-ribosylation factor and phospholipase D in adaptor recruitment. J. Cell Biol. 138, , 1239-1254.
Wettey, F. R., Hawkins, S. F., Stewart, A., Luzio, J. P., Howard, J. C., and Jackson, A. P. ((2002). ). Controlled elimination of clathrin heavy-chain expression in DT40 lymphocytes. Science 297, , 1521-1525.
Wilde, A., Beattie, E. C., Lem, L., Riethof, D. A., Liu, S. H., Mobley, W. C., Soriano, P., and Brodsky, F. M. ((1999). ). EGF receptor signaling stimulates SRC kinase phosphorylation of clathrin, influencing clathrin redistribution and EGF uptake. Cell 96, , 677-687.[CrossRef][Medline]
Wiley, H. S. ((1988). ). Anomalous binding of EGF to A431 cells is due to the effect of high receptor densities and a saturable endocytic system. J. Cell Biol. 107, , 801-810.
Williams, M. A., and Fukuda, M. ((1990). ). Accumulation of membrane glycoproteins in lysosomes requires a tyrosine residue at a particular position in the cytoplasmic tail. J. Cell Biol. 111, , 955-966.
Zaliauskiene, L., Kang, S., Brouillette, C. G., Lebowitz, J., Arani, R. B., and Collawn, J. F. ((2000). ). Down-regulation of cell surface receptors is modulated by polar residues within the transmembrane domain. Mol. Biol. Cell 11, , 2643-2655.
Zhen, L., et al. ((1999). ). Abnormal expression and subcellular distribution of subunit proteins of the AP-3 adaptor complex lead to platelet storage pool deficiency in the pearl mouse. Blood 94, , 146-155.
This article has been cited by other articles:
![]() |
N. Masuyama, T. Kuronita, R. Tanaka, T. Muto, Y. Hirota, A. Takigawa, H. Fujita, Y. Aso, J. Amano, and Y. Tanaka HM1.24 Is Internalized from Lipid Rafts by Clathrin-mediated Endocytosis through Interaction with {alpha}-Adaptin J. Biol. Chem., June 5, 2009; 284(23): 15927 - 15941. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schmidt, H.-G. Joost, and A. Schurmann GLUT8, the enigmatic intracellular hexose transporter Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E614 - E618. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chaudhuri, R. Mattera, O. W. Lindwasser, M. S. Robinson, and J. S. Bonifacino A Basic Patch on {alpha}-Adaptin Is Required for Binding of Human Immunodeficiency Virus Type 1 Nef and Cooperative Assembly of a CD4-Nef-AP-2 Complex J. Virol., March 15, 2009; 83(6): 2518 - 2530. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Lau and M. M. Chou The adaptor complex AP-2 regulates post-endocytic trafficking through the non-clathrin Arf6-dependent endocytic pathway J. Cell Sci., December 15, 2008; 121(24): 4008 - 4017. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Robila, M. Ostankovitch, M. L. Altrich-VanLith, A. C. Theos, S. Drover, M. S. Marks, N. Restifo, and V. H. Engelhard MHC Class II Presentation of gp100 Epitopes in Melanoma Cells Requires the Function of Conventional Endosomes and Is Influenced by Melanosomes J. Immunol., December 1, 2008; 181(11): 7843 - 7852. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Keyel, J. R. Thieman, R. Roth, E. Erkan, E. T. Everett, S. C. Watkins, J. E. Heuser, and L. M. Traub The AP-2 Adaptor {beta}2 Appendage Scaffolds Alternate Cargo Endocytosis Mol. Biol. Cell, December 1, 2008; 19(12): 5309 - 5326. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ruiz-Mateos, A. Pelchen-Matthews, M. Deneka, and M. Marsh CD63 Is Not Required for Production of Infectious Human Immunodeficiency Virus Type 1 in Human Macrophages J. Virol., May 15, 2008; 82(10): 4751 - 4761. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Beekman and P. J. Coffer The ins and outs of syntenin, a multifunctional intracellular adaptor protein J. Cell Sci., May 1, 2008; 121(9): 1349 - 1355. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Baust, M. Anitei, C. Czupalla, I. Parshyna, L. Bourel, C. Thiele, E. Krause, and B. Hoflack Protein Networks Supporting AP-3 Function in Targeting Lysosomal Membrane Proteins Mol. Biol. Cell, May 1, 2008; 19(5): 1942 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Craige, G. Salazar, and V. Faundez Phosphatidylinositol-4-Kinase Type II Alpha Contains an AP-3-sorting Motif and a Kinase Domain That Are Both Required for Endosome Traffic Mol. Biol. Cell, April 1, 2008; 19(4): 1415 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Lekishvili, E. Fromm, M. Mujoomdar, and F. Berditchevski The tumour-associated antigen L6 (L6-Ag) is recruited to the tetraspanin-enriched microdomains: implication for tumour cell motility J. Cell Sci., March 1, 2008; 121(5): 685 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato, J. Aoki, N. Misawa, E. Daikoku, K. Sano, Y. Tanaka, and Y. Koyanagi Modulation of Human Immunodeficiency Virus Type 1 Infectivity through Incorporation of Tetraspanin Proteins J. Virol., January 15, 2008; 82(2): 1021 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Berger, G. Salazar, M. L. Styers, K. A. Newell-Litwa, E. Werner, R. A. Maue, A. H. Corbett, and V. Faundez The subcellular localization of the Niemann-Pick Type C proteins depends on the adaptor complex AP-3 J. Cell Sci., October 15, 2007; 120(20): 3640 - 3652. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Lubben, D. A. Sahlender, A. M. Motley, P. J. Lehner, P. Benaroch, and M. S. Robinson HIV-1 Nef-induced Down-Regulation of MHC Class I Requires AP-1 and Clathrin but Not PACS-1 and Is Impeded by AP-2 Mol. Biol. Cell, September 1, 2007; 18(9): 3351 - 3365. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Mardones, P. V. Burgos, D. A. Brooks, E. Parkinson-Lawrence, R. Mattera, and J. S. Bonifacino The Trans-Golgi Network Accessory Protein p56 Promotes Long-Range Movement of GGA/Clathrin-containing Transport Carriers and Lysosomal Enzyme Sorting Mol. Biol. Cell, September 1, 2007; 18(9): 3486 - 3501. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jolly and Q. J. Sattentau Human Immunodeficiency Virus Type 1 Assembly, Budding, and Cell-Cell Spread in T Cells Take Place in Tetraspanin-Enriched Plasma Membrane Domains J. Virol., August 1, 2007; 81(15): 7873 - 7884. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Holmes, A. Flett, D. Coudreuse, H. C. Korswagen, and J. Pettitt C. elegans Disabled is required for cell-type specific endocytosis and is essential in animals lacking the AP-3 adaptor complex J. Cell Sci., August 1, 2007; 120(15): 2741 - 2751. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Camus, C. Segura-Morales, D. Molle, S. Lopez-Verges, C. Begon-Pescia, C. Cazevieille, P. Schu, E. Bertrand, C. Berlioz-Torrent, and E. Basyuk The Clathrin Adaptor Complex AP-1 Binds HIV-1 and MLV Gag and Facilitates Their Budding Mol. Biol. Cell, August 1, 2007; 18(8): 3193 - 3203. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kametaka, K. Moriyama, P. V. Burgos, E. Eisenberg, L. E. Greene, R. Mattera, and J. S. Bonifacino Canonical Interaction of Cyclin G associated Kinase with Adaptor Protein 1 Regulates Lysosomal Enzyme Sorting Mol. Biol. Cell, August 1, 2007; 18(8): 2991 - 3001. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Finzi, A. Orthwein, J. Mercier, and E. A. Cohen Productive Human Immunodeficiency Virus Type 1 Assembly Takes Place at the Plasma Membrane J. Virol., July 15, 2007; 81(14): 7476 - 7490. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Beckmann, S. Scheitza, P. Wernet, J. C. Fischer, and B. Giebel Asymmetric cell division within the human hematopoietic stem and progenitor cell compartment: identification of asymmetrically segregating proteins Blood, June 15, 2007; 109(12): 5494 - 5501. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chaudhuri, O. W. Lindwasser, W. J. Smith, J. H. Hurley, and J. S. Bonifacino Downregulation of CD4 by Human Immunodeficiency Virus Type 1 Nef Is Dependent on Clathrin and Involves Direct Interaction of Nef with the AP2 Clathrin Adaptor J. Virol., April 15, 2007; 81(8): 3877 - 3890. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. David, M.-C. Tiveron, A. Defays, C. Beclin, V. Camosseto, E. Gatti, H. Cremer, and P. Pierre BAD-LAMP defines a subset of early endocytic organelles in subpopulations of cortical projection neurons J. Cell Sci., January 15, 2007; 120(2): 353 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pak, W. K. Glowacka, M. C. Bruce, N. Pham, and D. Rotin Transport of LAPTM5 to lysosomes requires association with the ubiquitin ligase Nedd4, but not LAPTM5 ubiquitination J. Cell Biol., November 20, 2006; 175(4): 631 - 645. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Latysheva, G. Muratov, S. Rajesh, M. Padgett, N. A. Hotchin, M. Overduin, and F. Berditchevski Syntenin-1 Is a New Component of Tetraspanin-Enriched Microdomains: Mechanisms and Consequences of the Interaction of Syntenin-1 with CD63 Mol. Cell. Biol., October 15, 2006; 26(20): 7707 - 7718. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salazar, B. Craige, M. L. Styers, K. A. Newell-Litwa, M. M. Doucette, B. H. Wainer, J. M. Falcon-Perez, E. C. Dell'Angelica, A. A. Peden, E. Werner, et al. BLOC-1 Complex Deficiency Alters the Targeting of Adaptor Protein Complex-3 Cargoes Mol. Biol. Cell, September 1, 2006; 17(9): 4014 - 4026. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Di Pietro, J. M. Falcon-Perez, D. Tenza, S. R.G. Setty, M. S. Marks, G. Raposo, and E. C. Dell'Angelica BLOC-1 Interacts with BLOC-2 and the AP-3 Complex to Facilitate Protein Trafficking on Endosomes Mol. Biol. Cell, September 1, 2006; 17(9): 4027 - 4038. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nydegger, S. Khurana, D. N. Krementsov, M. Foti, and M. Thali Mapping of tetraspanin-enriched microdomains that can function as gateways for HIV-1 J. Cell Biol., June 5, 2006; 173(5): 795 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohno Physiological Roles of Clathrin Adaptor AP Complexes: Lessons from Mutant Animals J. Biochem., June 1, 2006; 139(6): 943 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Miedel, K. M. Weixel, J. R. Bruns, L. M. Traub, and O. A. Weisz Posttranslational Cleavage and Adaptor Protein Complex-dependent Trafficking of Mucolipin-1 J. Biol. Chem., May 5, 2006; 281(18): 12751 - 12759. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Theos, D. Tenza, J. A. Martina, I. Hurbain, A. A. Peden, E. V. Sviderskaya, A. Stewart, M. S. Robinson, D. C. Bennett, D. F. Cutler, et al. Functions of Adaptor Protein (AP)-3 and AP-1 in Tyrosinase Sorting from Endosomes to Melanosomes Mol. Biol. Cell, November 1, 2005; 16(11): 5356 - 5372. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||