![]() |
|
|
Vol. 17, Issue 1, 295-307, January 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





* State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China;
Department of Biological Chemistry, College of Medicine, University of California, Irvine, Irvine, CA 92697-1700
Submitted June 7, 2005;
Revised September 27, 2005;
Accepted October 24, 2005
Monitoring Editor: Tim Stearns
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
40%, of all the nosocomial bloodstream infections (Kullberg and Filler, 2002
Flo8 is a transcription factor critical for invasive growth and flocculation in haploids and pseudohyphal growth in diploids of Saccharomyces cerevisiae (Liu et al., 1996
). It is required for the expression of a family of FLO genes that encode glycerol phosphoinositol (GPI)-anchored cell surface adhesin genes (Kobayashi et al., 1996
). Among them, FLO11 is essential for invasive/filamentous growth and flocculation (Lo and Dranginis, 1998
). Flo8 functions downstream of the cyclical AMP (cAMP)-dependent protein kinase A (PKA) pathway because flo8 mutants block the effect of an activated PKA/cAMP pathway on FLO11 expression (Rupp et al., 1999
). Flo8 has been shown to bind to the promoter of FLO11, and the binding is regulated by Tpk2 (Pan and Heitman, 2002
), one of three catalytic subunits of PKA in S. cerevisiae. Phosphorylation of Flo8 by Tpk2 is required for Flo8 interaction with the FLO11 promoter both in vivo and in vitro (Pan and Heitman, 2002
).
In C. albicans, several signaling pathways can regulate the yeast-to-hypha transition (Whiteway and Oberholzer, 2004
). Among them, the cAMP/PKA pathway plays a major role in hyphal development and virulence, because many mutants in the pathway are defective in hyphal growth and show reduced virulence. The adenylate cyclase Cdc35 and its associated protein Cap1 are required for hyphal development under all hyphal-inducing conditions, including serum (Bahn and Sundstrom, 2001
; Rocha et al., 2001
). The cyclase activity is regulated by two G proteins, Ras1 and Gpa2, in C. albicans (Feng et al., 1999
; Sanchez-Martinez and Perez-Martin, 2002
; Miwa et al., 2004
; Maidan et al., 2005
). ras1 mutants are defective for hyphal formation under induction with serum filtrate in liquid media (Feng et al., 1999
), whereas gpa2 mutants are defective in hyphal growth on solid hyphal-inducing media (Miwa et al., 2004
; Maidan et al., 2005
). The G proteins act through PKA to induce morphogenesis in C. albicans. C. albicans PKA consists of one regulatory subunit, Bcy1, and two catalytic subunits, Tpk1 and Tpk2 (Sonneborn et al., 2000
; Bockmuhl et al., 2001
; Cassola et al., 2004
). Tpk1 and Tpk2 have distinct functions in hyphal development because their mutants have differential effects in different media (Bockmuhl et al., 2001
; Cassola et al., 2004
). One potential target of the cAMP/PKA pathway is Efg1, a basic helix-loop-helix protein similar to StuA of Aspergillus nidulans and Sok2 and Phd1 of S. cerevisiae (Stoldt et al., 1997
). efg1/efg1 mutants are unable to form hyphae in all liquid-inducing media (Stoldt et al., 1997
), but the mutants show enhanced hyphal formation under embedded growth conditions (Giusani et al., 2002
). Transcription profiling of cAMP signaling in C. albicans shows that Ras1 regulates a subset of Cdc35-regulated genes, but Efg1-regulated genes are distinct from those modulated by Cdc35 except for the class of genes induced during the yeast-to-hypha transition (Harcus et al., 2004
). The hypha-specific genes include GPI-anchored cell wall proteins, secreted proteases, and a G1 cyclin-like gene, and they have been shown to be important for virulence in systemic infections (Liu, 2001
; Zheng and Wang, 2004
).
Because Flo8 is a target of the cAMP/PKA pathway essential for invasive/filamentous growth in S. cerevisiae, we were interested to determine whether a similar regulator exists in C. albicans. We cloned a C. albicans FLO8 homolog by functional complementation of a S. cerevisiae flo8 mutant. FLO8 deletions in C. albicans completely blocked hyphal development and the expression of hyphal genes, and led to avirulence in a systemic model of candidiasis. Genome-wide transcription analysis of flo8/flo8 and efg1/efg1 mutants suggests that Flo8 specifically regulates subsets of Efg1-regulated genes, mostly hypha-specific genes. We present evidence to suggest that Flo8 and Efg1 function together in regulating the hyphal transcriptional program in C. albicans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
FLO8 Cloning and Disruption
The clone pCF56 was isolated from a C. albicans genomic library (Liu et al., 1994
) based on its ability to suppress the invasive defect of a S. cerevisiae flo8 mutant (HLY850) on SC-Ura medium. pCF56 contains a 3.4-kb insert, with a 2454 base pair open reading frame (ORF), corresponding to a protein (Flo8) of 817 amino acids. A 2.4-kb BglII-BamHI fragment in pCF56 was replaced with a 4-kb BglII-BamHI hisG-URA3-hisG fragment from pCUB6, generating plasmid pCF56-FLO8N
. A 1.5-kb SpeI fragment from pCF56 was inserted into the SpeI site of pCF56-FLO8N
to generate pCF56-FLO8
for disruption of FLO8. pCF56-FLO8
was digested with XhoI and SstI and transformed into CAI4 to produce FLO8/flo8 and flo8/flo8 strains. Spontaneous Ura derivatives were selected on 5-fluoro-orotic acid-containing medium. The disruption was confirmed by Southern blotting (Supplemental Figure 1). The plasmids used in this study are listed in Table 2. All the clones and plasmids were confirmed by DNA sequencing.
|
Plasmid Construction
pBA1 was constructed by subcloning an ADH1 promoter fragment with NotI and EcoRV at each end into BES116 (Feng et al., 1999
) at the NotI and EcoR V site.
pBA1-CaFLO8 for the expression of C. albicans FLO8 in C. albicans was constructed by placing a 2.45-kb PCR fragment containing FLO8 coding sequence into the BglII-ClaI site of plasmid pBA1. Primer 1 and primer 2 were used for PCR amplification.
pBA1-CaFLO8
N was constructed by placing a 2.1-kb PCR fragment into the BglII-ClaI site of plasmid pBA1. Primer 5'CTGGGATCCGTATGCTTCCTCTTATACAGCAG and primer 2 in Table 3 were used for PCR amplification.
|
pBES116-CaFLO8, a 3-kb HindIII-EcoRV fragment from pCF56 was inserted into BES116 (Feng et al., 1999
). Then, a 2.4-kb KpnI-HindIII PCR fragment containing C. albicans FLO8 promoter was amplified (primer 3 and 4) and inserted before the FLO8 coding region.
For pVTU-CaFLO8, a 2.45-kb FLO8 containing PCR product (primers 7 and 8) was subcloned into the SstI-XhoI site of pVT102U to express the C. albicans FLO8 under the control of ADH1p in S. cerevisiae. The full-length coding sequences of FLO8 and EFG1 were PCR amplified (primers 914) and inserted into pEG202 and pJG45, generating pEG202-CaFLO8, pEG202-EFG1, and pJGCaFLO8 for the two-hybrid assay. SC5314 genomic DNA was used as template for PCR amplification. All constructs were verified by DNA sequencing. The plasmids used in this study are listed in Table 2. The primers used for PCR amplification are listed in Table 3.
For CaFLO8-MYC13, a 580-base pair fragment containing 13xMYC was PCR amplified from the S. cerevisiae vector pFA6a-13MYC-HIS3MX6 (Longtine et al., 1998
) with oligonucleotides 5 and 6 (Table 3), and cloned into the BamHI and SphI sites of the C. albicans ACT1p-FLAG-HIS1 vector (Umeyama et al., 2002
) to create pPR671. A Not1 and an Mlu1 site were introduced between the BamHI and myc13 sequence in pPR671. The FLO8 gene was amplified from C. albicans genomic DNA (SC5314) using oligonucleotides 15 and 16 (Table 3). The 2.5-kb PCR product was digested with BamHI and MluI and then inserted into the BamHI-MluI sites of pPR671, to produce pCaFLO813MYC-FLAG-HIS1 (pPR672). pPR672 was digested with StuI to target the integration of the plasmid into the genomic RP10 locus under HIS1 selection. Expression of Flo8p under the ACT1 promoter in YPD at 30°C was verified by Western analysis using an anti c-myc-conjugated peroxidase antibody (Roche Diagnostics, Indianapolis, IN) enabling detection of Flo8p at
150 kDa.
pMSCTAP was constructed by cloning a codon-optimized TAP-tag that contains two copies of protein A sequence followed by a single copy of the calmodulin binding peptide (Rigaut et al., 1999
) into a BlueScript vector that carries C. albicans URA3 (Shrivastava and Liu, unpublished data). The TAP-CaURA3 can be used as a cassette for PCR amplification and insertion of the TAP in frame to the C terminus of a gene of interest.
Efg1-TAP Strain
Primers EFG1-F and EFG1-R are used to PCR amplify TAP-CaURA3 from pMSCTAP (EFG-TAP-F 5'-CCTTCACCCCAACAACATCAAGCTAATCAATCAGCTAGCACTGTTGCCAAAGAAGAAAAGAACATGGAAAAGAGAAGATGG-3'; URA3-EFG-R 5'-CGTTCATGTCAATGGATTTGGGAGAAGATTATGATCTATACTATTTCTTTTTTTATTATTCCGCGGTGGCGGCCGCTCTAG-3'). The underlined regions are the sequences identical to the beginning of TAP and URA3, respectively. The 5' 60 bp are homologous to the C-terminal end of EFG1. The amplified DNA was transformed directly into C. albicans (Wilson et al., 1999
), and the transformants with the TAP fused to the C terminus of Efg1 by homologous recombination were identified by PCR and verified by Western blot.
C. albicans Microarray Construction
A C. albicans microarray containing 6917 elements was printed with a C. albicans 70-mer set (QIAGEN Operon, Alameda, CA) on a code-link activated slide (GE Healthcare, Little Chalfont, Buckinghamshire, UK) by Microarray (Nashville, TN). The 70-mer set includes
6530 ORFs from the Assembly 6 ORFs released by the C. albicans Genome Sequencing Project at Stanford University (Stanford, CA). Oligonucleotide information is available at www.qiagen.com. The set includes 192 randomly generated 70-mers as negative controls. The mean intensity of the negative controls is used as the basal hybridization intensity in data evaluation.
Preparing cDNA for Microarray Experiments
Total RNA was extracted using the hot acid phenol method with the addition of phase lock gels (Eppendorf, Westbury, NY) and a LiCl precipitation. The quality of RNA was checked by running the samples on a nanochip using the Agilent Bioanalyzer 2100 (University of California Irvine DNA MicroArray Facility, Irvine, CA). Samples of high-quality RNA, as determined by rRNA profiles, were used for cDNA synthesis. For each experiment, RNA from two samples was pooled (12 µg each) and annealed to 10 µg of Oligo(dT) and Random 9mer primers from the Prime-It II kit (Stratagene, La Jolla, CA). cDNA was synthesized using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) in a mixture containing 0.5 mM deoxynucleoside triphosphates (aminoallyl-dUTP:dT in a 3:2 ratio), 5x first strand buffer (Invitrogen), and 0.1 M dithiothreitol (DTT) overnight at 42°C. The RNA was hydrolyzed with 0.2 M NaOH and 0.1 M EDTA at 65°C for 15 min and subsequently neutralized with 0.33 M Tris, pH 7.4. The cDNA was washed with double distilled H2O several times and concentrated to a small volume with a Microcon-3 filter (Millipore, Billerica, MA) and stored at 20°C.
Coupling and Microarray Hybridization
The cDNA was thawed at 42°C for 5 min, resuspended in 0.05 M sodium bicarbonate buffer, pH 9.0, and incubated with Cy3 or Cy5 dye (GE Healthcare) for 1 h at room temperature in the dark. Alternatively, the cDNA was coupled to Alexa Fluor 555 or 647 (Invitrogen) according to the manufacturer's instructions. The QIAGEN PCR purification kit was used to remove any unincorporated dye and eluted with 30 µl of 10 mM Tris-Cl, 5 mM EDTA, pH 8.0, twice. The whole sample was loaded into an Ultravette disposable cuvette (Brandtech Scientific, Essex, CT) and scanned from optical density (OD)200 to OD800 using a spectrophotometer to quantify the amount of cDNA generated as well as the amount of dye coupled to the cDNA. Then, volumes containing equal amounts of cDNA for the appropriate experiments were mixed and concentrated using a Microcon-30 filter. Either 5 or 9 µl of the probe (depending on the size of the coverslip) was heated to 100°C for 2 min. Meanwhile, the microarray slide was washed in 0.2% SDS for 10 min, washed in filtered H2O, dipped in ethanol, and spun dry. A hybridization chamber and Millipore buffer #3 was prewarmed (50°C) and two-thirds volume Millipore buffer was added to the probe. The mixture was spun down before adding to the microarray slide. The slides were hybridized in the hybridization chambers for 1620 h at 50°C.
Microarray Data Analysis
After hybridization, slides were washed, dried, and then scanned with a GSI Lumonics ScanArray 4000 slide scanner (GMI, Ramsey, MN) using its Scan Array software. The background-subtracted intensity of Cy3 and Cy5 at each spot was determined using the QuantArray software of the scanner. The background-subtracted intensities of Cy3 and Cy5 were used to plot log2(Cy5i/Cy3i) ratio for each element on a microarray against log10(Cy5ixCy3i) (R-I plot) (data not shown). R-I plots were used to predict the quality of hybridization. For example, curved R-I plots (usually because of photobleaching of one dye) or scattered R-I plots (usually indicates degraded RNA) were not used for subsequent data analysis. We routinely carried out four experimental repeats and array hybridizations for each experiment. Data from two high-quality hybridizations for each experiment, as determined by their R-I plots, were used for subsequent data analyses. Because equal amounts of cDNA for each dye were used in hybridization, we used total intensity normalization to normalize the Cy3 and Cy5 for each hybridization. The normalization involved scaling the Cy5 intensities by multiplying them with a normalization factor, which was determined by dividing the sum of Cy3 intensities by the sum of the Cy5 intensities. The ratio of Cy5i to Cy3i was then calculated using the corrected Cy5 values. The ratios that were above 2 times basal cutoff (Cy5i-Cy3i> avgCy5ibasal+avgCy3ibasal) and threefold cutoff were log transformed and clustered with the average linkage cluster in a hierarchical cluster program (Eisen et al., 1998
). The clustered data were viewed in TreeView. The cluster and TreeView programs are at http://rana.stanford.edu/software/.
Immunoprecipitation
C. albicans cells were grown to 35 x 107 cells/ml in 50 ml of YPD, SSA, or Lee's media in yeast or hyphal growth conditions. The cells were harvested by centrifugation at 4°C, washed, and resuspended in 0.5 ml of lysis buffer (10 mM Tris-HCl, pH 8, 250 mM NaCl, 0.1% NP-40, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine, 0.5 µg/ml leupeptin, 1.4 µg/ml pepstatin, 2.4 µg/ml chymostatin, and 17 µg/ml aprotinin) and equal volume of glass beads (Sigma, St. Louis, MO). Cells were lysed at 4°C using a Fast-Prep system (FP120; Thermo Electron, Waltham, MA). Cell lysates were centrifuged for 10 min at 13,000 rpm in a microcentrifuge at 4°C. Protein extract containing 5 mg of protein was subjected to immunoprecipitation using 60 µl of rabbit IgG agarose bead slurry that was preincubated once with 0.2 mg/ml sheared salmon sperm DNA, 0.5 mg/ml bovine serum albumin in phosphate-buffered saline (PBS), and washed once in the lysis buffer. After incubation for 2 h at 4°C, beads were washed six times with 0.5 ml of lysis buffer and once with 1 ml of TE (10 mM Tris-HCl, pH 8, 1 mM EDTA). Bound proteins were eluted from the beads in 60 µl of elution buffer (50 mM Tris-HCl, pH 8, 10 mM EDTA, and 1% SDS) by incubation for 1015 min at 65°C. Proteins were separated by 8% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Hybond; GE Healthcare). After blocking in 3% skim-milk powder in 0.05% PBS, Tween 20, a peroxidase-conjugated anti-c-myc antibody (Roche Diagnostics) was used to probe for myc-tagged proteins, which were then detected using the ECL system (GE Healthcare).
|
Northern Blotting
RNA extraction and Northern blotting were performed as described by Lane et al. (2001a
). A 3.4-kb FLO8 fragment from pCF56 was used as a probe for Northern analysis. PCR products for C. albicans ECE1, HWP1, ALS1, HGC1, IHD1, and HSP31 were used for probing Northern blots.
Virulence Assay
The virulence of C. albicans strains was tested as described by Chen et al. (2000
). ICR male mice (1821 g) from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China) were used for the virulence assay.
Nucleotide Sequence Accession Number
The GenBank accession number for the C. albicans FLO8 nucleotide sequence is AF414113
[GenBank]
and orf19.1093.
| RESULTS |
|---|
|
|
|---|
|
To determine whether the LUFS domain is important for C. albicans Flo8 function, we deleted the N-terminal 122 amino acids of Flo8 and introduced Flo8123817 and Flo81122 into haploid and diploid flo8 mutants of S. cerevisiae. Whereas the full-length C. albicans Flo8 could completely complement the invasive/filamentous growth defect of the flo8 mutants, neither Flo8123817 nor Flo81122 could (Figure 2B; our unpublished data). Therefore, both the LUFS domain in Flo81122 and other domains in Flo8123817 are required for Flo8 function. To determine whether the LUFS domain is important for C. albicans Flo8 transcriptional activity, we fused different Flo8 domains to the lexA DNA binding domain, and measured the transcriptional activities of the fusion proteins in S. cerevisiae. Fusion of Flo8 to the DNA binding domain of lexA gave a high level of lexAop-lacZ expression in a S. cerevisiae flo8-1 strain, which carries a nonsense mutation encoding Flo8 with a truncated LUFS domain (Liu et al., 1996
). This observation is similar to that reported for S. cerevisiae Flo8 (Rupp et al., 1999
; Pan and Heitman, 2002
). Therefore, C. albicans Flo8 is likely a transcriptional activator. Deleting the N-terminal 122 amino acids decreased Flo8 transcriptional activity by only 50%, but deleting the C-terminal 200 amino acids reduced the transcriptional activity by 60-fold (Figure 2C), suggesting that the transcriptional activation domain is probably at the C terminus. Alternatively, the C-terminal domain could interact with a transcriptional activator, leading to transactivation of Flo8. Removing the two regions together completely abolished the transcriptional activity. Our data suggest that both the N-terminal LUFS domain and the C-terminal region are important for Flo8 function.
|
Consistent with the defect in hyphal morphogenesis, the flo8/flo8 mutants were also defective in the expression of hypha-specific genes (Figure 3B). ECE1 and HWP1 were highly induced in wild-type cells under hyphal-inducing conditions, but they were not induced at all in flo8/flo8 mutants. The FLO8/flo8 heterozygote showed reduced expression of hypha-specific genes. Because Flo8 is required for the expression of several FLO genes of cell surface adhesins in S. cerevisiae, we also examined the expression of ALS1, which is expressed in both yeast and hyphal cells in an Efg1-dependent manner. Our data showed that Flo8 is essential for hyphal morphogenesis and the induction of hypha-specific genes and ALS1. FLO8 was expressed in both yeast and hyphae at low levels, as determined by the Northern analysis (our unpublished data).
The LUFS domain is important for Flo8 functions in hyphal development. A flo8/flo8 mutant transformed with FLO8
N, which lacks the LUFS domain, was unable to develop hyphae or express hyphal genes (Figure 3, C and D).
flo8/flo8 Is Avirulent in a Systemic Infection Model of Mice
The dimorphic transition ability of C. albicans has been linked with its pathogenicity in mice (Lo et al., 1997
, Chen et al., 2000
). Therefore, we examined the virulence of flo8/flo8 mutants in a systemic model of infection. Cells (5 x 106) of wild type (CAI4), flo8/flo8, and FLO8-complemented flo8/flo8 strain were inoculated into each mouse by tail vein injection. All three strains carry one copy of UAR3 integrated at the ADE2 locus. We observed that the mice injected with wild-type and complemented flo8/flo8 C. albicans started to lose weight after 1 d and started to die after 2 d, and all of the mice died by day 15 (Figure 4). The mice injected with the flo8/flo8, in contrast, had no symptoms of illness, and all mice survived for more than 25 d (Figure 4). Therefore, flo8/flo8 was avirulent in a mouse model of systemic infection.
|
Flo8 Is Required for Expressing Subsets of Efg1-regulated Genes
The phenotypes of the flo8/flo8 mutant in various hyphal-inducing conditions are very similar to that of efg1/efg1. Both are unable to induce hyphal morphogenesis and express hypha-specific genes in serum-containing media, and both show severely reduced virulence in the systemic infection model in mice. To further define Flo8 functions and its relationship with Efg1, we compared transcription profiles of flo8/flo8 and efg1/efg1 mutants.
We performed microarray hybridizations with cells grown in two sets of hyphal-inducing media, YPD + serum and Lee's. Wild-type, efg1/efg1, and flo8/flo8 cells were grown in YPD at 25°C for yeast growth and in YPD + serum at 37°C for hyphal growth. Similarly, the three strains were grown in Lee's medium at 25°C for yeast growth and in Lee's at 37°C for hyphal growth. After 3 h growth in YPD media or 6 h in Lee's medium, cells were harvested for RNA extraction. The RNA was reverse transcribed, and equal amounts of cDNA were labeled with Cy3 and Cy5 and hybridized to each slide. Wild type versus efg1/efg1 and wild type versus flo8/flo8 in each yeast growth or hyphal growth condition as well as wild-type hyphae versus wild-type yeast were compared on each slide. Changes in gene expression were measured as a ratio of normalized Cy3 versus Cy5 intensity at each position on each microarray slide. Most experiments had four experimental repeats. The ratio of normalized Cy3 versus Cy5 intensities from two repeats with high quality of hybridization, as determined by R-I plots (see Materials and Methods) were used in clustering analysis (Eisen et al., 1998
). The clustering result is visualized with TreeView (Figure 5A). The ratios used for the clustering analysis are available in Supplemental Figure 2.
|
-glucosidase Sta1 in Saccharomyces diastaticus (Yamashita et al., 1985
|
Flo8 and Efg1 Interact In Vivo
The fact that all the Flo8-regulated genes we identified so far were similarly regulated by Efg1 suggests that Flo8 and Efg1 might function together to control the expression of these genes. To determine whether Flo8 and Efg1 act together in transcriptional activation, we first determined whether the two transcription factors interact by yeast two-hybrid system. The Efg1 fusion to the DNA binding domain of lexA did not activate the transcription from lexAop-lacZ, in agreement with a recent report (Doedt et al., 2004
). When using the lexA-Efg1 as bait in the yeast two-hybrid system, we detected a weak two-hybrid interaction of Efg1 with Flo8 (Figure 6A). A reciprocal two-hybrid assay could not be performed because the lexADB-Flo8 fusion gave a high level of basal activity.
|
The functional relationship between Efg1 and Flo8 was further studied by epistasis experiments in S. cerevisiae. Overexpression of EFG1 or C. albicans FLO8 in S. cerevisiae enhanced invasive growth in wild-type haploids and bypassed the requirement of the Kss1 mitogen-activated protein kinase pathway. But the effect of EFG1 overexpression was completely blocked in a flo8 mutant (Figure 7). Therefore, Flo8 is required for Efg1-mediated transcriptional activation of invasive/filamentous growth in S. cerevisiae. Overexpression of EFG1 from the PCK1 promoter in a C. albicans flo8/flo8 mutant did not induce filamentous growth, and the flo8/flo8 mutant carrying the EFG1 overexpression construct showed similar yeast growth morphology as the control flo8/flo8 strain carrying a vector (our unpublished data). Although the result was in agreement with the epistasis study in S. cerevisiae, the extent of data interpretation was limited by the relatively weak phenotype observed in wild-type C. albicans expressing EFG1 under the PCK1 promoter, because it only generated pseudohyphal filaments. Reciprocal epistasis experiments with FLO8 overexpression in efg1/efg1 was hindered by the lack of any detectable phenotypes from FLO8 overexpression (our unpublished data).
|
| DISCUSSION |
|---|
|
|
|---|
-helices adjacent to the LisH motif (Figure 2A). It is likely that the LisH motif in Flo8 is also involved in dimerization, and together with the
-helices, forms a structure similar to the structure found in LIS1 (Kim et al., 2004a
Flo8 Is a Key Regulator of Hyphal Development and Is Essential for Virulence
Flo8 is essential for hyphal development in C. albicans. Deleting FLO8 completely blocks hypha formation under all aerobic hyphal-inducing conditions investigated. In terms of the extent of cell elongation in yeast and hyphal growth conditions, the flo8/flo8 mutant shows a more specific and tighter phenotype than the efg1/efg1 mutant, because efg1/efg1 cells are slightly elongated in response to serum at 37°C, whereas flo8/flo8 cells remain yeast-like. Whole-genome transcription analysis of flo8/flo8 and efg1/efg1 shows that Flo8 regulates subsets of Efg1-regulated genes, and most of these are hypha-specific genes, including a recently reported hypha-specific G1-cyclin (Zheng and Wang, 2004
) and a potential cell wall protein (Ihd1) with similarity to glucan 1,4-
-glucosidase Sta1 in S. diastaticus. We did not identify a class of genes that are regulated only by Flo8 under the growth conditions we used. In contrast, some Efg1-regulated genes are not affected by flo8/flo8. Therefore, Flo8 is essential and specific for hyphal development.
Like Efg1, Flo8 seems to have a dual function in filamentous growth. Although the flo8/flo8 mutant blocked hyphal development in aerobic conditions at 37°C, it formed long hyphal filaments in a microaerophilic condition at room temperature. This suggests that Flo8 could act as an activator of the hyphal response program to certain stimuli but could also function as a repressor of hyphal development in a matrix. Unlike the efg1/efg1 mutant, which formed heterogenous filaments surrounded with yeast cells in the matrix, the flo8/flo8 mutant formed uniform hyphal filaments when embedded in agar. Therefore, flo8/flo8 seems to have a stronger and more complete phenotype than efg1/efg1 under both aerobic and microaerophilic conditions.
The flo8/flo8 mutant is avirulent in a mouse model of systemic infection. This is probably directly linked to the critical role of Flo8 in hyphal development. The flo8/flo8 mutant completely blocked hyphal development and specifically prevented the expression of hypha-specific genes, many of which are known to contribute to virulence. In addition, the flo8/flo8 mutant is completely filamentous under embedded conditions. It seems that the mutant is unable to switch between yeast and filamentous forms under a given condition. This is consistent with its avirulent property in the mouse model, because the virulence of C. albicans is considered to be linked to the ability of cells to undergo dimorphic transitions. The subtle morphological difference between the efg1/efg1 and the flo8/flo8 mutants is also consistent with the observation that flo8/flo8 is avirulent, whereas the efg1/efg1 mutant shows reduced virulence.
Flo8 May Function Downstream of the cAMP/PKA Pathway, Together with Efg1, in Regulating the Hyphal Transcriptional Program
Several lines of evidence suggest that Flo8 may function downstream of the cAMP/PKA pathway, and together with Efg1, may regulate the expression of hyphal genes. First, C. albicans FLO8 could complement the defects of Scflo8 in invasive/filamentous growth, and therefore it is likely to function in the same position as ScFlo8 in S. cerevisiae, which is downstream of Tpk2. Second, the flo8/flo8 mutant has similar phenotypes as cdc35/cdc35 and efg1/efg1; they are defective in hyphal development and the induction of hypha-specific genes including HGC1 under many liquid hyphal-inducing media, including serum-containing media, but they show elevated filamentation under embedded conditions. Third, transcription profiling of flo8/flo8 and efg1/efg1 shows that Flo8 regulates the hypha-specific set of the Efg1-regulated genes. We did not find genes regulated by Flo8, and not by Efg1. Interestingly, hypha-specific genes are the only overlapping genes affected by both efg1/efg1 and cdc35/cdc35 in a genome-wide profiling study (Harcus et al., 2004
). Fourth, an in vivo interaction between Flo8 and Efg1 was detected by yeast two-hybrid and immunoprecipitation. This places both Efg1 and Flo8 downstream of the cAMP/PKA pathway. Whether one or both of them are regulated by PKA remains to be determined. Considering that some Efg1-repressed genes are not regulated by Flo8, we predict that, when in complex with Flo8, the Efg1/Flo8 complex can activate transcription. This is consistent with the notion that Efg1 is an inhibitor of transcription under both yeast and hyphal growth conditions (Doedt et al., 2004
), whereas Flo8 seems to act as a transcriptional activator as the lexADB-Flo8 fusion has high transcriptional activity. It is possible, that by interacting with different regulators, Efg1 can exert different effects on transcription.
Flo8 may interact with additional regulators to integrate responses from different signaling pathways to regulate the hyphal transcriptional program. LUFS-containing regulators have been found to interact with other transcriptional regulators. In Arabidopsis, the LUFS domain of Leunig is both necessary and sufficient for its interaction with Seuss, and the Leunig/Seuss complex regulates gene expression during flower development (Sridhar et al., 2004
). In Drosophila, the Ssdp protein interacts through its LUFS domain with Chip, a cofactor of the LIM homeodomain transcription factors, and regulates the activity of the LIMhomeodomain protein complexes in various developmental processes (van Meyel et al., 2003
). In S. cerevisiae, the Flo8/Mss11 complex interacts with Ste12 and Tec1 to activate STA1 expression (Kim et al., 2004b
). In C. albicans, we show that Flo8 interacts with Efg1. Because the flo8/flo8 mutant has a tighter phenotype than that of efg1/efg1, we predict that Flo8 may interact with other coactivators or coinhibitors besides Efg1 to regulate hyphal development. So, we propose that Flo8 acts downstream of several pathways to integrate various signals in hyphal development. In conclusion, we have identified a conserved regulator Flo8 that plays an essential role in the dimorphic switch and virulence of C. albicans.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
These authors contributed equally to this work. ![]()
Address correspondence to: Haoping Liu (h4liu{at}uci.edu) or Jiangye Chen (jychen{at}sunm.shcnc.ac.cn).
| REFERENCES |
|---|
|
|
|---|
Bockmuhl, D. P., Krishnamurthy, S., Gerads, M., Sonneborn, A., and Ernst, J. F. ((2001). ). Distinct and redundant roles of the two protein kinase A isoforms Tpk1p and Tpk2p in morphogenesis and growth of Candida albicans. Mol. Microbiol. 42, , 12431257.[CrossRef][Medline]
Brown, D. H., Jr., Giusani, A. D., Chen, X., and Kumamoto, C. A. ((1999). ). Filamentous growth of Candida albicans in response to physical environmental cues and its regulation by the unique CZF1 gene. Mol. Microbiol. 34, , 651662.[CrossRef][Medline]
Cassola, A., Parrot, M., Silberstein, S., Magee, B. B., Passeron, S., Giasson, L., and Cantore, M. L. ((2004). ). Candida albicans lacking the gene encoding the regulatory subunit of protein kinase A displays a defect in hyphal formation and an altered localization of the catalytic subunit. Eukaryot. Cell 3, , 190199.
Chen, J., Zhou, S., Wang, Q., Chen, X., Pan, T., and Liu, H. ((2000). ). Crk1, a novel Cdc2-related protein kinase, is required for hyphal development and virulence in Candida albicans. Mol. Cell. Biol. 20, , 86968708.
Chou, S., Huang, L., and Liu, H. ((2004). ). Fus3-regulated Tec1 degradation through SCFCdc4 determines MAPK signaling specificity during mating in yeast. Cell 119, , 981990.[CrossRef][Medline]
Christianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H., and Hieter, P. ((1992). ). Multifunctional yeast high-copy-number shuttle vectors. Gene 110, , 119122.[CrossRef][Medline]
Conner, J., and Liu, Z. ((2000). ). LEUNIG, a putative transcriptional corepressor that regulates AGAMOUS expression during flower development. Proc. Natl. Acad. Sci. USA 97, , 1290212907.
De Groot, P. W., Hellingwerf, K. J., and Klis, F. M. ((2003). ). Genome-wide identification of fungal GPI proteins. Yeast 20, , 781796.[CrossRef][Medline]
Doedt, T., Krishnamurthy, S., Bockmuhl, D. P., Tebarth, B., Stempel, C., Russell, C. L., Brown, A. J., and Ernst, J. F. ((2004). ). APSES proteins regulate morphogenesis and metabolism in Candida albicans. Mol. Biol. Cell 15, , 31673180.
Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. ((1998). ). Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95, , 1486314868.
Emes, R. D., and Ponting, C. P. ((2001). ). A new sequence motif linking lissencephaly, Treacher Collins and oral-facial-digital type 1 syndromes, microtubule dynamics and cell migration. Hum. Mol. Genet. 10, , 28132820.
Feng, Q., Summers, E., Guo, B., and Fink, G. ((1999). ). Ras signaling is required for serum-induced hyphal differentiation in Candida albicans. J. Bacteriol. 181, , 63396346.
Fonzi, W. A., and Irwin, M. Y. ((1993). ). Isogenic strain construction and gene mapping in Candida albicans. Genetics 134, , 717728.[Abstract]
Gillum, A. M., Tsay, E. Y., and Kirsch, D. R. ((1984). ). Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198, , 179182.[CrossRef][Medline]
Gimeno, C. J., Ljungdahl, P. O., Styles, C. A., and Fink, G. R. ((1992). ). Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68, , 10771090.[CrossRef][Medline]
Giusani, A. D., Vinces, M., and Kumamoto, C. A. ((2002). ). Invasive filamentous growth of Candida albicans is promoted by Czf1p-dependent relief of Efg1p-mediated repression. Genetics 160, , 17491753.
Gyuris, J., Golemis, E., Chertkov, H., and Brent, R. ((1993). ). Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75, , 791803.[CrossRef][Medline]
Harcus, D., Nantel, A., Marcil, A., Rigby, T., and Whiteway, M. ((2004). ). Transcription profiling of cyclic AMP signaling in Candida albicans. Mol. Biol. Cell 15, , 44904499.
Kim, M. H., Cooper, D. R., Oleksy, A., Devedjiev, Y., Derewenda, U., Reiner, O., Otlewski, J., and Derewenda, Z. S. ((2004a). ). The structure of the N-terminal domain of the product of the lissencephaly gene Lis1 and its functional implications. Structure 12, , 987998.[Medline]
Kim, T. S., Kim, H. Y., Yoon, J. H., and Kang, H. S. ((2004b). ). Recruitment of the Swi/Snf complex by Ste12-Tec1 promotes Flo8-Mss11-mediated activation of STA1 expression. Mol. Cell. Biol. 24, , 95429556.
Kobayashi, O., Suda, H., Ohtani, T., and Sone, H. ((1996). ). Molecular cloning and analysis of the dominant flocculation gene FLO8 from Saccharomyces cerevisiae. Mol. Gen. Genet. 251, , 707715.[Medline]
Kullberg, B. J., and Filler, S. G. ((2002). ). Candidemia, Washington, DC: American Society for Microbiology.
Lane, S., Birse, C., Zhou, S., Matson, R., and Liu, H. ((2001a). ). DNA array studies demonstrate convergent regulation of virulence factors by Cph1, Cph2, and Efg1 in Candida albicans. J. Biol. Chem. 276, , 4898848996.
Lane, S., Zhou, S., Pan, T., Dai, Q., and Liu, H. ((2001b). ). The basic helix-loop-helix transcription factor Cph2 regulates hyphal development in Candida albicans partly via TEC1. Mol. Cell. Biol. 21, , 64186428.
Liu, H. ((2001). ). Transcriptional control of dimorphism in Candida albicans. Curr. Opin. Microbiol. 4, , 728735.[CrossRef][Medline]
Liu, H., Kohler, J., and Fink, G. R. ((1994). ). Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266, , 17231726.
Liu, H., Styles, C. A., and Fink, G. R. ((1993). ). Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 262, , 17411744.
Liu, H., Styles, C. A., and Fink, G. R. ((1996). ). Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144, , 967978.[Abstract]
Lo, H. J., Kohler, J. R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., and Fink, G. R. ((1997). ). Nonfilamentous C. albicans mutants are avirulent. Cell 90, , 939949.[CrossRef][Medline]
Lo, W. S., and Dranginis, A. M. ((1998). ). The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae. Mol. Biol. Cell 9, , 161171.
Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. ((1998). ). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, , 953961.[CrossRef][Medline]
Maidan, M. M., De Rop, L., Serneels, J., Exler, S., Rupp, S., Tournu, H., Thevelein, J. M., and Van Dijck, P. ((2005). ). The G protein-coupled receptor Gpr1 and the G{alpha} protein Gpa2 act through the cAMP-protein kinase A pathway to induce morphogenesis in Candida albicans. Mol. Biol. Cell 16, , 19711986.
Miwa, T., Takagi, Y., Shinozaki, M., Yun, C. W., Schell, W. A., Perfect, J. R., Kumagai, H., and Tamaki, H. ((2004). ). Gpr1, a putative G-protein-coupled receptor, regulates morphogenesis and hypha formation in the pathogenic fungus Candida albicans. Eukaryot. Cell 3, , 919931.
Murad, A. M., d'Enfert, C., Gaillardin, C., Tournu, H., Tekaia, F., Talibi, D., Marechal, D., Marchais, V., Cottin, J., and Brown, A. J. ((2001). ). Transcript profiling in Candida albicans reveals new cellular functions for the transcriptional repressors CaTup1, CaMig1 and CaNrg1. Mol. Microbiol. 42, , 981993.[CrossRef][Medline]
Nantel, A., et al. ((2002). ). Transcription profiling of Candida albicans cells undergoing the yeast-to-hyphal transition. Mol. Biol. Cell 13, , 34523465.
Pan, X., and Heitman, J. ((2002). ). Protein kinase A operates a molecular switch that governs yeast pseudohyphal differentiation. Mol. Cell. Biol. 22, , 39813993.
Reynolds, T. B., and Fink, G. R. ((2001). ). Bakers' yeast, a model for fungal biofilm formation. Science 291, , 878881.
Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. ((1999). ). A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 17, , 10301032.[CrossRef][Medline]
Riggle, P. J., Andrutis, K. A., Chen, X., Tzipori, S. R., and Kumamoto, C. A. ((1999). ). Invasive lesions containing filamentous forms produced by a Candida albicans mutant that is defective in filamentous growth in culture. Infect. Immun. 67, , 36493652.
Roberts, R. L., and Fink, G. R. ((1994). ). Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev. 8, , 29742985.
Rocha, C. R., Schroppel, K., Harcus, D., Marcil, A., Dignard, D., Taylor, B. N., Thomas, D. Y., Whiteway, M., and Leberer, E. ((2001). ). Signaling through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic fungus Candida albicans. Mol. Biol. Cell 12, , 36313643.
Rupp, S., Summers, E., Lo, H. J., Madhani, H., and Fink, G. ((1999). ). MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene. EMBO J. 18, , 12571269.[CrossRef][Medline]
Sanchez-Martinez, C., and Perez-Martin, J. ((2002). ). Gpa2, a G-protein alpha subunit required for hyphal development in Candida albicans. Eukaryot. Cell 1, , 865874.
Sonneborn, A., Bockmuhl, D. P., Gerads, M., Kurpanek, K., Sanglard, D., and Ernst, J. F. ((2000). ). Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans. Mol. Microbiol. 35, , 386396.[CrossRef][Medline]
Sridhar, V. V., Surendrarao, A., Gonzalez, D., Conlan, R. S., and Liu, Z. ((2004). ). Transcriptional repression of target genes by LEUNIG and SEUSS, two interacting regulatory proteins for Arabidopsis flower development. Proc. Natl. Acad. Sci. USA 101, , 1149411499.
Stoldt, V. R., Sonneborn, A., Leuker, C. E., and Ernst, J. F. ((1997). ). Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16, , 19821991.[CrossRef][Medline]
Umeyama, T., Nagai, Y., Niimi, M., and Uehara, Y. ((2002). ). Construction of FLAG tagging vectors for Candida albicans. Yeast 19, , 611618.[CrossRef][Medline]
van Meyel, D. J., Thomas, J. B., and Agulnick, A. D. ((2003). ). Ssdp proteins bind to LIM-interacting co-factors and regulate the activity of LIM-homeodomain protein complexes in vivo. Development 130, , 19151925.
Vernet, T., Dignard, D., and Thomas, D. Y. ((1987). ). A family of yeast expression vectors containing the phage f1 intergenic region. Gene 52, , 225233.[CrossRef][Medline]
Whiteway, M., and Oberholzer, U. ((2004). ). Candida morphogenesis and host-pathogen interactions. Curr. Opin. Microbiol. 7, , 350357.[CrossRef][Medline]
Wilson, R. B., Davis, D., and Mitchell, A. P. ((1999). ). Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181, , 18681874.
Yamashita, I., Suzuki, K., and Fukui, S. ((1985). ). Nucleotide sequence of the extracellular glucoamylase gene STA1 in the yeast Saccharomyces diastaticus. J. Bacteriol. 161, , 567573.
Zheng, X., and Wang, Y. ((2004). ). Hgc1, a novel hypha-specific G1 cyclin-related protein regulates Candida albicans hyphal morphogenesis. EMBO J. 23, , 18451856.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
R. Pukkila-Worley, A. Y. Peleg, E. Tampakakis, and E. Mylonakis Candida albicans Hyphal Formation and Virulence Assessed Using a Caenorhabditis elegans Infection Model Eukaryot. Cell, November 1, 2009; 8(11): 1750 - 1758. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Su, Y. Li, Y. Lu, and J. Chen Mss11, a Transcriptional Activator, Is Required for Hyphal Development in Candida albicans Eukaryot. Cell, November 1, 2009; 8(11): 1780 - 1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bouchonville, A. Forche, K. E. S. Tang, A. Selmecki, and J. Berman Aneuploid Chromosomes Are Highly Unstable during DNA Transformation of Candida albicans Eukaryot. Cell, October 1, 2009; 8(10): 1554 - 1566. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dodgson, H. Avula, K.-L. Hoe, D.-U. Kim, H.-O. Park, J. Hayles, and J. Armstrong Functional Genomics of Adhesion, Invasion, and Mycelial Formation in Schizosaccharomyces pombe Eukaryot. Cell, August 1, 2009; 8(8): 1298 - 1306. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stichternoth and J. F. Ernst Hypoxic Adaptation by Efg1 Regulates Biofilm Formation by Candida albicans Appl. Envir. Microbiol., June 1, 2009; 75(11): 3663 - 3672. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lu, C. Su, X. Mao, P. P. Raniga, H. Liu, and J. Chen Efg1-mediated Recruitment of NuA4 to Promoters Is Required for Hypha-specific Swi/Snf Binding and Activation in Candida albicans Mol. Biol. Cell, October 1, 2008; 19(10): 4260 - 4272. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. L. Chaffin Candida albicans Cell Wall Proteins Microbiol. Mol. Biol. Rev., September 1, 2008; 72(3): 495 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Noffz, V. Liedschulte, K. Lengeler, and J. F. Ernst Functional Mapping of the Candida albicans Efg1 Regulator Eukaryot. Cell, May 1, 2008; 7(5): 881 - 893. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goyard, P. Knechtle, M. Chauvel, A. Mallet, M.-C. Prevost, C. Proux, J.-Y. Coppee, P. Schwartz, F. Dromer, H. Park, et al. The Yak1 Kinase Is Involved in the Initiation and Maintenance of Hyphal Growth in Candida albicans Mol. Biol. Cell, May 1, 2008; 19(5): 2251 - 2266. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Bahn, M. Molenda, J. F. Staab, C. A. Lyman, L. J. Gordon, and P. Sundstrom Genome-Wide Transcriptional Profiling of the Cyclic AMP-Dependent Signaling Pathway during Morphogenic Transitions of Candida albicans Eukaryot. Cell, December 1, 2007; 6(12): 2376 - 2390. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, C. Su, X. Mao, F. Cao, and J. Chen Roles of Candida albicans Sfl1 in Hyphal Development Eukaryot. Cell, November 1, 2007; 6(11): 2112 - 2121. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Wolyniak and P. Sundstrom Role of Actin Cytoskeletal Dynamics in Activation of the Cyclic AMP Pathway and HWP1 Gene Expression in Candida albicans Eukaryot. Cell, October 1, 2007; 6(10): 1824 - 1840. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bauer and J. Wendland Candida albicans Sfl1 Suppresses Flocculation and Filamentation Eukaryot. Cell, October 1, 2007; 6(10): 1736 - 1744. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Biswas, P. Van Dijck, and A. Datta Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 348 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wang, S. Lane, Z. Tian, A. Sharon, I. Hazan, and H. Liu Temporal and Spatial Control of HGC1 Expression Results in Hgc1 Localization to the Apical Cells of Hyphae in Candida albicans Eukaryot. Cell, February 1, 2007; 6(2): 253 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Huang, H. Wang, S. Chou, X. Nie, J. Chen, and H. Liu From the Cover: Bistable expression of WOR1, a master regulator of white-opaque switching in Candida albicans PNAS, August 22, 2006; 103(34): 12813 - 12818. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Vinces, C. Haas, and C. A. Kumamoto Expression of the Candida albicans Morphogenesis Regulator Gene CZF1 and Its Regulation by Efg1p and Czf1p Eukaryot. Cell, May 1, 2006; 5(5): 825 - 835. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||