|
|
|
|
Vol. 16, Issue 9, 4375-4385, September 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





* Department of Internal Medicine l, Medical University of Ulm, Ulm 89081, Germany;
Afdeling Biochemie, Katholieke Universiteit Leuven, 3000 Leuven, Belgium
Submitted March 24, 2005;
Revised May 12, 2005;
Accepted June 9, 2005
Monitoring Editor: Vivek Malhotra
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The various biological roles of PKD1 are regulated by both its catalytic activity and its subcellular localization that are modulated by its regulatory domain (Iglesias and Rozengurt, 1999
; Oancea et al., 2003
). Functional differences between PKD isoforms could therefore arise from distinct effects of the regulatory domain on the catalytic activity and the subcellular localization of the respective enzyme.
The regulatory domain at the NH2-terminal region of PKDs consists of a tandem repeat of cysteine-rich zinc finger-like motifs termed C1a and C1b and a pleckstrin homology (PH) domain (Rykx et al., 2003
). Cysteine-rich zinc finger-like motifs are present in a variety of proteins, including PKCs (Wang et al., 2003
), chimaerin (Areces et al., 1994
), and UNC-13 (Kazanietz et al., 1995
), and they play multiple roles in enzyme regulation. In PKD1, the C1a/C1b domain is responsible for the majority of phorbol ester binding (Iglesias et al., 1998
) and acts as a membrane targeting module that shuttles PKD1 between different subcellular compartments (Rykx et al., 2003
). Furthermore, deletion of the C1a, the C1b, or the PH subdomain, respectively, leads to the constitutive activation of PKD1, suggesting that these subdomains have a negative/inhibitory impact on its catalytic activity (Iglesias and Rozengurt, 1998
). The PH domain also has been shown to mediate nuclear export, whereas the C1b domain regulates nuclear import of PKD1 (Rey et al., 2001
). At present little is known about whether the various PKD isoforms are regulated and act in a similar manner or exhibit distinct regulatory and functional properties. There is controversy as to the localization of PKD2. It has been suggested that in contrast to PKD1 and 3, PKD2 activation does not induce its redistribution from the cytoplasm to the nucleus (Rey et al., 2003a
). Furthermore, we have recently demonstrated that in contrast to PKD1, activation of nuclear factor-
B by PKD2 in response to oxidative stress does not require its catalytic activity (Mihailovic et al., 2004
). Thus, PKD2 could have distinct regulatory properties compared with the other PKD isoenzymes.
Here, we have analyzed the role of the regulatory domain of PKD2 in phorbol ester binding, the control of catalytic activity, and its subcellular localization by using live cell imaging. We show that the PH domain in PKD2 is a negative regulator of enzyme activity, which is similar to PKD1. However, in marked contrast to PKD1, the C1a/C1b domain of PKD2 plays a positive/stimulatory role in the regulation of the catalytic activity. In particular the C1b motif is required for phorbol ester binding as well as basal and GPCR-stimulated kinase activity of PKD2. Using live cell imaging of PKD2 fused to green fluorescent protein (EGFP), we show that PKD2 shuttles continuously between the cytoplasm and the nucleus of epithelial tumor cells. Activation of the cholecystokinin (CCK)B receptor provokes nuclear accumulation of PKD2. Mutational analysis of the regulatory domain revealed a functional nuclear export signal (NES) in the C1a domain and a functional nuclear localization sequence (NLS) in the linker region between the C1a and the C1b domain of PKD2. Thus, there is a sophisticated regulation of PKD2 activity and nucleocytoplasmic shuttling by the cysteine-rich domain of PKD2. The C1b domain is mainly responsible for phorbol-12,13-dibutyrate (PDBu) binding and catalytic activity, whereas the C1 domain and the linker region regulate nucleocytoplasmic shuttling. These data point to a functional role of PKD2 in the nucleus and demonstrate marked differences in the control of catalytic activity and subcellular localization of PKD1 and PKD2 by their regulatory domain, which could determine isoform-specific signaling properties.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of PKD2 Mutants
PKD2 and PKD2 mutants were ligated into pEGFP-C2 (BD Biosciences Clontech, Palo Alto, CA) or a pcDNA3 expression plasmid (Invitrogen, Carlsbad, CA) containing a N-terminal FLAG-tag (a kind gift of Dr. Franz Oswald, University of Ulm, Ulm, Germany). Deletion of the entire C1a/C1b domain (H139-C314; 176 amino acids) and deletion of the PH domain (T397-M509; 113 amino acids) were performed directly in pcDNA3 by a splice-overlap PCR strategy using Taq-Polymerase (Invitrogen). These primers were used resulting in the deletion of the C1a/C1b domain: EcoRI5' (5' gcgaattcgccaccgccccctctt 3'), 3'
C1a/C1b (5' ctcccccagcgggcggatctggaa 3'), 5'
C1a/C1b (5' atccgcccgctgggggaggccctt 3'), and 3'XbaI (5' gaatagggccctctagatgcatgc 3'). These primers resulted in the deletion of the PH domain: EcoRI5' (5' gcgaattcgccaccgccccctctt 3'), 3'
PH (5' gatgacggggctggatttccgcgt 3'), 5'
PH (5' aaatccagccccgtcatccttcag 3'), and 3'XbaI (5' gaatagggccctctagatgcatgc 3'). Deletions of the C1a domain (H139-P185; 47 amino acids) and C1b domain (H265-C314; 50 amino acids) were made in pEGFP-PKD2 by PCR with primers containing specific restriction sites. The deletion of the C1a domain was established with primers EcoRI5' (5' gcgaattcgccaccgccccctctt 3'), 3'ApaI (5' ccgtgagggcccgcgggcgg 3') and cloned into EGFP-PKD2. Primers for the deletion of the C1b domain are the following: EcoRI5' (5' gcgaattcgccaccgccccctctt 3'), 3'SalI (5' cgacgcgtcgaccttggagagc 3'), 5'SalI (5' acgcgtcgactgcctgggggag 3'), and 3'XbaI(5' gaatagggccctctagatgcatgc 3'). Site-specific mutations within EGFP-PKD2, resulting both in single and double amino acid substitutions (D695A, S706/710E, L159/V163A, and K193A/R194G) were performed by a PCR approach using the QuikChange site-directed mutagenesis system (Stratagene, La Jolla, CA) according to the manufacturer's instructions. All these constructs were confirmed by DNA sequence analysis.
AGS-B, HEK293, and PANC-1 Cell Transfection
Exponentially growing AGS-B, HEK293, or PANC-1 cells (5 x 104 cells/35 mm dish) were transfected with EGFP- or FLAG-tagged PKD2 or the respective PKD2 mutants as indicated in the figure legends using FuGENE (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. The cells were used for experimental purposes 48 h after transfection.
PDBu Binding to HEK293 Cells
To determine the binding of [3H]PDBu to intact HEK293 cells, cells transfected with either pEGFP, pEGFP-PKD2, or the respective mutants were washed twice with DMEM and incubated with binding medium (DMEM containing 1 mg/ml bovine serum albumin and 10 nM [3H]PDBu) at 37°C for 30 min. Cells were then rapidly washed at 4°C with phosphate-buffered saline (PBS), lysed, and bound radioactivity was determined using a Beckman beta-scintillation counter. Nonspecific binding was determined in the presence of 10 µM PDBu.
Western Blotting and Immunoprecipitations
For immunoprecipitations, HEK293 or AGS-B cells in 35-mm dishes were transfected with various plasmids as described above and lysed in a solution containing 50 mM Tris-HCl, pH 7.6, 2 mM EGTA, 2 mM EDTA, 2 mM dithiothreitol (DTT), protease inhibitors (aprotinin [10 µg/ml], leupeptin [100 µg/ml], pepstatin (0.7 µg/ml), 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride), and 1% Triton X-100 (lysis buffer I). Proteins were immunoprecipitated with the anti-EGFP or anti-FLAG antibody and further analyzed by Western blotting using various antibodies as indicated in the figure legends. Immunoreactive bands were visualized using horseradish peroxidase-conjugated antimouse IgG followed by enhanced chemiluminescence (ECL).
Crm-1 Binding Assay
Nuclear extracts of HEK293 cells transfected with FLAG-PKD2 constructs were prepared from 5 x 106 cells as described by Dignam et al. (1983
). Immunoprecipitations were performed for 1 h using an anti-FLAG monoclonal antibody (mAb) (Sigma, St. Louis, MO), respectively. Western Blots were performed as described above.
In Vitro Kinase Assays
To examine PKD2 autokinase activity and in vitro histone phosphorylation by PKD2 and its mutants, anti-EGFP immunoprecipitates were prepared as described above. Immune complexes were washed twice with lysis buffer I, twice with lysis buffer II (buffer I without Triton X-100) and twice with kinase buffer (30 mM Tris-HCl, pH 7.4, 10 mM MgCl2, and 1 mM DTT) and then resuspended in 20 µl of kinase buffer in the presence (for histone phosphorylation) or absence (for autokinase activity) of 0.5 mg/ml histone H1 and 100 µM [
-32P]ATP. Reactions were incubated for 10 min at 30°C, terminated by adding an equal amount of 2x SDS-PAGE sample buffer, and further analyzed by SDS-PAGE, followed by autoradiography. Autoradiographs were further analyzed by scanning densitometry using the MacBAS V2.5 software (Fuji Photo Film, Tokyo, Japan).
Immunofluorescence Studies
After the indicated transfections and stimulations, AGS-B cells were immediately fixed with 4% formaldehyde for 10 min. Antibodies were added overnight in PBS at 4°C. After washing in PBS, cells were incubated with Alexa-coupled secondary antibodies (Dianova, Hamburg, Germany) for 1 h at room temperature. Slides were finally embedded in Mowiol (Calbiochem, San Diego, CA).
Live Cell Imaging and Fluorescence Intensity Evaluation
Imaging of living and fixed cells expressing EGFP-tagged proteins was performed with a confocal laser scanning microscope (LSM 510 META; Carl Zeiss, Jena, Germany) equipped with a 488-nm argon laser. For live cell imaging cells were grown and transfected in MatTek glass-bottomed dishes (MatTek, Ashland, MA). Forty-eight hours after transfection cells were maintained in DMEM supplemented with 30 mM HEPES, pH 7.0. During the measurements the medium was kept at 37°C in an atmosphere containing 5% CO2 using a LSM 510 Incubator S (Carl Zeiss). Gastrin (100 nM) stimulation of the cells was performed 40 min before imaging or fixation, respectively. After incubation with LMB cells were maintained at 37°C for 1 h before imaging or fixation. Samples were imaged with detector slit widths of 500-548 nm using a 63x oil (1.4 numerical aperture) immersion objective. Quantitative analysis of the nuclear and cytoplasmic fluorescence intensity was performed on images of the midsection of living or fixed cells. The midsection was first determined by a Z-stack. The nuclear/cytoplasmic ratio of fluorescence intensity was quantified using the Image J public domain Java image processing program (http://rsb.info.nih.gov/ij/download.htm). For quantification, the fluorescence intensity in the cytoplasmic or nuclear compartment was determined in a 0.5 x 0.5-µm square that was centered in the nucleus or cytoplasm, respectively (2 values per cell). Due to the more inhomogeneous cytoplasmic distribution of EGFP-PKD2 in gastrin stimulated AGS-B cells four values in different areas of the cytoplasm were examined and combined to generate the cytoplasmic value. Results are the means of the fluorescence intensity determined in 20 cells expressing EGFP-PKD2-WT or the respective EGFP-PKD2 mutants. The relative nuclear fluorescence intensity was calculated using the following equation: Finuclear:
Finuc/n/
Ficyt/n. Finuc is the fluorescence intensity in the nucleus, Ficyt is the relative fluorescence intensity in the cytoplasm, and n is the number of cells examined.
Fluorescence Loss in Photobleaching (FLIP)
To monitor nucleocytoplasmic shuttling of the EGFP fusion proteins, live cell imaging was performed as described above. A time series of images was recorded after 20-min stimulation of cells with 100 nM gastrin. The bleach rate for each series of images was calculated and used to correct the fluorescence intensities of the images. For qualitative FLIP analysis, cells imaged using the 488-nm line of an argon laser of a Zeiss LSM510 META confocal microscope operating at 40% laser power and 5% transmission (imaging intensity). Four imaging scans of a single cell were performed. Then, the cytoplasm was chosen as region of interest by the LSM 510 Meta software and selectively bleached four times with 100% transmission (bleaching intensity) 30 s each, followed by imaging scans at the times indicated in the figure. At least 10 data sets were analyzed for each time point. The background corrected nuclear fluorescence at the time before the initial photobleaching was set as 100%. The data points were fitted with a nonlinear curve using GraphPad Prism software (GraphPad Software, San Diego, CA).
Materials
[
-32P]ATP (5000 Ci/mmol; 37 GBq = 1 mCi) was from Amersham Biosciences (Piscataway, NJ). [3H]PDBu (20 Ci/mmol) was purchased from MP Biomedicals (Strasbourg, France). The anti-Golgin 97 antibody directed against a peripheral membrane protein localized on the cytoplasmic face of the Golgi apparatus was from Molecular Probes (Leiden, The Netherlands). The anti-CRM-1 and the anti-importin
/Rch-1 antibodies were from BD Transduction Laboratories (Lexington, KY). The monoclonal anti-RNA polymerase II (Pol-II) antibody was from BAbCO (Richmond, CA). The monoclonal anti-green fluorescent protein (GFP) antibody was obtained from Roche Diagnostics. The polyclonal antiphospho-PKD1/protein kinase Cµ Ser744/Ser748 antibody was obtained from Cell Signaling Technology (Beverly, MA). This antibody was raised against a synthetic phospho-Ser744/Ser748 peptide corresponding to residues surrounding Ser744/Ser748. This sequence is identical in PKD1 and PKD2 with the corresponding serine residues in PKD2 being Ser706 and Ser710. The anti-PKD2 antibody was from Orbigen (San Diego, CA). The anti-PKD1 antibody D-20 was purchased from Upstate Biotechnology (Charlottesville, VA). All other reagents were of the highest grade available.
| RESULTS |
|---|
|
|
|---|
PH), the entire cysteine-rich domain (PKD2-
C1a/C1b), or only the C1a (PKD2-
C1a) and C1b (PKD2-
C1b) domain, respectively (Figure 1). All mutants exhibited a similar level of expression upon transfection (Figure 2A). [3H]PDBu binding of PKD2-
PH was comparable with wild-type PKD2. In contrast, deletion of the entire C1a/C1b domain abolished phorbol ester binding. The PKD2 mutant lacking the C1a domain was still able to bind phorbol esters, but binding was reduced by
50% compared with wild-type PKD2 (Figure 2A). In contrast, the mutant lacking the C1b domain exhibited virtually no detectable [3H]PDBu binding. Thus, the cysteine-rich domain and in particular the C1b domain is essential for [3H]PDBu binding to the enzyme.
|
|
Regulation of PKD2 Kinase Activity by the Regulatory Domain
To determine the role of the C1a/C1b domain and the PH domain for PKD2 kinase activity, HEK293 cells were transfected with various EGFP-tagged PKD2 expression plasmids: wild-type PKD2; PKD2-S706/710E, in which Ser706 and Ser710 within the activation loop of the kinase are replaced with Glu, rendering the kinase constitutively active (Mihailovic et al., 2004
); PKD2-
PH, a mutant lacking the PH domain; PKD2-D695A, a catalytically inactive mutant of PKD2 that was generated by replacing the Asp in the DFG motif by Ala and PKD2-
C1a/C1b, which lacks the entire C1a/C1b domain. All plasmids exhibited similar levels of expression (Figure 2B).
Deletion of the PH domain in PKD2 results in a marked increase in PKD2 catalytic activity as demonstrated by autokinase activity as well as in vitro kinase assays using histone as substrate. The catalytic activity of PKD2-
PH was comparable to the constitutively active PKD2-S706/710E mutant (Figure 2B). In contrast, deletion of the C1a/C1b domain results in only a slight increase in the basal catalytic activity compared with wild-type PKD2. Thus, the PH domain is a negative regulator of PKD2 catalytic activity, whereas the C1a/C1b domain seems to have only a weak, if at all, inhibitory effect on kinase activity.
To further define the regulatory properties of the C1a/C1b domain, we examined the catalytic activity of mutants lacking the C1a or the C1b domain, respectively, in an epithelial tumor cell model, AGS-B human gastric cancer cells. Again, basal activity of PKD2-
C1a/C1b was only slightly increased compared with wild-type PKD2 and could be further enhanced by incubation of cells with gastrin. PKD2-
C1a exhibited only a small, not significant increase in basal kinase activity, which was comparable to PKD2-
C1a/C1b. Incubation of cells with gastrin led to a marked increase in catalytic activity of PKD2-
C1a, which was comparable to that of PKD2-
C1a/C1b and reached
60% of wild-type PKD2 (Figure 3A). In marked contrast, PKD2-
C1b exhibited a rather low basal catalytic activity. Treatment of cells with gastrin led only to a small increase in catalytic activity which was comparable to that of wild-type PKD2 in unstimulated AGS-B cells. Similar data were obtained when cells were incubated with PDBu (our unpublished data). Thus, the C1b domain seems to be crucial for PKD2 catalytic activity. PKD2-
C1b does not bind phorbol esters (Figure 2A). However, this mutant is still phosphorylated at the critical residues Ser706/Ser710 in the activation loop in response to gastrin (Sturany et al., 2002
; Figure 3B) and also in response to PDBu (our unpublished data). Thus, phosphorylation of PKD2 by PKCs at these residues is not sufficient to confer maximum PKD2 catalytic activity in the absence of lipid binding to the C1b domain.
|
In conclusion, the C1a and the C1b motif differ substantially with respect to their effect on the catalytic activity of PKD2. The PKD2-
C1a/C1b mutant and in particular the less extensive deletions of the C1a and the C1b domain revealed that neither of these domains plays a negative role in the regulation of PKD2 activity. In contrast, the C1b domain seems to be required for the activation of PKD2 and can therefore be regarded as a positive regulator of PKD2 catalytic activity.
Subcellular Localization of PKD2 in AGS-B Human Gastric Cancer Cells
Regulatory domains not only modify the catalytic activity but also regulate the subcellular localization of protein kinases (Filhol et al., 2003
). So far, very little is known about the subcellular localization of PKD2. It has been questioned whether PKD2 can localize to the nuclear compartment under physiological conditions (Rey et al., 2003a
). To visualize the subcellular localization of PKD2, AGS-B human gastric cancer cells were transfected with EGFP-tagged wild-type PKD2. The majority of the EGFP signal was detected in the cytoplasm. Some fluorescence was also visible in the perinuclear region. Costaining with the Golgi marker Golgin revealed that perinuclear PKD2 largely localized to the Golgi compartment in accordance with previous data obtained in Madin-Darby canine kidney cells (Yeaman et al., 2004
). To further determine the subcellular localization of PKD2 in response to a physiological stimulus, AGS-B cells were treated with gastrin that potently induces activation of the kinase via the CCKB receptor (Sturany et al., 2002
). Gastrin treatment of AGS-B cells provoked an accumulation of EGFP-PKD2 at the plasma membrane and in particular in the nucleus. A marked, 8.5-fold increase in the nucleo/cytoplasmic fluorescence ratio of EGFP-PKD2 could be observed (Figure 4A, top). Nuclear localization of PKD2 was confirmed by costaining of cells with an anti-Pol-II antibody that detects nuclear RNA polymerase II. In the presence of gastrin, EGFP-PKD2 and Pol-II immunoreactivity were both detectable in the nuclear compartment (Figure 4B). Endogenous PKD2 immunoreactivity was mainly detectable in the cytoplasm and the perinuclear area of unstimulated AGS-B cells (Figure 4C). We confirmed that the antibody used to detect endogenous PKD2 only detects PKD2 and no other isoforms of the PKD family (Figure 4C). On treatment of cells with gastrin, there was a 3.5-fold increase in the nucleo/cytoplasmic fluorescence ratio of endogenous PKD2 using an antibody that selectively detects the kinase. Thus, endogenous as well as transfected PKD2 accumulate in the nucleus upon incubation of AGS-B cells with gastrin.
|
Nucleocytoplasmic Shuttling of PKD2 Is Regulated by a Crm-1-dependent Mechanism
Next, we examined how PKD2 shuttles between the cytoplasm and the nucleus. For nuclear export, most proteins rely on a hydrophobic NES and its recognition by Crm-1, an NES receptor in the nuclear pore complex. We found that PKD2 coimmunoprecipitates with Crm-1 (Figure 5A), suggesting a Crm-1 dependent nuclear export mechanism for PKD2. The interaction of Crm-1 with PKD2 was independent of its catalytic activity (our unpublished data). Leptomycin B (LMB) is an antifungal antibiotic that has been shown to inhibit NES-dependent nuclear export by binding to Crm-1 (Kudo et al., 1998
; Nishi et al., 1994
). Indeed, LMB treatment of live AGS-B cells resulted in a striking, 24-fold increase in the nucleo/cytoplasmic fluorescence ratio of EGFP-PKD2, which was not further enhanced in the presence of gastrin (Figure 5B). Nuclear fluorescence intensity did not increase when cells were transfected with the EGFP vector alone and subsequently incubated with LMB (our unpublished data). There was also a sevenfold increase in the nucleo/cytoplasmic fluorescence ratio of endogenous PKD2 in the presence of LMB in AGS-B cells. Again, gastrin did not further increase nuclear PKD2 immunoreactivity in LMB-treated cells (Figure 5C). Thus, PKD2 is not restricted in its mobility in living cells and shuttles between the nucleus and the cytoplasm by a Crm-1 dependent mechanism. The fact that very little endogenous PKD2 as well as EGFP-PKD2 is detectable in the cytoplasm upon treatment of cells with LMB suggests that most of the cellular PKD2 participates in the nucleocytoplasmic shuttling. A marked increase in nuclear PKD2 upon treatment with LMB also could be observed in other cell lines such as Panc-1 human pancreatic cancer cells, COS-7, HEK293, and HeLa cells (Figure 5D; our unpublished data).
|
Role of the Regulatory Domains for Nucleocytoplasmic Shuttling of PKD2
The NES is a short leucine-rich sequence motif that binds Crm-1 and is necessary to mediate active nuclear export (Gorlich and Mattaj, 1996
). NES transport motifs regulate the intracellular localization of a variety of proteins (Xu and Massague, 2004
). It has been demonstrated that the PH domain in PKD1 contains a nuclear export signal (Rey et al., 2001
). The PKD2 mutant lacking the entire PH domain, EGFP-PKD2-
PH, was predominantly localized in the cytoplasm and around the nucleus of unstimulated, living AGS-B cells, but it did not accumulate in the nucleus (Figure 6A). Only upon incubation of AGS-B cells with gastrin and in the presence of LMB EGFP-PKD2-
PH was clearly detectable in the nucleus, resulting in a 10- and 21-fold increase in the nucleo/cytoplasmic fluorescence ratio, respectively. Thus, the subcellular localization of PKD2-
PH in unstimulated, living cells resembles closely that of wild-type PKD2 (Figure 6A), demonstrating that the PH domain in PKD2 does not contain a functional NES.
|
C1a/1b was found predominantly in the cytoplasm of unstimulated, living AGS-B cells. On gastrin treatment, EGFP-PKD2-
C1a/1b increased in the perinuclear area and to a lesser degree also in the nucleus. There was only a 2.7-fold increase in the nucleo/cytoplasmic fluorescence ratio of PKD2-
C1a/1b in response to gastrin in living cells. Even in the presence of LMB the nucleo/cytoplasmic fluorescence ratio of PKD2-
C1a/1b increased only by 4.6-fold. These data demonstrate that nuclear accumulation of PKD2 is, at least in part, prevented when the C1a/C1b domain is missing even under conditions that inhibit Crm-1-dependent nuclear export (Figure 6B). Therefore, this domain of PKD2 is likely to play a role in the regulation of nuclear entry.
The C1a/C1b Domain of PKD2 Contains a Functional Nuclear Localization Sequence
Importin-
is the nuclear import receptor that recognizes cargo proteins carrying conventional basic monopartite and bipartite NLSs (Chook and Blobel, 2001
). First, we determined whether PKD2 can interact with importin-
. As shown in Figure 6C, importin-
coimmunoprecipitates with PKD2, suggesting that the nuclear uptake of PKD2 is mediated by importin-
. The binding of importin-
to PKD2 was constitutive (our unpublished data). However, the amount of importin-
that coprecipitated with PKD2 was markedly reduced when the C1a/C1b domain of the kinase was missing in accordance with our finding that nuclear accumulation of PKD2-
C1a/C1b is reduced compared with wild-type PKD2 (Figure 6C). Next, we examined whether the PKD2 sequence contains a potential NLS. NLSs are classified into various categories. The classical NLS exhibits a 4 residue pattern composed of four basic amino acids (K or R; pat4 NLS) (Hicks and Raikhel, 1995
). A bipartite NLS is characterized by two basic residues, a 10-residue spacer, and another basic region consisting of at least three basic residues out of five residues (Robbins et al., 1991
). The zinc finger region of PKD1 contains a putative bipartite nuclear entry signal (Rey et al., 2001
). A similar signal sequence can be found in PKD2 at the C terminus of the C1a domain and in the linker region between C1a and C1b. The second part of this bipartite NLS in the linker region between C1a and C1b of PKD2 (192RKRR195) is itself a monopartite pat4 NLS (Figure 7). To determine the functional relevance of this sequence, the lysine residue 193 and the arginine residue 194 were changed to alanine and glycine, respectively. This mutant, EGFP-PKD2-K193A/R194G, was largely localized in the cytoplasm of unstimulated, living AGS-B cells. Interestingly, there was no detectable nuclear accumulation of EGFP-PKD2-K193A/R194G upon treatment of cells with gastrin and even in the presence of LMB despite the fact that PKD2-K193A/R194G exhibited a similar increase in catalytic activity as wild-type PKD2 in response to gastrin treatment of cells (our unpublished data). Consequently, there was no change in the nucleo/cytoplasmic fluorescence ratio of EGFP-PKD2-K193A/R194G in response to gastrin or LMB. Thus, the monopartite pat4 NLS in the linker region between the C1a and the C1b domain of PKD2 is indeed functional (Figure 6C).
|
The C1a Domain Is Required for Nuclear Export of PKD2 in Living Cells
The C1a domain of PKD2 contains the first 11 AA of the putative bipartite NLS at its C terminus (Figure 7). To analyze whether this part of the bipartite NLS also was relevant for nuclear import of PKD2, we examined the subcellular localization of the PKD2-
C1a mutant. Surprisingly, PKD2-
C1a was largely detectable in the nucleus already in unstimulated, living AGS-B cells. The nucleo/cytoplasmic fluorescence ratio of PKD2-
C1a in unstimulated AGS-B cells was well comparable to that of wild-type PKD2 in gastrin-treated cells. Consequently, incubation of cells with gastrin did not further increase nuclear accumulation of PKD2-
C1a (Figure 8A). Quantification of the nucleo/cytoplasmic fluorescence ratio of PKD2-
C1a revealed that only the complete block of Crm-1-dependent nuclear export by LMB was able to induce a slight, 1.5-fold increase in this ratio. Accordingly, binding of PKD2 to Crm-1 was markedly reduced when the C1a domain was missing (Figure 8A). Thus, the C1a domain contains a functional nuclear export signal rather than a nuclear localization sequence.
|
C1a Trafficking by FLIP
C1a and wild-type PKD2 with the cytoplasm, AGS-B cells were transfected with EGFP-PKD2-
C1a or EGFP-PKD2, respectively, and incubated with gastrin for 20 min. Subsequently, the cytoplasm was repetitively and selectively bleached, and we asked whether EGFP-PKD2-
C1a and EGFP-PKD2 fluorescence decreased in the nucleus as a consequence of nucleocytoplasmic shuttling. As shown in Figure 8B, the FLIP experiments revealed that there was a substantial loss of nuclear fluorescence of EGFP-PKD2 in living cells after bleaching of the cytoplasm. In contrast, there was very little loss of nuclear fluorescence of EGFP-PKD2-
C1a. Quantification of the data confirmed that EGFP-PKD2 does considerably move between the nucleus and the cytoplasm of AGS-B cells in response to gastrin. Half of the nuclear fluorescence of EGFP-PKD2 was lost 220 s after bleaching of the cytoplasm, and an apparent plateau of 10% of the initial fluorescence was reached after 700 s (Figure 8B, bottom). This kinetics is comparable to the loss of nuclear fluorescence of nucleoporin 98, which shows an NF1/2 of
3 min and reaches an apparent final plateau of 8% of the initial fluorescence after
20 min (Griffis et al., 2002
C1a decreased only by
20% of the initial fluorescence compared with PKD2 in the presence of LMB. Thus, movement of PKD2 from the nucleus to the cytoplasm is substantially decreased when the C1a domain is missing. This further demonstrates that the C1a domain contains a functional NES.
|
|
C1b also could play a role in the regulation of nucleocytoplasmic shuttling of PKD2. As shown in Figure 10B, PKD2-
C1b was largely detectable in the cytoplasm of unstimulated, living AGS-B cells. This is in marked contrast to PKD2-
C1a. Furthermore, upon treatment of cells with gastrin, there was only a twofold increase in nuclear fluorescence intensity. This could suggest that this sequence contains a functional NLS. However, by blocking the Crm-1-dependent nuclear export with LMB we observed a marked, 14-fold increase in the nucleo/cytoplasmic fluorescence ratio of PKD2-
C1b, which was comparable to that of wild-type PKD2 (Figure 10B). Thus, nuclear entry is apparently not blocked upon deletion of the C1b domain of PKD2 and this mutant is still able to shuttle between the cytoplasm and the nucleus. Because PKD2-
C1b is not activated by gastrin treatment of cells (Figure 3A), the lack of catalytic activity could explain why gastrin treatment of AGS-B cells does not lead to an increase in nuclear fluorescence intensity of this mutant. | DISCUSSION |
|---|
|
|
|---|
Role of the Regulatory Domain in Phorbol Ester Binding and Catalytic Activity of PKD2
We found that the PH domain of PKD2 does not bind PDBu and is a negative regulator of PKD2 kinase activity. Thus, the PH domain in PKD2 plays a similar role in the regulation of catalytic activity as the PH domain in PKD1 (Iglesias and Rozengurt, 1998
). The C1a and the C1b domain of PKD2 differ substantially in their ability to mediate specific phorbol ester binding to the kinase. The C1b domain was found to be responsible for the majority of PDBu binding. Again, these data are in good agreement with the findings in PKD1 (Iglesias et al., 1998
). However, deletion of the entire cysteine-rich domain of PKD2 led only to a minor increase in the basal catalytic activity of PKD2 that could be further enhanced by treatment of cells with gastrin. In PKD1, deletion of the entire C1a/C1b domain, the C1a or the C1b motif, respectively, leads to maximum activation of the enzyme. Consequently, this domain also has been termed a negative regulator of PKD1 activity (Iglesias and Rozengurt, 1999
). In PKD2, selective deletion of the PKD2-C1a domain did not increase basal catalytic activity and even more striking, deletion of the PKD2-C1b domain resulted in a complete loss of catalytic activity even upon incubation of cells with gastrin and despite phosphorylation of the mutant at Ser706/Ser710 in the activation loop. Thus, despite a sequence homology between the C1a/C1b subdomains of PKD1 and 2, the C1b domain in PKD2 is a positive regulator of catalytic activity because lipid binding to this domain is required for its activation even if PKCs phosphorylate the critical serine residues in the activation loop.
PKD2 Shuttles between the Cytoplasm and the Nucleus
Regulatory domains also can modulate the subcellular localization of a protein. Our data show that PKD2 localizes to similar compartments as PKD1 and PKD3, the plasma membrane and the Golgi (Maeda et al., 2001
; Hausser et al., 2002
) but also the nucleus (Rey et al., 2001
, 2003b
). It has been reported that activation of PKD2 does not induce its redistribution from the cytoplasm to the nucleus (Rey et al., 2003a
). Our data in living AGS-B cells but also in other cell lines indicate that PKD2 shuttles continuously between the cytoplasm and the nucleus by a Crm-1-dependent nuclear export mechanism. Furthermore, activation of GPCRs leads to a marked nuclear accumulation of PKD2. This finding does not exclude the fact that the precise localization of members of the PKD family may at least in part be cell type specific.
We did not detect a marked difference in the subcellular distribution of wild-type PKD2 and PKD2-
PH in AGS-B cells, suggesting that catalytic activity alone is not sufficient to trigger translocation of PKD2 to distinct subcellular compartments. Interestingly, there was no nuclear accumulation of PKD2-
PH, demonstrating that the PH domain of PKD2 has no obvious effect on nucleocytoplasmic shuttling. Thus, in marked contrast to PKD1 (Rey et al., 2001
), this domain does not mediate nuclear export of PKD2.
Functional Domains Involved in Nucleocytoplasmic Distribution of PKD2
The subcellular distribution of a PKD2-
C1a/C1b mutant was mainly cytoplasmic and hence similar to that of wild-type PKD2 in unstimulated AGS-B cells. However, the C1a/C1b domain contains a potential bipartite NLS at the C terminus of the C1a domain and a pat4 NLS in the linker region between the C1a and C1b domain. Mutation of the pat4 NLS (K193A/R194G) revealed that the lysine residue 193 and the arginine residue 194 are instrumental for efficient nuclear targeting of PKD2. Surprisingly, live cell imaging and our FLIP experiments revealed that C1a domain contains a functional NES. Here, the leucine residue 159 and the valine residue 163 were found to be crucial for nuclear export of PKD2. Thus, the potential NLS at the C terminus of the C1a subdomain does not seem to be functionally relevant and the NES is the predominant functional localization signal in this sequence. The NES motif as well as the bipartite NLS motif is highly conserved between PKD1, 2, and 3, suggesting that these domains could play similar roles in all members of the PKD family. It has been reported that the C1a domain of PKD1 does not interfere with nuclear import but slightly accumulated in the nucleus (Rey et al., 2001
). However, the precise role of the PKD1-C1a domain for nucleocytoplasmic shuttling has not been elucidated, and the sequence deleted to generate this mutant comprised the C1a domain including the linker region with the pat4 NLS (Rey et al., 2001
). We found no increase in nuclear PKD2-
C1b even in the presence of gastrin. However, in contrast to PKD1 (Rey et al., 2001
), there was a marked increase in nuclear PKD2-
C1b upon treatment of cells with leptomycin B. This suggests that PKD2-
C1b is still able to shuttle between the cytoplasm and the nucleus. Similar findings were obtained using a catalytically inactive PKD2-D695A mutant (our unpublished data). Therefore, the lack of nuclear accumulation of PKD2-
C1b is most likely due to the fact that this mutant cannot be activated by treatment of cells with gastrin.
In conclusion, examination of the regulatory domain of PKD2 revealed similarities, but also striking differences to the published data on PKD1 despite the high sequence homology. Our data demonstrate that the C1a/C1b domain in PKD2 has complex regulatory properties: The C1b domain is the major receptor for phorbol esters and plays a positive role in the regulation of catalytic activity, whereas the C1a domain and the linker region between C1a and C1b tightly regulate nucleocytoplasmic shuttling of the enzyme. It is suspected that in vivo, the substrate specificity of a kinase is likely to be determined both by affinity for its regulatory subunit that brings the kinase in proximity to the substrate and by subcellular localization. The ability to define the specific subcellular localization of PKD2 might enable us to gain further insight into compartment-specific signaling properties of this enzyme.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Present address: NMI, 72770 Reutlingen, Germany. ![]()
Address correspondence to: Thomas Seufferlein (thomas.seufferlein{at}medizin.uni-ulm.de).
| REFERENCES |
|---|
|
|
|---|
Chook, Y. M., and Blobel, G. ((2001). ). Karyopherins and nuclear import. Curr. Opin. Struct. Biol. 11, , 703-715.[CrossRef][Medline]
Dignam, J. D., Martin, P. L., Shastry, B. S., and Roeder, R. G. ((1983). ). Eukaryotic gene transcription with purified components. Methods Enzymol. 101, , 582-598.[Medline]
Filhol, O., Nueda, A., Martel, V., Gerber-Scokaert, D., Benitez, M. J., Souchier, C., Saoudi, Y., and Cochet, C. ((2003). ). Live-cell fluorescence imaging reveals the dynamics of protein kinase CK2 individual subunits. Mol. Cell. Biol. 23, , 975-987.
Gorlich, D., and Mattaj, I. W. ((1996). ). Nucleocytoplasmic transport. Science 271, , 1513-1518.[Abstract]
Griffis, E. R., Altan, N., Lippincott-Schwartz, J., and Powers, M. A. ((2002). ). Nup98 is a mobile nucleoporin with transcription-dependent dynamics. Mol. Biol. Cell 13, , 1282-1297.
Hausser, A., Link, G., Bamberg, L., Burzlaff, A., Lutz, S., Pfizenmaier, K., and Johannes, F. J. ((2002). ). Structural requirements for localization and activation of PKC mu (PKC mu) at the Golgi compartment. J. Cell Biol. 156, , 65-74.
Hayashi, A., Seki, N., Hattori, A., Kozuma, S., and Saito, T. ((1999). ). PKCnu, a new member of the PKC family, composes a fourth subfamily with PKCmu. Biochim. Biophys. Acta 1450, , 99-106.[Medline]
Hicks, G. R., and Raikhel, N. V. ((1995). ). Protein import into the nucleus: an integrated view. Annu. Rev. Cell. Dev. Biol. 11, , 155-188.[CrossRef][Medline]
Iglesias, T., Matthews, S., and Rozengurt, E. ((1998). ). Dissimilar phorbol ester binding properties of the individual cysteine-rich motifs of protein kinase D. FEBS Lett. 437, , 19-23.[CrossRef][Medline]
Iglesias, T., and Rozengurt, E. ((1998). ). Protein kinase D activation by mutations within its pleckstrin homology domain. J. Biol. Chem. 273, , 410-416.
Iglesias, T., and Rozengurt, E. ((1999). ). Protein kinase D activation by deletion of its cysteine-rich motifs. FEBS Lett. 454, , 53-56.[CrossRef][Medline]
Kazanietz, M. G., Lewin, N. E., Bruns, J. D., and Blumberg, P. M. ((1995). ). Characterization of the cysteine-rich region of the Caenorhabditis elegans protein Unc-13 as a high affinity phorbol ester receptor. Analysis of ligand-binding interactions, lipid cofactor requirements, and inhibitor sensitivity. J. Biol. Chem. 270, , 10777-10783.
Kudo, N., Wolff, B., Sekimoto, T., Schreiner, E. P., Yoneda, Y., Yanagida, M., Horinouchi, S., and Yoshida, M. ((1998). ). Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1. Exp. Cell Res. 242, , 540-547.[CrossRef][Medline]
Lippincott-Schwartz, J., Snapp, E., and Kenworthy, A. ((2001). ). Studying protein dynamics in living cells. Nat. Rev. Mol. Cell. Biol. 2, , 444-456.[CrossRef][Medline]
Maeda, Y., Beznoussenko, G. V., Van Lint, J., Mironov, A. A., and Malhotra, V. ((2001). ). Recruitment of protein kinase D to the trans-Golgi network via the first cysteine-rich domain. EMBO J. 20, , 5982-5990.[CrossRef][Medline]
Manning, G., Whyte, D. B., Martinez, R., Hunter, T., and Sudarsanam, S. ((2002). ). The protein kinase complement of the human genome. Science 298, , 1912-1934.
Mihailovic, T., Marx, M., Auer, A., Van Lint, J., Schmid, M., Weber, C., and Seufferlein, T. ((2004). ). Protein kinase D2 mediates activation of nuclear factor
B by Bcr-Abl in Bcr-Abl+ human myeloid leukemia cells. Cancer Res. 64, , 8939-8944.
Nishi, K., Yoshida, M., Fujiwara, D., Nishikawa, M., Horinouchi, S., and Beppu, T. ((1994). ). Leptomycin B targets a regulatory cascade of crm1, a fission yeast nuclear protein, involved in control of higher order chromosome structure and gene expression. J. Biol. Chem. 269, , 6320-6324.
Oancea, E., Bezzerides, V. J., Greka, A., and Clapham, D. E. ((2003). ). Mechanism of persistent protein kinase D1 translocation and activation. Dev. Cell 4, , 561-574.[CrossRef][Medline]
Rey, O., Sinnett-Smith, J., Zhukova, E., and Rozengurt, E. ((2001). ). Regulated nucleocytoplasmic transport of protein kinase D in response to G protein-coupled receptor activation. J. Biol. Chem. 276, , 49228-49235.
Rey, O., Yuan, J., and Rozengurt, E. ((2003a). ). Intracellular redistribution of protein kinase D2 in response to G-protein-coupled receptor agonists. Biochem. Biophys. Res. Commun. 302, , 817-824.[CrossRef][Medline]
Rey, O., Yuan, J., Young, S. H., and Rozengurt, E. ((2003b). ). PKC nu/protein kinase D3 nuclear localization, catalytic activation, and intracellular redistribution in response to G protein-coupled receptor agonists. J. Biol. Chem. 278, , 23773-23785.
Robbins, J., Dilworth, S. M., Laskey, R. A., and Dingwall, C. ((1991). ). Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64, , 615-623.[CrossRef][Medline]
Rykx, A., De Kimpe, L., Mikhalap, S., Vantus, T., Seufferlein, T., Vandenheede, J. R., and Van Lint, J. ((2003). ). Protein kinase D: a family affair. FEBS Lett. 546, , 81-86.[CrossRef]