![]() |
|
|
Vol. 17, Issue 10, 4513-4525, October 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cell Biology, Center of Anatomy, Hannover Medical School, D-30625 Hannover, Germany
Submitted May 4, 2006;
Revised August 2, 2006;
Accepted August 3, 2006
Monitoring Editor: Jean Gruenberg
| ABSTRACT |
|---|
|
|
|---|
2-subunit of the adaptor protein (AP) complex AP2 in vitro. Here, we demonstrate that a C-terminal segment of CVAK104 interacts with the N-terminal domain of clathrin and with the
-appendage of AP2. CVAK104 localizes predominantly to the perinuclear region of HeLa and COS-7 cells, but it is also present on peripheral vesicular structures that are accessible to endocytosed transferrin. The distribution of CVAK104 overlaps extensively with that of AP1, AP3, the mannose 6-phosphate receptor, and clathrin but not at all with its putative phosphorylation target AP2. RNA interference-mediated clathrin knockdown reduced the membrane association of CVAK104. Recruitment of CVAK104 to perinuclear membranes of permeabilized cells is enhanced by guanosine 5'-O-(3-thio)triphosphate, and brefeldin A redistributes CVAK104 in cells. Both observations suggest a direct or indirect requirement for GTP-binding proteins in the membrane association of CVAK104. Live-cell imaging showed colocalization of green fluorescent protein-CVAK104 with endocytosed transferrin and with red fluorescent protein-clathrin on rapidly moving endosomes. Like AP1-depleted COS-7 cells, CVAK104-depleted cells missort the lysosomal hydrolase cathepsin D. Together, our data suggest a function for CVAK104 in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. | INTRODUCTION |
|---|
|
|
|---|
- and
2-), a medium (µ2-), and a small (
2)-subunit, recruits clathrin to the plasma membrane as a prerequisite for receptor-mediated endocytosis. The structurally related AP1 adaptor complex (
-,
1-, µ1-, and
1-subunits) is predominantly involved in clathrin-dependent sorting of newly synthesized lysosomal enzymes at the TGN. Lysosomal hydrolases, tagged with mannose-6-phosphate moieties, are recognized by mannose-6-phosphate receptors (M6PRs) at the TGN and packaged into AP1-containing CCVs (Rouille et al., 2000
In recent years, it became evident that the formation of CCVs involves a complex series of dynamic proteinprotein and proteinlipid interactions that are regulated by cycles of phosphorylation and dephosphorylation of interacting partners (Korolchuk and Banting, 2003
). An interesting example is a group of endocytic proteins designated as dephosphins that include dynamin 1, amphiphysin 1 and 2, and AP180. The dephosphins are found in the phosphorylated state in resting nerve terminals and are coordinately dephosphorylated upon stimulation of the nerve terminals (Cousin and Robinson, 2001
). In addition, the clathrin heavy chain and one of the clathrin LCs (LCb) as well as the large and the medium subunits of AP1 and AP2 are subject to phosphorylation both in vitro and in vivo (Bar-Zvi and Branton, 1986
; Ghosh and Kornfeld, 2003
; Flett et al., 2005
). It is known that some of the kinases responsible for the phosphorylation mentioned above are associated with purified CCVs. The µ2-subunit of AP2, for example, is phosphorylated in vitro by the CCV-associated kinases AAK1 and GAK/auxilin2, respectively (Greener et al., 2000
; Conner and Schmid, 2002
).
For a better understanding of the basic machinery and the regulatory mechanisms underlying clathrin-dependent intracellular transport processes, it is necessary to identify all components of this machinery and to define their precise role. Recently, a novel 104-kDa coated vesicle-associated protein with a serine/threonine kinase homology domain (CVAK104) was discovered by mass spectroscopy analysis of purified rat brain CCVs and in isolated adaptor protein preparations derived from bovine brain (Blondeau et al., 2004
; Conner and Schmid, 2005
). CVAK104 directly binds to both clathrin and the plasma membrane adaptor AP2. The new protein belongs to the SCY1-like family of protein kinases (referred to as SCYL2) that are thought to be catalytically inactive as they lack a number of highly conserved residues within the kinase homology domain known to be essential in other kinases (Manning et al., 2002
). However, Conner and Schmid (2005)
demonstrated that CVAK104 has not only autocatalytic activity but is also capable of phosphorylating the
2-adaptin subunit of AP2 in the presence of poly-L-lysine. These data suggest a role for CVAK104 in regulating the function of the adaptor complex AP2 and therefore in controlling clathrin-dependent trafficking at the plasma membrane.
In this study, we went on to show that clathrin and AP2 interact with a C-terminal segment of CVAK104. Immunolocalization studies demonstrated that CVAK104 does not colocalize with AP2 at the plasma membrane but is predominantly located to the perinuclear region of cultured cells where it colocalizes with AP1-containing structures in a clathrin-dependent manner. This suggests a function for CVAK104 in CCV formation at the Golgi and in endosomal sorting rather than a function in endocytosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-adaptin (Chin et al., 1989
-adaptin (Ahle et al., 1988
-adaptin were obtained from BD Biosciences Transduction Laboratories (Lexington, KY). The mouse mAb against
-1,4-galactosyltransferase (GT) was from J. Rohrer (Institute of Physiology, University of Zürich, Zürich, Switzerland) (Berger et al., 1986
-adaptin (Santa Cruz Biotechnology, Santa Cruz, CA), mab 100/3, anti-
-adaptin (Ahle et al., 1988
Cloning and Expression of Recombinant Fusion Proteins
The monomeric red fluorescent protein (RFP)-clathrin construct was described previously (Benesch et al., 2005
). The construct for the expression of 6xHis-
2-hinge/ear [corresponding to rat brain
2-adaptin-(592-951) of AP2] was from Tomas Kirchhausen (Harvard Medical School, Boston, MA) (Shih et al., 1995
), and the construct for glutathione S-transferase (GST)-
-appendage was provided by Richard Anderson (University of Texas, Dallas, TX) (Wang et al., 1995
). The 6xHis-AP180-(329-746) was kindly provided by Ruth Knorr (Hannover Medical School, Hannover, Germany), and GST fused to N-terminal domain (TD) (GST-TD) was provided by James Keen (Jefferson University, Philadelphia, PA). The CVAK104 cDNA clone 6473586 (GenBank accession no. BC063798) in pCMV-sport6 was obtained from Open Biosystems (Huntsville, AL). The complete open reading frame was amplified by polymerase chain reaction (PCR) and ligated between the EcoRI and NotI sites of pGEX-6P-1 (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom). N-terminal (GST)-CVAK104 fragments were generated by introducing stop-codons using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA). The cDNA fragment of CVAK104-(699-929) was amplified by PCR and inserted into the EcoRI and Sal sites of pGEX-6P-1 and of pEGFP-C2 (Clontech, Mountain View, CA). To fuse CVAK104 with enhanced green fluorescent protein (EGFP), full-length cDNA was first digested with NotI and blunted with Klenow polymerase followed by digestion with EcoRI and then inserted into EcoRI and SmaI sites of pEGFP-C2. Cloning and mutations were confirmed using DNA sequencing (MWG Biotech, Martinsried, Germany). Expression of recombinant GST- or polyhistidine-fusion proteins was performed essentially as described previously (Kalthoff et al., 2002
). To remove the GST moiety, GST-fusion proteins were digested with PreScission protease (GE Healthcare) according to the manufacturer's instructions.
Small Interfering RNA (siRNA)
The CVAK104 siRNA (AAUGGGCUAGCUUGGAAGAUU) and the clathrin heavy chain siRNA (AACCUGCGGUCUGGAGUCAAC) were obtained from Dharmacon RNA Technologies (Lafayette, CO). The target sequence of the
-adaptin siRNA was AAGCCCAGACATGCTTGCGCAUU.
Preparation of Cytosol and Clathrin-coated Vesicle Proteins
To obtain cytosol, fresh rat or pig brains were homogenized in 250 mM sucrose, 10 mM HEPES, 1 mM dithiothreitol, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride (pH 7.0; 1 ml of buffer/g tissue) using a Potter S homogenizer (B. Braun Biotech International, Melsungen, Germany) and centrifuged for 45 min at 90,000 rpm in a Beckman TLA 100.1 rotor (Beckman Coulter, Fullerton, CA). The pellet was discarded, and the supernatant was centrifuged for another 45 min as described above. The clarified cytosol was dialyzed against 25 mM HEPES, 125 mM potassium acetate, and 5 mM magnesium acetate, pH 7.1 (buffer G) overnight. When not used immediately, the cytosol was shock frozen and stored at 80°C. Frozen cytosol was rapidly thawed in a water bath at 37°C and then clarified by ultracentrifugation.
Clathrin triskelia and adaptor proteins were isolated essentially as described previously (Scheele et al., 2003
) with the modification that adaptor proteins were further purified by ion exchange chromatography using a Mono Q column (GE Healthcare) equilibrated with 20 mM Tris-HCl, pH 8.5. Proteins were eluted with a linear gradient of 0500 mM NaCl in 20 mM Tris-HCl, pH 8.5. The total volume of the gradient was 25 ml.
Pull-Down Experiments
GST-CVAK104-fusion proteins or GST-N-terminal domain of clathrin (GST-TD) immobilized on glutathione (GSH)-Sepharose beads (GE Healthcare) (GST-CVAK104: 38 µg of coupled to 30 µl of GSH-Sepharose beads; GST-TD: 30 µg on 5 µl of GSH beads mixed with 15 µl of Sepharose CL-4B beads) were incubated with 200 µl of rat brain cytosol (3.7 mg/ml in buffer G) for 1 h on ice. The beads were pelleted by centrifugation for 1 min at 10,000 rpm and 4°C in an A-8-11 swinging bucket rotor (Eppendorf, Hamburg, Germany) and resuspended in 1 ml of buffer G and pelleted again. The last step was repeated once. For the third wash, the resuspended beads were underlayed with 200 µl of 10% sucrose in buffer G. After a final washing step, aliquots of the supernatant and pellet fractions were analyzed by SDS-PAGE and immunoblotting. For pull-down assays with GST-fusion proteins and purified proteins, a slightly different protocol was used, including the following modifications: the incubation buffer was supplemented with 0.05% bovine serum albumin (BSA), and the number of washing steps was reduced to two. GST-CVAK104-, GST-TD- (for loading of beads, see above), or GST-
-appendage-beads (GST-
-app.: 30 µg of coupled to 5 µl of GSH beads mixed with 15 µl of Sepharose CL-4B beads) were incubated with 5 µg of isolated adaptor proteins or 9 µg of recombinant CVAK104 and CVAK104-(699-929), respectively, in buffer G. Clathrin cage binding assays were carried out essentially as described previously (Scheele et al., 2001
).
Tissue Distribution
The determination of the amount of CVAK104 expressed in different mouse tissues was performed as described previously (Kalthoff et al., 2002
).
Cell Culture and Transfection
HeLa SS6 and COS-7 cells were cultured and transfected with siRNAs as described previously (Meyerholz et al., 2005
). For transfection with EGFP-CVAK104 and FLAG-OCRL constructs, 3 x 104 cells were seeded on poly-L-lysinecoated glass coverslips in 24-well plates and on the next day they were transfected with 0.8 µg of DNA and 1 µl of Lipofectamine 2000 (Invitrogen, Karlsruhe, Germany) per well. Immunofluorescence analysis was done 24 h after transfection.
Cell Fractionation
Cell fractionation after siRNA-mediated clathrin heavy chain depletion was performed as described previously (Hinrichsen et al., 2003
).
In Vitro Recruitment of CVAK104 and AP1
For recruitment experiments, PtK cells growing on glass coverslips were permeabilized with 40 µg/ml digitonin in buffer G (25 mM HEPES, pH 7.1, 125 mM potassium acetate, and 5 mM magnesium acetate) + 1 mM dithiothreitol (DTT) for 5 min on ice and then with 4 µg/ml digitonin in the same buffer for 5 min at room temperature. Permeabilized cells were then incubated with pig brain cytosol either with or without 170 µM guanosine 5'-O-(3-thio)triphosphate (GTP
S) and/or an ATP-regenerating system (2 mM ATP, 5 mM creatine phosphate, and 5 U/ml creatine kinase) in a total volume of 420 µl of buffer G supplemented with 4 µg/ml digitonin and 1 mM DTT for 30 min at 37°C. Cells were washed three times with buffer G and then processed for immunofluorescence analysis.
Immunofluorescence Microscopy
Cells grown on poly-L-lysinecoated glass coverslips were fixed for 10 min at room temperature in 4% paraformaldehyde dissolved in phosphate-buffered saline (PBS) (2.7 mM KCl, 1.9 mM KH2PO4, 8.2 mM Na2HPO4, and 137 mM NaCl, pH 7.4). After fixation, the cells were washed three times with PBS; incubated for 5 min with 20 mM Tris-HCl and 140 mM NaCl, pH 7.6 (TBS); and then permeabilized with 0.1% Triton X-100 in TBS (or 0.05% saponin in PBS for detection of endogenous CVAK104) for 5 min. Antibodies were diluted in PBS containing 3% BSA. Cells were incubated for 1 h with primary antibodies and 45 min with secondary antibodies at 37°C. Washes after antibody incubations were performed by dipping coverslips into PBS 10 times. Finally, cells were embedded in Prolong Antifade (Molecular Probes). The effect of nocodazole (Sigma-Aldrich) or brefeldin A (BFA; Sigma-Aldrich) on the localization of CVAK104 was tested by incubating HeLa cells with 33 µM nocodazole for 3 h or 2 µg/ml BFA for 4 min at 37°C before fixation. Labeled cells were viewed with an Axiovert 200 M epi-fluorescence microscope, and images were recorded with an AxioCamMRm digital camera controlled by AxioVision software release 4.2 (Carl Zeiss AG, Oberkochen, Germany). Confocal light microscopy was performed with a LSM 510 Meta System (Carl Zeiss AG). Final figures were arranged with Adobe Photoshop version 8.0 and Adobe Illustrator version 11.0 (Adobe Systems, Mountain View, CA). To assay the uptake of transferrin by immunofluorescence, transfected cells were serum starved for 30 min in Leibowitz's L15 medium containing 0.1% BSA at 37°C and then incubated with 2.5 µg/ml Texas Red-labeled transferrin in the same medium for 1 h on ice. Unbound ligand was removed by quick washes with ice-cold serum-free medium, and bound ligand was allowed to be internalized upon incubation in 0.1% BSA/Leibowitz's L15 medium for different times at 37°C. For immunofluorescence, the cells were processed as described above.
Live-Cell Fluorescence Microscopy
COS-7 cells (8 x 104) were seeded on 30-mm glass coverslips, and the next day they were transfected with 4 µg of DNA and 10 µl of Lipofectamine 2000 (Invitrogen). Between 20 and 24 h posttransfection, coverslips were placed into a POCmini incubating chamber (Carl Zeiss AG), overlaid with 1 ml of Leibowitz's L15 medium plus 10% fetal calf serum and transferred to the heating stage of the microscope (Carl Zeiss AG), which was fitted with an acrylic incubating chamber to maintain a constant 37°C imaging environment. The same setup was used to follow the uptake of Texas Red-labeled transferrin. Briefly, serum-starved cells were preincubated for 1 h at 4°C with transferrin. Unbound ligand was removed by quick washes with prewarmed serum-free medium before cells were overlaid with Leibowitz's L15 medium containing 0.1% BSA and transferred to the microscope for imaging at 37°C.
Western Blotting
Proteins were separated by SDS-PAGE by using 919% gradient gels (Lindner and Ungewickell, 1992
) and then electroblotted onto Protran nitrocellulose transfer membrane (Whatman Schleicher and Schuell, Dassel, Germany). Horseradish peroxidase-coupled secondary antibodies were visualized using a chemiluminescence reagent detection system (GE Healthcare).
Cathepsin D Sorting Assay
Cathepsin D sorting was assayed essentially as described previously (Doray et al., 2002
). Briefly, COS-7 cells, transfected with GFP, CVAK104 or AP1-specific siRNA were washed, placed in methionine-free medium, and labeled for 2 h at 37°C with 0.5 mCi/ml Redivue I-[35S]methionine (GE Healthcare) in the presence of 20 mM HEPES, pH 7.4. Excess of unlabeled methionine (10 mM final concentration) was added to initiate a 4-h chase at 37°C. Cells were then placed on ice and lysed as described previously (Lobel et al., 1989
). Cathepsin D was immunoprecipitated overnight at 4°C with a rabbit anti-human cathepsin D antiserum and protein A-Sepharose beads from high-speed supernatants of cell lysates and from culture medium. Immunoprecipitated proteins were separated on an 11% SDS-PAGE under nonreducing conditions. Gels were treated with EN3HANCE (PerkinElmer Life and Analytical Sciences, Boston, MA), dried, and exposed to Kodak Biomax MR film (Eastman Kodak, Rochester, NY) at 80°C.
| RESULTS |
|---|
|
|
|---|
|
|
90 kDa failed to bind (Figure 1A, asterisk). The size of the fragment indicated that the loss of
150 residues from the N- or C-terminal end of CVAK104 abolished clathrin binding. This suggested that the clathrin binding site is most likely located close to either end of the CVAK104 polypeptide chain and that the DLL-sequence motifs at positions 434 and 655, respectively, are not sufficient for clathrin binding.
To directly identify the clathrin binding region within CVAK104, we expressed three GST-fusion protein fragments: the first covered the N-terminal segment from the N terminus to 375Cys [GST-CVAK104-(1-375)] that includes the kinase homology domain; the second, GST-CVAK104-(1-697) extends to 697Lys with the two DLL motifs included; the third stretches from 699Gln to the C terminus [GST-CVAK104-(699-929)] (Figure 2A). For pull-down binding assays, the aforementioned GST-fusion proteins were attached to GSH-Sepharose beads and incubated with rat brain cytosol. Whereas full-length CVAK104 and the C-terminal segment 699-929 associated with clathrin, neither of the two N-terminal fragments did (Figure 2B). This result suggests that the interaction of CVAK104 with the TD of clathrin is mediated by the C-terminal region of CVAK104 and not by the two DLL motifs. This conclusion was further supported by the results of a pull-down experiment showing that GST-TD attached to GSH-Sepharose readily associated with CVAK104-(699-929) (Figure 2C). Interestingly, the interaction of the CVAK104 fragment with the clathrin TD was efficiently competed by adding an excess of a polyhistidine-tagged recombinant fragment of AP180 (segment 329-746) that contains five DLL motifs and is known to associate with the TD of clathrin (Lafer, 2002
) (Figure 2D). We also observed that the
2-hinge + ear domain (
2-residues 592-951) of AP2, which contains in its flexible hinge region the 631LLNLD clathrin box motif, inhibited binding of CVAK104 to TD (Figure 2E). Thus, we can conclude that CVAK104, AP180, and the
2-subunit of AP2 bind to the same or overlapping sites on the clathrin TD.
AP2 was previously reported to interact with CVAK104 (Conner and Schmid, 2005
). When we analyzed the proteins that associated with the immobilized CVAK104 after incubation with cytosol by Western blotting for the presence of AP1 or AP2, we failed to detect either (our unpublished data). We also were unable to coimmunoprecipitate AP2 with antibodies directed against the CVAK104 (our unpublished data). However, when a highly enriched adaptor protein fraction from pig brain clathrin-coated vesicles was incubated with the immobilized CVAK104 or CVAK104-(699-929), we detected weak binding of AP2 to full-length CVAK104 but better binding to the C-terminal segment 699-929 (Figure 2F). The apparent stronger binding of AP2 to the C-terminal CVAK104 fragment is readily explained by the fact that CVAK104 is very sensitive to proteolytic attack, which results preferentially in the loss of C-terminal portions of the immobilized GST-tagged CVAK104, thereby lowering in effect the concentration of the bait, whereas the GST-CVAK104-(699-929) proved to be more stable. Another explanation could be that the AP2 binding site in the C-terminal segment of CVAK104 is not readily accessible in the intact protein. In contrast to AP2, the Golgi adaptor AP1 failed to bind to both fusion proteins.
The
-appendage domain of AP2 is known to constitute a major platform for proteinprotein interactions with diverse binding partners. A GST-pull-down experiment demonstrated that the C-terminal CVAK104 segment 699-929 directly associates with the
-appendage domain of AP2 (Figure 2G).
Together, we have demonstrated that the clathrin N-terminal domain and the
-appendage domain of AP2 associate in vitro with a C-terminal segment of CVAK104 that starts with 699Gln.
Tissue Expression and Subcellular Localization of CVAK104
Next, we wanted to determine whether the in vitro interaction of CVAK104 with clathrin and AP2 manifests itself in a colocalization of CVAK104 with those proteins in vivo. So far, there is only evidence that CVAK104 is expressed in brain. Therefore, we first analyzed several mouse organs as well as HeLa and COS-7 cultured cells for the expression of CVAK104 by immunoblotting. We observed that CVAK104 is ubiquitously expressed and that its expression relative to that of the AP1
subunit seemed to be constant in all organs and cell lines that were examined by us (Figure 3).
|
-1,4-GT is located in the trans-Golgi and in the TGN. Endogenous CVAK104 overlapped well with this marker but less so with the cis-Golgi matrix protein GM130 (Figure 4B). The absence of CVAK104 from the cis-Golgi was more clearly seen when the Golgi stacks were disrupted by treatment with nocodazole. Figure 4B clearly shows that in contrast to GM130 many of the GT spots coincide with CVAK104 puncta in nocodazole-treated cells, indicating that perinuclear CVAK104 is also part of the TGN. At steady state, the cation-independent mannose 6-phosphate receptor (CI-M6PR) is mainly found in the endosomal system and in the TGN (Kornfeld, 1992
|
|
To determine the distribution of CVAK104 between the cytosolic and membrane fraction, HeLa cell homogenates were separated by ultracentrifugation into the two fractions and analyzed by SDS-PAGE and immunoblotting. This showed that
33% of the endogenous CVAK104 in HeLa cells is associated with membranes (Figure 9C, inset).
Dynamic Behavior of CVAK104-containing Membrane Structures
The dynamics of CVAK104 was studied in live COS-7 cells expressing GFP-CVAK104. Most strikingly, GFP-CVAK104labeled organelles or vesicles were highly motile (Figure 6A and Movie 6A.mov, published as supporting information). The colocalization of clathrin with CVAK104 seen in fixed cells prompted us to cotransfect COS-7 cells with GFP-CVAK104 and RFP-tagged clathrin light chain A (RFP-CLC) and to image both proteins in living cells. The series of frames from Movie 6B.mov shown in Figure 6B illustrates that GFP-CVAK104 and RFP-CLC are often localized to the same rapidly moving structures. Furthermore, when GFP-CVAK104 expressing COS-7 cells were allowed to take up Texas Red-labeled transferrin for 5 min, we observed that GFP-CVAK104 and transferrin often moved together (Movie 6C.mov and Figure 6C). Thus, the live-cell imaging data confirm the colocalization of CVAK104 with clathrin and internalized transferrin.
|
S. Recruitment of CVAK104 and AP1 was detected by immunofluorescence (Figure 8). On inclusion of an ATP-regenerating system to the cytosol no significant binding above background level of CVAK104 and AP1 was observed (Figure 8, A and B). However, in the presence of GTP
S, a poorly hydrolyzable GTP analogue that locks GTPases such as ARF in their active membrane-bound state, substantial amounts of both proteins were found on Golgi and/or endosomal membranes of the permeabilized PtK cells (Figure 8C). The GTP
S-induced recruitment of CVAK104 and AP1 was not significantly altered when the ATP-regenerating system was additionally present in the assay (Figure 8D). These results strongly suggest that the perinuclear localization of CVAK104 is at least indirectly dependent on a GTP-binding protein, probably on ARF1. ARF1 is also known to stimulate the synthesis of phosphatidylinositol-4,5-bisphosphate (PIP2) on the Golgi complex by recruiting phosphatidylinositol-4-OH kinase-
(Godi et al., 1999
|
|
|
|
-adaptin or CVAK104 compared with cells transfected with a control siRNA. Moreover, the percentage of secreted cathepsin D relative to cell-associated mature plus secreted cathepsin D was 21% in control cells, 25% in AP1-depleted cells, and 33% in CVAK104-depleted cells. Interestingly, the CVAK104 knockdown seemed to have a more severe effect on cathepsin D sorting than the AP1 depletion. But, this phenotype can readily be explained by the different efficiencies of the knockdowns. CVAK104 expression in the siRNA-treated COS-7 cells was found to be 15% of control (Figure 11A), whereas the AP1 expression was only reduced to 38% of control (our unpublished data). Thus, the loss of CVAK104 causes missorting of a significant amount of cathepsin D from the TGN/endosomal pathway to the cell surface.
|
| DISCUSSION |
|---|
|
|
|---|
2 subunit of AP2 and itself (Conner and Schmid, 2005
2-subunit of AP2. This suggests that CVAK104 requires for its association with clathrin a site located in between blade 1 and 2 of the seven-bladed propeller structure of the clathrin N-terminal domain. Because both, the DLL motifs and the clathrin box motifs interfered efficiently with CVAK104 binding to clathrin, it also can be concluded that AP180 and AP2 bind to the same or at least overlapping sites on the clathrin N-terminal domain. In contrast, the interaction of the C-terminal segment of CVAK104 with AP2 seems to involve an unconventional site on the
-appendage domain of AP2. This is supported by two lines of reasoning: first, there are neither DPF/W- nor FXDXF-type nor WXX(F/W)X(D/E)-type binding motifs present in CVAK104. The former are known to engage the
-appendage platform domain and the latter the
-appendage sandwich subdomain. Second, mutations in the subdomains that are known to prevent binding to the subdomains failed to abolish CVAK104 binding (our unpublished data). Together, these data suggest that CVAK104 is a component of AP2-containing clathrin-coated structures at the plasma membrane or a component of endocytic-coated vesicles. Unexpectedly, however, we observed that endogenous as well as transiently expressed GFP-tagged CVAK104 was not found at the plasma membrane but was instead localized to the TGN and to endosomal membranes of HeLa and COS-7 cells.
Why is CVAK104 found together with clathrin and AP1 on internal membranes rather than together with AP2 at the plasma membrane? It is possible that the exclusion of CVAK104 from AP2-containing clathrin-coated pits results from the competition with other accessory proteins that bind to AP2 with higher affinity. This conjecture is supported by the observation that CVAK104 was able to pull down AP2 only from highly enriched adaptor protein preparations (Conner and Schmid, 2005
; this study) but not from rat brain cytosol, where the AP2 concentration is much lower than in the enriched fractions. Our in vitro binding studies also indicated that the interaction of intact CVAK104 with AP2 is in contrast to its isolated C-terminal segment very low and one explanation could be that the AP2 binding site is only poorly accessible in the intact protein. Moreover, the interaction of CVAK104 with clathrin is necessary for targeting the protein to the TGN and endosomal membranes, because upon clathrin depletion by RNAi CVAK104 was partially redistributed to the cytosol. In contrast, the absence of CVAK104 on AP2-containing clathrin-coated pits indicates that the association with clathrin is not sufficient for the recruitment of CVAK104. It is thus likely that the recruitment of CVAK104 to specific membranes requires at least one more factor in addition to clathrin. Although CVAK104 and AP1 show a very convincing colocalization, we can nevertheless rule out the possibility that both proteins may recruit each other. First, like Conner and Schmid (2005)
, we could not observe any interaction between AP1 and CVAK104 in vitro; and second, depletion of AP1 or CVAK104 by RNAi had little effect on the distribution of the respective other protein. The GTP
S-dependent association of CVAK104 with Golgi/and or endosomal membranes in permeabilized PtK cells and the effect of brefeldin A suggest that small GTPases of the Rab or ARF families might be involved in the correct targeting of CVAK104. These GTPases can alternate between an active GTP-bound form, which is associated with an individual subset of internal membranes, and an inactive cytosolic GDP-bound form (Behnia and Munro, 2005
; Jordens et al., 2005
). Thus, members of the Rab and ARF family would be ideally suited for the organelle-specific recruitment of CVAK104. The localization GFP-CVAK104-(699-929) to clathrin- and AP1-positive structures in the perinuclear region suggests that these additional recruiting factors also interact with the C-terminal domain of CVAK104.
CVAK104 staining overlaps significantly with that of clathrin, AP1, AP3, and endocytosed transferrin in the area of the TGN and throughout the cytoplasm (Figures 4 and 5). In contrast, there is little colocalization of CVAK104 with the early endosomal marker EEA1 (Figure 4). Outside the juxtanuclear area, the number of CVAK104-positive structures exceeds those of AP1, probably because CVAK104 is also present on AP3 structures. AP1 is known to be located at the TGN and on tubulovesicular structures that also contain GGA1 and the mannose-6-phosphate receptor (Puertollano et al., 2001
; Waguri et al., 2003
). These structures are very dynamic, and they undergo transient fusions with peripheral endosomes that allows for the mixing of their contents, e.g., transferrin (Waguri et al., 2003
; Polishchuk et al., 2006
) and explains the partial colocalization of AP1 with transferrin (Figure 5; Waguri et al., 2003
). Our triple-labeling experiments demonstrating colocalization of transferrin with AP1 and CVAK104 (Figure 5) strongly suggest CVAK104 to be a component of the tubulovesicular structures and the peripheral endosomes. However, the absence of EEA1 from the peripheral CVAK104 or AP1-positive structures suggests that they do not correspond to classical early endosomes but are more closely related to recycling endosomes. The RNAi-mediated knockdown of CVAK104 did not cause any significant morphological changes in the distribution of clathrin or adaptors. However, sorting of cathepsin D, either at the TGN or in the peripheral endosomes, was effected to the end that a significant amount of the newly synthesized enzyme was diverted from the lysosomal route to the cell surface and secreted from there into the culture medium. In contrast, neither the uptake nor the recycling of transferrin was altered in CVAK104-depleted cells or in cells overexpressing the GFP-CVAK104-(699-929) fragment.
What might be the function of CVAK104? Its possible role as a kinase ought to be viewed with caution until the original claim has been substantiated by specific mutations of residues involved in the catalytic mechanism or ATP binding. A possible alternate function of the kinase-like domain might be that of a proteinprotein interaction module (Manning et al., 2002
). This module might be regulated by nucleotides, because CVAK104 is an ATP-binding protein (Conner and Schmid, 2005
). Using the gel chromatographic procedure of Hummel and Dreyer (1962)
, we also observed ATP binding to CVAK104 (our unpublished data). Sequence comparisons between species ranging from mammals to fish indicate that CVAK104 is a highly conserved protein. The degree of sequence identity between human CVAK104 and zebra fish is 64%. In the CVAK104 sequence that corresponds to the catalytic loop of Ser/Thr kinases, an invariant aspartic acid is substituted in all species by an asparagine residue, and the invariant lysine is replaced in all but fish by a threonine residue. Given this high degree of conservation and that CVAK104 is expressed in all tested mouse tissues (Figure 3) and the role of CVAK104 in the sorting of lysosomal hydrolases, it can safely be assumed that this novel protein is important for efficient membrane trafficking between the TGN and/or the endosomal system, but its precise molecular role remains to be elucidated.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-05-0390) on August 16, 2006.
Address correspondence to: Ernst J. Ungewickell (ungewickell.ernst{at}mh-hannover.de)
Abbreviations used: ARF, ADP-ribosylation factor; BFA, brefeldin A; BSA, bovine serum albumin; CCV, clathrin-coated vesicle; CVAK104, coated-vesicle-associated kinase of 104 kDa; EEA, early endosomal antigen; GFP, green fluorescent protein; GST, glutathione S-transferase; GT, galactosyltransferase; HC, heavy chain; LC, light chain; M6PR, mannose 6-phosphate receptor; PBS, phosphate-buffered saline; PIP2, phosphatidylinositol-4,5-bisphosphate; RFP, red fluorescent protein; RNAi, RNA interference; siRNA, short interfering RNA; TD, amino-terminal domain; Tf, transferrin; TGN, trans-Golgi network.
| REFERENCES |
|---|
|
|
|---|
Bar-Zvi, D. and Branton, D. (1986). Clathrin-coated vesicles contain two protein kinase activities. Phosphorylation of clathrin beta-light chain by casein kinase II. J. Biol. Chem 261, 96149621.
Behnia, R. and Munro, S. (2005). Organelle identity and the signposts for membrane traffic. Nature 438, 597604.[CrossRef][Medline]
Benesch, S., Polo, S., Lai, F. P., Anderson, K. I., Stradal, T. E., Wehland, J., Rottner, K. (2005). N-WASP deficiency impairs EGF internalization and actin assembly at clathrin-coated pits. J. Cell Sci 118, 31033115.
Berger, E. G., Aegerter, E., Mandel, T., Hauri, H. P. (1986). Monoclonal antibodies to soluble, human milk galactosyltransferase (lactose synthase A protein). Carbohydr. Res 149, 2333.[CrossRef][Medline]
Blondeau, F., et al. (2004). Tandem MS analysis of brain clathrin-coated vesicles reveals their critical involvement in synaptic vesicle recycling. Proc. Natl. Acad. Sci. USA 101, 38333838.
Brodsky, F. M. (1985). Clathrin structure characterized with monoclonal antibodies. I. Analysis of multiple antigenic sites. J. Cell Biol 101, 20472054.
Brodsky, F. M., Chen, C. Y., Knuehl, C., Towler, M. C., Wakeham, D. E. (2001). Biological basket weaving: formation and function of clathrin-coated vesicles. Annu. Rev. Cell. Dev. Biol 17, 517568.[CrossRef][Medline]
Chen, C. Y. and Brodsky, F. M. (2005). Huntingtin-interacting protein 1 (Hip1) and Hip1-related protein (Hip1R) bind the conserved sequence of clathrin light chains and thereby influence clathrin assembly in vitro and actin distribution in vivo. J. Biol. Chem 280, 61096117.
Chin, D. J., Straubinger, R. M., Acton, S., Nathke, I., Brodsky, F. M. (1989). 100-kDa polypeptides in peripheral clathrin-coated vesicles are required for receptor-mediated endocytosis. Proc. Natl. Acad. Sci. USA 86, 92899293.
Conner, S. D. and Schmid, S. L. (2002). Identification of an adaptor-associated kinase, AAK1, as a regulator of clathrin-mediated endocytosis. J. Cell Biol 156, 921929.
Conner, S. D. and Schmid, S. L. (2005). CVAK104 is a novel poly-L-lysine-stimulated kinase that targets the beta2-subunit of AP2. J. Biol. Chem 280, 2153921544.
Cousin, M. A. and Robinson, P. J. (2001). The dephosphins: dephosphorylation by calcineurin triggers synaptic vesicle endocytosis. Trends Neurosci 24, 659665.[CrossRef][Medline]
Doray, B., Bruns, K., Ghosh, P., Kornfeld, S. (2002). Interaction of the cation-dependent mannose 6-phosphate receptor with GGA proteins. J. Biol. Chem 277, 1847718482.
Flett, A., Semerdjieva, S., Jackson, A. P., Smythe, E. (2005). Regulation of the clathrin-coated vesicle cycle by reversible phosphorylation. Biochem. Soc. Symp 6570.
Futter, C. E., Gibson, A., Allchin, E. H., Maxwell, S., Ruddock, L. J., Odorizzi, G., Domingo, D., Trowbridge, I. S., Hopkins, C. R. (1998). In polarized MDCK cells basolateral vesicles arise from clathrin-gamma-adaptin-coated domains on endosomal tubules. J. Cell Biol 141, 611623.
Ghosh, P., Dahms, N. M., Kornfeld, S. (2003). Mannose 6-phosphate receptors: new twists in the tale. Nat. Rev. Mol. Cell Biol 4, 202212.[CrossRef][Medline]
Ghosh, P. and Kornfeld, S. (2003). AP-1 binding to sorting signals and release from clathrin-coated vesicles is regulated by phosphorylation. J. Cell Biol 160, 699708.
Godi, A., Pertile, P., Meyers, R., Marra, P., Di Tullio, G., Iurisci, C., Luini, A., Corda, D., De Matteis, M. A. (1999). ARF mediates recruitment of PtdIns-4-OH kinase-beta and stimulates synthesis of PtdIns(4,5)P2 on the Golgi complex. Nat. Cell Biol 1, 280287.[CrossRef][Medline]
Greener, T., Zhao, X., Nojima, H., Eisenberg, E., Greene, L. E. (2000). Role of cyclin G-associated kinase in uncoating clathrin-coated vesicles from non-neuronal cells. J. Biol. Chem 275, 13651370.
Hinners, I. and Tooze, S. A. (2003). Changing directions: clathrin-mediated transport between the Golgi and endosomes. J. Cell Sci 116, 763771.
Hinrichsen, L., Harborth, J., Andrees, L., Weber, K., Ungewickell, E. J. (2003). Effect of clathrin heavy chain- and alpha-adaptin-specific small inhibitory RNAs on endocytic accessory proteins and receptor trafficking in HeLa cells. J. Biol. Chem 278, 4516045170.
Hirst, J., Motley, A., Harasaki, K., Peak Chew, S. Y., Robinson, M. S. (2003). EpsinR: an ENTH domain-containing protein that interacts with AP-1. Mol. Biol. Cell 14, 625641.
Hummel, J. P. and Dreyer, W. J. (1962). Measurement of protein-binding phenomena by gel filtration. Biochim. Biophys. Acta 63, 530532.[Medline]
Jordens, I., Marsman, M., Kuijl, C., Neefjes, J. (2005). Rab proteins, connecting transport and vesicle fusion. Traffic 6, 10701077.[CrossRef][Medline]
Kalthoff, C., Groos, S., Kohl, R., Mahrhold, S., Ungewickell, E. J. (2002). Clint: a novel clathrin-binding ENTH-domain protein at the Golgi. Mol. Biol. Cell 13, 40604073.
Kornfeld, S. (1992). Structure and function of the mannose 6-phosphate/insulinlike growth factor II receptors. Annu. Rev. Biochem 61, 307330.[CrossRef][Medline]
Korolchuk, V. and Banting, G. (2003). Kinases in clathrin-mediated endocytosis. Biochem. Soc. Trans 31, 857860.[CrossRef][Medline]
Lafer, E. M. (2002). Clathrin-protein interactions. Traffic 3, 513520.[CrossRef][Medline]
Le Borgne, R., Alconada, A., Bauer, U., Hoflack, B. (1998). The mammalian AP-3 adaptor-like complex mediates the intracellular transport of lysosomal membrane glycoproteins. J. Biol. Chem 273, 2945129461.
Legendre-Guillemin, V., Metzler, M., Lemaire, J. F., Philie, J., Gan, L., Hayden, M. R., McPherson, P. S. (2005). Huntingtin interacting protein 1 (HIP1) regulates clathrin assembly through direct binding to the regulatory region of the clathrin light chain. J. Biol. Chem 280, 61016108.
Lindner, R. and Ungewickell, E. (1992). Clathrin-associated proteins of bovine brain coated vesicles. An analysis of their number and assembly-promoting activity. J. Biol. Chem 267, 1656716573.
Lobel, P., Fujimoto, K., Ye, R. D., Griffiths, G., Kornfeld, S. (1989). Mutations in the cytoplasmic domain of the 275 kD mannose 6-phosphate receptor differentially alter lysosomal enzyme sorting and endocytosis. Cell 57, 787796.[CrossRef][Medline]
Lowe, M. (2005). Structure and function of the Lowe syndrome protein OCRL1. Traffic 6, 711719.[CrossRef][Medline]
Mallard, F., Antony, C., Tenza, D., Salamero, J., Goud, B., Johannes, L. (1998). Direct pathway from early/recycling endosomes to the Golgi apparatus revealed through the study of shiga toxin B-fragment transport. J. Cell Biol 143, 973990.
Manning, G., Whyte, D. B., Martinez, R., Hunter, T., Sudarsanam, S. (2002). The protein kinase complement of the human genome. Science 298, 19121934.
Meyer, C., Eskelinen, E. L., Guruprasad, M. R., von Figura, K., Schu, P. (2001). Mu 1A deficiency induces a profound increase in MPR300/IGF-II receptor internalization rate. J. Cell Sci 114, 44694476.[Medline]
Meyer, C., Zizioli, D., Lausmann, S., Eskelinen, E. L., Hamann, J., Saftig, P., von Figura, K., Schu, P. (2000). mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. EMBO J 19, 21932203.[CrossRef][Medline]
Meyerholz, A., Hinrichsen, L., Groos, S., Esk, P. C., Brandes, G., Ungewickell, E. J. (2005). Effect of clathrin assembly lymphoid myeloid leukemia protein depletion on clathrin coat formation. Traffic 6, 12251234.[CrossRef][Medline]
Ooi, C. E., Dell'Angelica, E. C., Bonifacino, J. S. (1998). ADP-Ribosylation factor 1 (ARF1) regulates recruitment of the AP-3 adaptor complex to membranes. J. Cell Biol 142, 391402.
Polishchuk, R. S., Pietro, E. S., Pentima, A. D., Tete, S., Bonifacino, J. S. (2006). Ultrastructure of long-range transport carriers moving from the trans-Golgi network to peripheral endosomes. Traffic 7, 810921103.[CrossRef][Medline]
Puertollano, R., Aguilar, R. C., Gorshkova, I., Crouch, R. J., Bonifacino, J. S. (2001). Sorting of mannose 6-phosphate receptors mediated by the GGAs. Science 292, 17121716.
Robinson, M. S. and Bonifacino, J. S. (2001). Adaptor-related proteins. Curr. Opin. Cell Biol 13, 444453.[CrossRef][Medline]
Rouille, Y., Rohn, W., Hoflack, B. (2000). Targeting of lysosomal proteins. Semin. Cell Dev. Biol 11, 165171.[CrossRef][Medline]
Rous, B. A., Reaves, B. J., Ihrke, G., Briggs, J. A., Gray, S. R., Stephens, D. J., Banting, G., Luzio, J. P. (2002). Role of adaptor complex AP-3 in targeting wild-type and mutated CD63 to lysosomes. Mol. Biol. Cell 13, 10711082.
Scheele, U., Alves, J., Frank, R., Duwel, M., Kalthoff, C., Ungewickell, E. (2003). Molecular and functional characterization of clathrin- and AP-2-binding determinants within a disordered domain of auxilin. J. Biol. Chem 278, 2535725368.
Scheele, U., Kalthoff, C., Ungewickell, E. (2001). Multiple interactions of auxilin 1 with clathrin and the AP-2 adaptor complex. J. Biol. Chem 276, 3613136138.
Shih, W., Gallusser, A., Kirchhausen, T. (1995). A clathrin-binding site in the hinge of the beta 2 chain of mammalian AP-2 complexes. J. Biol. Chem 270, 3108331090.
Stamnes, M. A. and Rothman, J. E. (1993). The binding of AP-1 clathrin adaptor particles to Golgi membranes requires ADP-ribosylation factor, a small GTP-binding protein. Cell 73, 9991005.[CrossRef][Medline]
Traub, L. M., Ostrom, J. A., Kornfeld, S. (1993). Biochemical dissection of AP-1 recruitment onto Golgi membranes. J. Cell Biol 123, 561573.
Ungewickell, A., Ward, M. E., Ungewickell, E., Majerus, P. W. (2004). The inositol polyphosphate 5-phosphatase Ocrl associates with endosomes that are partially coated with clathrin. Proc. Natl. Acad. Sci. USA 101, 1350113506.
Valdivia, R. H., Baggott, D., Chuang, J. S., Schekman, R. W. (2002). The yeast clathrin adaptor protein complex 1 is required for the efficient retention of a subset of late Golgi membrane proteins. Dev. Cell 2, 283294.[CrossRef][Medline]
Waguri, S., Dewitte, F., Le Borgne, R., Rouille, Y., Uchiyama, Y., Dubremetz, J. F., Hoflack, B. (2003). Visualization of TGN to endosome trafficking through fluorescently labeled MPR and AP-1 in living cells. Mol. Biol. Cell 14, 142155.
Wang, L. H., Sudhof, T. C., Anderson, R. G. (1995). The appendage domain of alpha-adaptin is a high affinity binding site for dynamin. J. Biol. Chem 270, 1007910083.
Winkler, F. K. and Stanley, K. K. (1983). Clathrin heavy chain, light chain interactions. EMBO J 2, 13931400.
This article has been cited by other articles:
![]() |
Y. Katoh, B. Ritter, T. Gaffry, F. Blondeau, S. Honing, and P. S. McPherson The Clavesin Family, Neuron-specific Lipid- and Clathrin-binding Sec14 Proteins Regulating Lysosomal Morphology J. Biol. Chem., October 2, 2009; 284(40): 27646 - 27654. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Terabayashi, Y. Funato, M. Fukuda, and H. Miki A Coated Vesicle-associated Kinase of 104 kDa (CVAK104) Induces Lysosomal Degradation of Frizzled 5 (Fzd5) J. Biol. Chem., September 25, 2009; 284(39): 26716 - 26724. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Burman, L. Bourbonniere, J. Philie, T. Stroh, S. Y. Dejgaard, J. F. Presley, and P. S. McPherson Scyl1, Mutated in a Recessive Form of Spinocerebellar Neurodegeneration, Regulates COPI-mediated Retrograde Traffic J. Biol. Chem., August 15, 2008; 283(33): 22774 - 22786. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||