![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 17, Issue 11, 4656-4665, November 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Association with the Actin Cytoskeleton Is Regulated by Alternative Splicing
,
*Department of Pharmacology, Biomedical Sciences Program, and Neuroscience Program, University of Colorado Health Sciences Center, Aurora, CO 80045
Submitted March 30, 2006;
Revised August 2, 2006;
Accepted August 11, 2006
Monitoring Editor: Paul Forscher
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
has morphogenic functions in neurons not shared by the 
isoform. CaMKII contains three exons (v1, v3, and v4) not present in the CaMKII gene, and two of these exons (v1 and v4) are subject to differential alternative splicing. We show here that CaMKII, but not , mediated bundling of F-actin filaments in vitro. Most importantly, inclusion of exon v1 was required for CaMKII association with the F-actin cytoskeleton within cells. CaMKIIe, which is the dominant variant around birth and lacks exon v1 sequences, failed to associate with F-actin. By contrast, CaMKII', which instead lacks exon v4, associated with F-actin as full-length CaMKII. Previous studies with CaMKII mutants have indicated a role of nonstimulated kinase activity in enhancing dendritic arborization. Here, we show that F-actin–targeted CaMKII, but not , was able to phosphorylate actin in vitro even by nonstimulated basal activity in absence of Ca2+/CaM. In rat pancreatic islets and in skeletal muscle, the actin-associated CaMKII' and M were the predominant variants, respectively. Thus, cytoskeletal targeting may mediate functions of CaMKII variants also outside the nervous system. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; McGee and Bredt, 2003; Lamprecht and LeDoux, 2004; Segal, 2005). The isoform of Ca2+/calmodulin(CaM)-dependent protein kinase II (CaMKII) has been studied extensively because of its prominent role in regulating the strength of individual synaptic connections (for examples, see Malinow et al., 1989; Silva et al., 1992; Giese et al., 1998; for reviews, see Malenka and Nicoll, 1999; Lisman et al., 2002; Griffith, 2004). Much less is known about the other major brain isoform, CaMKII. However, CaMKII has specific morphogenic functions in regulating dendritic arborization and synapse density not shared by the isoform (Fink et al., 2003). This isoform specificity is thought to be mediated by the specific binding of CaMKII, but not to F-actin (Shen et al., 1998; Fink et al., 2003).
The four CaMKII isoforms encoded by different genes (, , 
, and 
) are highly homologous to each other and can phosphorylate and regulate a variety of substrate proteins in response to Ca2+ signals (for reviews, see Soderling et al., 2001; Hudmon and Schulman, 2002; Lisman et al., 2002; Colbran and Brown, 2004). The multimeric CaMKII holoenzymes are composed of 12 subunits (Kolodziej et al., 2000; Morris and Torok, 2001; Rosenberg et al., 2005; Rosenberg et al., 2006) of a single isoform or combinations of different isoforms (Bayer et al., 1998; Shen et al., 1998; Brocke et al., 1999; Lantsman and Tombes, 2005). All CaMKII isoforms contain an N-terminal kinase domain and a C-terminal association domain, connected by a variable linker region that is subject to alternative splicing (see Figure 1). Within a holoenzyme, each subunit is activated separately by Ca2+/CaM; however, binding of Ca2+/CaM to two neighboring subunits initiates an intersubunit autophosphorylation at T286 (or T287 in , , and ) that renders the kinase autonomous (active in the absence of Ca2+/CaM) (Hanson et al., 1994; Rich and Schulman, 1998). This autophosphorylation may have a molecular memory function (for review, see Lisman and McIntyre, 2001) and enables Ca2+-spike frequency decoding by CaMKII (De Koninck and Schulman, 1998; Bayer et al., 2002). At least one CaMKII isoform is present in every tissue examined (Tobimatsu and Fujisawa, 1989; Bayer et al., 1999). However, CaMKII is especially enriched in the brain, where the and isoforms can constitute up to 1–2% of total protein (Erondu and Kennedy, 1985). Although CaMKII is exclusively expressed in neurons, CaMKII is additionally found in skeletal muscle and in endocrine cells such as pituitary, adrenal glands, and pancreatic cells (Tobimatsu and Fujisawa, 1989; Urquidi and Ashcroft, 1995; Bayer et al., 1998; Rochlitz et al., 2000; Tabuchi et al., 2000). CaMKII is thought to regulate Ca2+ homeostasis in muscle (Wang and Best, 1992; Xu et al., 1993; Hain et al., 1995) and insulin secretion and production in pancreatic beta cells (Wasmeier and Hutton, 1999; Tabuchi et al., 2000; Osterhoff et al., 2003; for review, see Easom, 1999).
|
; Tombes et al., 2003). For example, the CaMKII gene does not contain any sequences homologous to the CaMKII variable exons v1, v3, and v4 (Figure 1), whereas the CaMKII gene does not contain a homologue to an insert that mediates nuclear targeting of the CaMKII splice variant B (Srinivasan et al., 1994; Heist et al., 1998). Thus, we hypothesized that sequences encoded by the exons v1, v3, and/or v4 are involved in CaMKII-specific targeting to the F-actin cytoskeleton. At least CaMKII exons v1 and v4 are subject to alternative splicing in brain. Although expression of CaMKII dominates in mature brain, expression of CaMKIIe, which lacks exon v1, dominates in brain around and before birth (Brocke et al., 1995). Interestingly, alternative splicing of exons v1 (lacking in e and e') and v4 (lacking in ' and e') is differentially regulated even among individual mature hippocampal CA1 pyramidal neurons, with most neurons expressing exclusively one splice variant (Brocke et al., 1999). Thus, tightly regulated alternative splicing may control expression of differently actin-associated CaMKII variants, thereby possibly affecting the morphogenic functions of CaMKII in dendritic arborization and/or synapse density. Results of this study summarized in Figure 1 show that CaMKII and ', but not e, associated with the F-actin cytoskeleton, demonstrating a developmental switch between differently targeted splice variant. |
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
or was purified from a baculovirus/Sf9 expression system on a phosphocellulose column followed by gel filtration chromatography, as described previously (Singla et al., 2001; Bradshaw et al., 2002; Fink et al., 2003). Actin (4 µM) was polymerized on ice in F-buffer (25 mM HEPES, pH 7.4, 50 mM KCl, 2 mM MgCl2, 1 mM EGTA, 0.5 mM dithiothreitol [DTT], and 0.2 mM ATP). CaMKII (170 nM subunits), 3 µM CaM, and/or 2 mM CaCl2 were added as indicated and binding was assessed as described previously (Fink et al., 2003). However, sedimentation was carried out at lower centrifugation speed (10,000 x g) for 20 min. Both F-actin and CaMKII were spun under the same condition before the binding assay. Supernatants and pellets were analyzed for actin and CaMKII or by Western blot analysis with the specific antibodies anti-actin 20–33 (rabbit polyclonal; 1:500 in 2% bovine serum albumin [BSA]; Sigma-Aldrich, St. Louis, MO), CB2 or CB1 (mouse monoclonals; 1:2000 and 1:1000 in 2.5% milk), respectively (Bayer et al., 1998; Fink et al., 2003). For electron microscopy, actin was polymerized, and kinase was added as described above. Copper grids were coated with Formvar and carbon and then glow discharged. Approximately 10 µl of the actin/kinase mix was applied to the copper grids for 2 min and excess liquid was wicked away with blotting paper. Grids were stained with 1–2% uranyl acetate for 2 min and then briefly rinsed in distilled water. Excess liquid was removed, and grids were allowed to dry. Electron microscopy was performed on a Tecnai G2 BioTwin (at 80 kV and 49,000 magnification) in the electron microscopy core facility of University of Colorado Health Sciences Center (Aurora, CO).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Expression Analysis
Pancreatic islets from Sprague Dawley rats (Harlan, Indianapolis, IN) were isolated at the islet core facility of the Diabetes and Endocrine Research Center at University of Colorado Health Sciences Center. Total cellular RNAs were prepared using RNAqueous-4PCR (Ambion, Austin, TX). SuperScriptIII reverse transcriptase (Invitrogen, Carlsbad, CA) was used for cDNA synthesis, primed with both random decamers and 12–18mer oligo(dT). PCR amplification for expression analysis was done with Platinum-Taq (Invitrogen) and CaMKII-specific primers flanking the variable region (bvf, GACAGGAGACTGTGGAATGTC and bvr, TCAAAGTCGCCGTTGTTGAC) for 40 cycles with 15-s denaturation at 94°C for 20 s, annealing at 55°C, and 90-s elongation at 72°C (shorter elongation times favored shorter PCR products from skeletal muscle cDNA, corresponding in length to instead of M; our unpublished data). RT-PCR products were separated on 2% agarose gels in TAE-buffer, and stained with ethidium bromide (0.1 µg/ml gel). For direct sequencing, RT-PCR products were purified using QIAquick (QIAGEN, Valencia, CA).
Cell Culture, Transfection, and Constructs
Cos-7 cells were cultured on glass-bottomed dishes (30 mm with 12-mm glass bottom; MatTek, Ashland, MA) and transfected by the calcium phosphate method as described previously (Bayer et al., 1998, 2001, 2006). An enhanced green fluorescent protein [EGFP] A207K mutant with reduced dimerization was used to create membrane-associated form of green fluorescent protein (mGFP)-CaMKII constructs (Zacharias et al., 2002; Bayer et al., 2006). Vectors for expression of unlabeled or hemagglutinin (HA)-tagged CaMKII splice variants were described previously (Brocke et al., 1995; Bayer et al., 2002); SacI/PmlI fragments were exchanged to create the mGFP fusion protein (the SacI site in the multiple cloning site of the original mGFP-CaMKII was deleted by religation after XhoI/EcoRI cut). mGFP-CaMKII K43R, A303R, and T287D were created by exchanging cyan fluorescent protein in previously described constructs (Bayer et al., 2002) with mGFP. mGFP-CaMKII
3 was created by PCR mutagenesis by using mGFP-CaMKIIe as a template and primer combination that flanked the exon v3 and v4 sequences. After sequencing of a positive clone, a SacI/PmlI fragment was exchanged with the original vector as described above to avoid possible PCR-generated mutations in the vector sequence.
F-Actin Staining and Microscopy
mGFP-CaMKII localization in Cos-7 cells was analyzed 2 d after transfection. Scoring of actin cytoskeletal localization in live cells was done on a Nikon TE-300 inverted microscope with a 63x objective, blind of the mGFP-CaMKII variant used. Fifty or all transfected cells per dish were scored; eight dishes were analyzed for each construct. Alternatively, cells were fixed in 4% paraformaldehyde in 100 mM phosphate buffer, pH 7.2, for 10 min at room temperature, permeabilized for 20–30 min in 0.1% Triton X-100 in phosphate-buffered saline (PBS), and F-actin was stained by 165 nM Texas Red-phalloidin (Invitrogen) in PBS for 30 min. Images were taken on a Zeiss Axiovert 200M microscope (Carl Zeiss, Thornwood, NY) equipped with a 63x plan-apo/1.2 numerical aperture objective, 175-W xenon light source, independently controlled excitation and emission filter wheels, and a CoolSnapHQ camera (Roper Scientific, Trenton, NJ). Fluorescence images were acquired blind of the mGFP construct and analyzed for GFP/Texas Red colocalization correlation index by using SlideBook software (Intelligent Imaging Innovations, Denver, CO). Six images 0.5 µm apart in the z-plane were taken per cell, deconvoluted, and maximum projected.
Fluorescence Recovery after Photobleaching (FRAP) Analysis
Motility of mGFP-CaMKII variants in transfected Cos-7 cells was analyzed by FRAP on the Zeiss imaging setup described above, at 30°C in 50 mM HEPES-buffered, pH 7.4, Hank's balanced saline. Bleaching was done using a micropoint FRAP system (Photonic Instruments, St. Charles, IL), and images were acquired every 5 s; the first image acquisition possible on the setup was 
2 s after bleach (set to t = 0 s). Background fluorescence, measured outside cells, was subtracted. The average fluorescence intensity during 60 s before bleach was rescaled to 1, and the intensity on the first image after bleach was rescaled to 0. Photobleach caused by image acquisition was minimal and was not corrected for in the data presentation. The slope (k) and maximum (ymax) of the recovery curves was determined by curve fit to the single exponential association function y = ymax * (1 – e–kx) in GraphPad Prism software (GraphPad Software, San Diego, CA). For calculating bleach efficiency, intensity before bleach was rescaled to 0%, and background intensity was rescaled to –100%. To correct the estimate of the recoverable pool for recovery occurring even before the first test image, intensity of the first live image after bleach was rescaled to apparent bleach efficiency in this image divided by the real bleach efficiency as measured in fixed cells (instead of rescaling it to 0). The estimate of the actual recoverable pool was not corrected for reduction in the total fluorescence within cells caused by the bleach.
F-Actin Phosphorylation Assay
Purified CaMKII (100 nM subunits) was added to 4 µM actin polymerized in F-buffer as described above. The kinase/actin mix was then diluted 1:5 into phosphorylation buffer (25 mM HEPES, pH 7.4, 50 mM KCl, 20 mM MgCl2, 0.2 mM [-32P]ATP at 0.5 Ci/mmol, and 1.2 mM EGTA) and incubated for 15 min at 30°C to measure phosphorylation by basal activity. Stimulated phosphorylation was induced for 3 min by a mix that contained 2 mM CaCl2 and 1 µM CaM instead of EGTA. CaMKII inhibitors were added as indicated. To assess phosphorylation of kinase and actin, the reaction mixes were separated on SDS-gels, blotted onto nitrocellulose membrane, and subjected to autoradiography.
In a similar assay, mGFP-CaMKII wild type and K43R in extracts from transfected Cos-7 cells were used, with extracts of mock-transfected cells as control. Cos-7 cells were extracted in HB (50 mM PIPES, pH 7.2, 10% glycerol, 1 mM EGTA, 1 mM DTT, and 1X Boehringer protease inhibitor cocktail), and kinase was solubilized with 150 mM sodium perchlorate before a 20-min 16,000 x g centrifugation at 4°C. The extract supernatants were adjusted for amount of kinase (as determined by GFP fluorescence) and total Cos protein (using extracts from mock-transfected cells; determined by Bradford assay with BSA standard). Adjusted extracts were centrifuged for 60 min at 100,000 x g. The sodium perchlorate was removed from the supernatants using Microcon YM-100 spin columns (Millipore, Billerica, MA), yielding the final extracts used in the phosphorylation reactions.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, but Not may be able to interact with several F-actin filaments simultaneously. Formation of such large F-actin complexes can be assessed in vitro by low-speed sedimentation assays. Although individual filaments are sedimented at 100,000 x g, presence of a cross-linking protein is required for F-actin sedimentation at 10,000 x g. Indeed, F-actin was sedimented at low speed only in presence of CaMKII (Figure 2A). As previously described for binding, formation of large CaMKII/F-actin complexes was disrupted by Ca2+/CaM; either Ca2+ or CaM alone was not sufficient to disrupt these complexes (Figure 2A). By contrast, CaMKII did not result in F-actin sedimentation under any conditions.
|
complexes, electron microscopy was performed after negative staining with uranyl acetate. Without kinase or in presence of CaMKII, no formation of extensive actin filament bundles was observed (Figure 1B and Supplemental Figure 1), as expected. By contrast, addition of CaMKII resulted in formation of F-actin bundles with multiple parallel filaments (Figure 2C). Additionally, in some areas CaMKII seemed to cross-link filaments without bundle formation (Figure 2C, right). In these areas, particles of CaMKII holoenzyme size (25 nm in diameter) were observed associated with the actin filaments. Similar particles were also seen associated with the F-actin bundles. Although such particles also may be present within the tightly packed bundles, they could not be clearly distinguished in such location (Figure 2C).
CaMKII and ', but Not 3 or e, Associated with the Actin Cytoskeleton
We hypothesized that the variable exons v1, v3, and/or v4, which are lacking in the isoform, are necessary for F-actin association (Figure 1). CaMKIIe and ' lack exons v1 and v4, respectively. By contrast, no splice variant lacking exon v3 was detected in rat brain (Supplemental Figure 2). Thus, we generated a CaMKII mutant (3) that lacks exons v1, v3, and v4. mGFP fusion proteins of the CaMKII and isoforms, the 3 mutant, and the splice variants ', e, and M (Figure 1) were expressed in Cos-7 cells, and their subcellular localization was analyzed (Figure 3). First, apparent F-actin localization (stress fibers, cortical actin, and membrane ruffles) of the GFP fluorescence in live cells was scored into three categories (strong, mild, and no apparent F-actin localization) (Figure 3A). Then, cells were fixed and F-actin was stained with phalloidin-Texas Red, and the index of GFP/Texas Red colocalization was determined on deconvoluted images (Figure 3B). Examples of phalloidin-stained transfected Cos-7 cells are shown in Figure 3C. As hypothesized, CaMKII3 did not associate with F-actin structures. Even lack of exon v1 alone, in the splice variant e, was sufficient to disrupt F-actin association. Localization of both 3 and of e was indistinguishable from CaMKII localization in both analysis methods. By contrast, lack of exon v4 in ' did not reduce F-actin association seen for the full-length CaMKII. CaMKIIM contains an additional insert C-terminal of exon v5 (Figure 2) that generates putative binding sites for Src homology 3 (SH3) domains (Bayer et al., 1998). Localization of M, , and ' were indistinguishable in the scoring analysis in live cells (Figure 3A). After phalloidin stain, the F-actin colocalization coefficient for M was significantly higher than for , 3, and e; however, it was lower compared with and ' (Figure 3B). This may reflect association of the M variant with additional subcellular targets, as has been speculated previously based on putative SH3 binding (Urquidi and Ashcroft, 1995; Bayer et al., 1998). Together, the results clearly indicate that the variable region exon v1, which is lacking in CaMKIIe, is necessary for localization to the actin cytoskeleton within cells (for overview, see Figure 1).
|
and e Were More Mobile within Cells than and ' and e was indistinguishable from each other and relatively fast (Figure 4A) (k = 5.79 ± 0.26 and 5.12 ± 0.29 min–1, respectively, after curve fit to single exponential association). Fluorescence recovered almost completely (90%) within 2 min, indicating that and e are mobile and not persistently targeted to any subcellular structures within Cos-7 cells. FRAP of CaMKII and ' was also similar to each other, but significantly different from and e FRAP (Figure 4A). FRAP was slower (k = 1.55 ± 0.08 and 2.15 ± 0.09 min–1, respectively) and fluorescence recovered only partially (50%). This indicates that a significant pool of and ' remained persistently bound to F-actin and did not exchange in the unstimulated Cos-7 cells. Examples of e and ' FRAP images are shown in Figure 4A. In addition to bleaching e in its typical evenly distributed localization (Figure 4A, first row), we also bleached e enriched in actin-like structures (Figure 5A, second row), which is more typical for or ' localization (Figure 4A, third row). FRAP of e was equally fast and complete in both localizations, indicating that any apparent actin-like localization of e is different in nature from the more extensive actin association of or '.
|
|
and e in live cells were only about one-half of that seen for and ' (Figure 4B). This is probably because of significant diffusion of and e even during the time between the bleach and acquisition of the first image (2 s). Indeed, mGFP-CaMKII and showed the same bleach efficiency in fixed cells, which was also undistinguishable from the apparent bleach efficiencies for and ' in live cells (Figure 4B). Thus, the recoverable pool of and e during FRAP is even higher than initially estimated from the rescaled fluorescence recovery shown in Figure 4A (95% instead of 90%). Notably, monomeric mGFP alone typically showed only minimal apparent bleach efficiency but in a much larger apparent bleach area (our unpublished data). Thus, FRAP of the soluble and e is probably resolvable in our experimental setup only because of relatively slow diffusion of the large mGFP-CaMKII holoenzymes (>900 kDa).
Localization of CaMKII Mutants
CaMKII and several of its mutants were previously tested for their effect on dendritic arborization of hippocampal neurons in dissociated culture (Fink et al., 2003). We have now quantified the actin cytoskeletal localization of these CaMKII mutants in Cos-7 cells (Figure 5). A303R (impaired for CaM binding) and K43R (impaired for ATP binding) localized to F-actin similarly as wild type. However, in the live cell scoring, A303R seemed to localize even stronger than wild type (p < 0.05 in two-tailed t test) (Figure 5). A303R does not disperse from F-actin upon Ca2+ signals (Shen and Meyer, 1999), likely because of impaired CaM binding; this seems to mildly enhance localization even in unstimulated cells. By contrast, the CaMKII mutant T287D (constitutively active) did not show F-actin colocalization (Figure 5). T287D mimics autophosphorylation at T287, indicating that T287 autophosphorylation is involved in regulation of actin binding, either directly or by increasing affinity for Ca2+/CaM (Meyer et al., 1992). The T287D mutant had significantly lower effect on dendritic arborization than wild type (Fink et al., 2003), further supporting functional importance of cytoskeletal localization of CaMKII.
F-Actin Phosphorylation by Basal Activity of Bound CaMKII
The CaM-binding impaired CaMKII mutant A303R enhanced dendritic arborization in hippocampal neurons, whereas the ATP-binding impaired K43R mutant did not (Fink et al., 2003), indicating a possible role for CaM-independent kinase activity. Could F-actin binding directly enhance CaM-independent CaMKII activity? CaMKII binding to F-actin did not increase phosphorylation of a substrate peptide, indicating that the activation state of the kinase was not changed (Fink et al., 2003). However, CaMKII can autophosphorylate at residues other than T286/T287, even by its basal activity (Colbran, 1993), that is, by activity without Ca2+/CaM stimulation or phosphorylation at T286/287 (Figure 6) (T286/T287 autophosphorylation requires binding of Ca2+/CaM to make T286/T287 accessible as a substrate, in addition to kinase activation; Hanson et al., 1994; Rich and Schulman, 1998). Thus, we hypothesized that basal activity of targeted CaMKII could similarly suffice to phosphorylate other substrate proteins that are anchored in the right position. Indeed, purified CaMKII phosphorylated F-actin in vitro even by nonstimulated basal activity, whereas the nonactin-binding CaMKII isoform did not (Figure 6). This is not because of differential substrate preference of the isoforms, because CaMKII did phosphorylate actin at least as well as CaMKII when stimulated by Ca2+/CaM (Figure 6). The phosphorylated actin-sized band was only observed in presence of actin, but not when actin was omitted or substituted for BSA, or when CaMKII was omitted (Supplemental Figure 3). The CaMKII inhibitor KN93, but not the inactive analogue KN92, inhibited Ca2+/CaM-stimulated actin phosphorylation by both CaMKII and . Actin phosphorylation by basal activity of CaMKII was not inhibited (Figure 6A), as expected, because KN93 is competitive with Ca2+/CaM (Sumi et al., 1991) and thus should not inhibit basal activity. Other inhibitors such as AIP or CaM-KIINtide are not competitive with Ca2+/CaM, but bind to CaMKII only in the activated and not in the basal state (Ishida et al., 1995; Chang et al., 2001). To further test actin phosphorylation by basal CaMKII activity, mGFP-CaMKII wild type and the ATP-binding impaired mutant K43R from extracts of transfected Cos-7 cells were used (Supplemental Figure 3). The K43R extract caused phosphorylation above background, indicating some residual kinase activity of this mutant; the alternative that actin bundling by CaMKII activated another kinase seems less likely. Also, wild-type kinase extracts caused a higher degree of basal actin phosphorylation than both K43R extracts and extracts from mock-transfected cells (Supplemental Figure 3). These results strongly support phosphorylation by basal activity of targeted CaMKII and give a possible explanation why the two activation-deficient CaMKII mutants A303R (CaM-binding impaired) and K43R (ATP-binding impaired) have opposite effects on dendritic arborization (Fink et al., 2003).
|
Variants during Development and in Different Tissues, ', e, and e' in frontal cortex of rat brain on day 2 after birth, whereas dominated by day 14 and was even more prominent in adult brain (Figure 7A). This developmental switch is consistent with a previous report (Brocke et al., 1995). However, CaMKIIe expression is not eliminated during development (Brocke et al., 1999; Supplemental Figure 2). Expression of CaMKII variants was also detected in pancreatic islets and in skeletal muscle, but not in heart (Figure 7B). The major splice variant in skeletal muscle correspondend in length to CaMKIIM (Bayer et al., 1998), whereas the major variant in islets corresponded to CaMKII'. Identity of CaMKII' was confirmed by restriction digest (Figure 7C) and by direct sequencing of the RT-PCR product. Thus, skeletal muscle and islets expressed two different but F-actin–associated CaMKII variants (cf. Figure 3). Additionally, small amounts of and e' transcripts were identified in islets, based on the length of two minor RT-PCR products (our unpublished data).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
function in enhancing dendritic arborization and synapse density is thought to be mediated by CaMKII binding to F-actin, a property not shared by the isoform (Fink et al., 2003). Consistent with this isoform-specific binding, the CaMKII, but not the isoform, assembled with F-actin into large complexes, including bundles of parallel actin filaments. Most importantly, alternative splicing of CaMKII regulated its localization to F-actin within cells. CaMKII and ', but not e, associated with the actin cytoskeleton, indicating that the sequence encoded by variable exon v1 is necessary for the interaction (Figure 2). Alternative splicing of exon v1 depends both on cell type and developmental stage.
CaMKIIe is the dominant splice variant before birth; CaMKII becomes dominant between day 4 and 13 of postnatal rat brain development, both in cortex and hippocampus (Brocke et al., 1995). Thus, alternative splicing of CaMKII provides a developmental switch from a cytoplasmic to an actin cytoskeleton-associated isoform. The F-actin–binding CaMKII enhances dendritic arborization and synapse formation (Fink et al., 2003), and the timing of the developmental switch to this splice variant correlates with extensive synapse formation. Notably, the e variant dominates at a time when the other major brain isoform, CaMKII, is not yet significantly expressed (Burgin et al., 1990; Bayer et al., 1999). CaMKIIe variant transcripts also were found also in mature rat brain. Thus, although there is a developmental switch in splicing, expression of e is not eliminated during development. Indeed, e transcripts have been detected previously in mature hippocampal CA1 pyramidal neurons by single cell RT-PCR (Brocke et al., 1999). Four of 14 CaMKII-positive cells expressed e transcripts, indicating differentially regulated alternative splicing even among mature neurons of the same cell type (Brocke et al., 1999). Notably, splice variant expression seemed segregated, with only one cell expressing more than one splice variant (Brocke et al., 1999). This segregation of expression may be functionally important, because CaMKII coassembles also with nonactin binding isoforms and targets such heteromeric holoenzymes to the actin cytoskeleton (Shen et al., 1998). CaMKII can partially escape such coassembly and cotargeting, because its mRNA is targeted to dendrites (Burgin et al., 1990; Mayford et al., 1996); protein synthesis in a separate compartment then allows formation of homomeric holoenzymes. By contrast, coexpression of CaMKII and e would result in actin-targeted heteromers, which can be prevented by exclusive expression of only one variant within individual neurons. The mechanism for differential regulation of CaMKII splicing even among individual neurons of the same cell type is presently unclear. However, regulation by synaptic stimulation is an intriguing possibility that may provide a novel form of long-lasting neuronal plasticity. Synaptic plasticity indeed involves F-actin dynamics (Kim and Lisman, 1999; Fischer et al., 2000; Krucker et al., 2000; Star et al., 2002; Penzes et al., 2003; Okamoto et al., 2004; for review, see Lamprecht and LeDoux, 2004), which may be differentially modulated by CaMKII isoforms with different actin association (Fink et al., 2003).
In addition to neurons, CaMKII gene expression was found in pancreatic islets and in skeletal muscle, but not in heart. The dominant transcript in skeletal muscle, CaMKIIM, contains exon v1 (Bayer et al., 1998) and localized to the actin cytoskeleton in Cos-7 cells. However, the F-actin colocalization index for M was lower than for and '. This may reflect additional targeting of M to other subcellular locations, possibly mediated by the putative binding sites for SH3 domains present in the 12-kDa M-specific insert (Urquidi and Ashcroft, 1995; Bayer et al., 1998).
The major CaMKII transcript found in rat pancreatic islets was ', which lacks exon v4 and was found to associate with the actin cytoskeleton. By contrast, previous studies in rat and human found predominant expression of CaMKIIe' (Rochlitz et al., 2000; Tabuchi et al., 2000), which additionally lacks exon v1 and did not associate with F-actin. This difference may be due to use of different rat strains (Sprague-Dawley versus Wistar), raising the possibility of variation also among individual humans. Notably, the two rat strains show some difference in their insulin secretion and response (Gaudreault et al., 2001; de Groot et al., 2004). CaMKII is thought to regulate insulin secretion and production (Wasmeier and Hutton, 1999; Bhatt et al., 2000; Tabuchi et al., 2000; Osterhoff et al., 2003), and it will be interesting to see whether and how these functions depend on actin association. CaMKII may be the second major isoform in islets (Rochlitz et al., 2000; Osterhoff et al., 2003); however, it was not detected in all studies (Breen and Ashcroft, 1997; Tabuchi et al., 2000). CaMKII variants do not contain sequences homologous to exon v1, but the CaMKII association domain has been reported to mediate localization of a GFP-fusion protein to the actin cytoskeleton (Caran et al., 2001). However, it should be noted that actin localization of CaMKII was rather mild, and, in contrast to the CaMKII localization observed here, became apparent only after fixation of the cells (Caran et al., 2001).
CaMKII bundled and cross-linked F-actin filaments. This suggests that CaMKII holoenzymes can bind multiple F-actin filaments simultaneously. Inactive holoenzymes form disk-like structures composed of two stacked hexameric rings (Kolodziej et al., 2000; Hoelz et al., 2003; Rosenberg et al., 2005). Thus, at least two actin filaments should be able to bind to a holoenzyme without steric hindrance, one to each ring and at several possible angles to each other. A previous electron microscopic study detected binding of CaMKII to F-actin (Ohta et al., 1986), but it did not describe cross-linking of filaments. However, the CaMKII preparation used in the study likely contained mostly the isoform (from a soluble, noncytoskeletal fraction of forebrain); small amounts of isoform present may have been sufficient to mediate some binding, but not bundling or cross-linking.
CaMKII dissociates from F-actin upon Ca2+/CaM stimulation (Fink et al., 2003; Figure 2). Thus, cross-linking of actin filaments by CaMKII may play a role in Ca2+-regulated actin dynamics. However, such a possible direct structural function is presently unclear. Moreover, kinase activity is required for the morphogenic function of CaMKII in enhancing dendritic arborization, because a kinase dead mutant (K43R) even had a dominant-negative effect (Fink et al., 2003). By contrast, a CaM binding-deficient mutant (A303R) still enhanced arborization (Fink et al., 2003), indicating a function of CaM-independent activity. Indeed, whereas both CaMKII and phosphorylated actin upon Ca2+/CaM stimulation in vitro, only the F-actin–binding CaMKII phosphorylated actin even by its nonstimulated basal activity. Binding to F-actin does not increase CaMKII activity toward a soluble peptide substrate (Fink et al., 2003), suggesting that targeting generated a high local substrate concentration that is sufficient to result in significant phosphorylation even by basal activity. Consistent with such interpretation, basal CaMKII activity is sufficient for autophosphorylation (at residues other than T286 in or T287 in ) (Colbran, 1993). A previous study indicated that CaMKII can phosphorylate SynGAP also by basal activity when both proteins are bound to the adaptor protein MUPP1 (Krapivinsky et al., 2004). Thus, a function of basal kinase activity after targeting may underlie the different effects of the two activity- or activation-impaired mutants (Fink et al., 2003). Although the morphogenic effect of CaMKII could involve direct phosphorylation of actin, it seems more likely that phosphorylation of other actin-bound regulatory proteins is required.
Previous studies showed that alternative splicing of CaMKII modulates its Ca2+-spike frequency response (Bayer et al., 2002). The results presented here show that alternative splicing also regulated the association of CaMKII with the actin cytoskeleton, which is thought to underlie the specific morphogenic role of CaMKII in neurons (Fink et al., 2003). It will be interesting to elucidate how these two biochemical properties contribute to differential function of the CaMKII splice variants, and how the alternative splice events are regulated.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
The online version of this contains supplemental material at MBC Online (http://www.molbiolcell.org). 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-03-0252) on August 23, 2006.
Address correspondence to: K. Ulrich Bayer (ulli.bayer{at}uchsc.edu)
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bayer, K. U., De Koninck, P., Schulman, H. (2002). Alternative splicing modulates the frequency-dependent response of CaMKII to Ca(2+) oscillations. EMBO J 21, 3590–3597.[CrossRef][Medline]
Bayer, K. U., Harbers, K., Schulman, H. (1998). alphaKAP is an anchoring protein for a novel CaM kinase II isoform in skeletal muscle. EMBO J 17, 5598–5605.[CrossRef][Medline]
Bayer, K. U., LeBel, E., McDonald, G., O'Leary, H., Schulman, H., De Koninck, P. (2006). Transition from reversible to persistent binding of CaMKII to postsynaptic sites and NR2B. J. Neurosci 26, 1164–1174.
Bayer, K. U., Lohler, J., Schulman, H., Harbers, K. (1999). Developmental expression of the CaM kinase II isoforms: ubiquitous gamma- and delta-CaM kinase II are the early isoforms and most abundant in the developing nervous system. Brain Res. Mol. Brain Res 70, 147–154.[Medline]
Bhatt, H. S., Conner, B. P., Prasanna, G., Yorio, T., Easom, R. A. (2000). Dependence of insulin secretion from permeabilized pancreatic beta-cells on the activation of Ca(2+)/calmodulin-dependent protein kinase II A re-evaluation of inhibitor studies. Biochem Pharmacol 60, 1655–1663.[CrossRef][Medline]
Bradshaw, J. M., Hudmon, A., Schulman, H. (2002). Chemical quenched flow kinetic studies indicate an intraholoenzyme autophosphorylation mechanism for Ca2+/calmodulin-dependent protein kinase II. J. Biol. Chem 277, 20991–20998.
Breen, M. A. and Ashcroft, S. J. (1997). Human islets of Langerhans express multiple isoforms of calcium/calmodulin-dependent protein kinase II. Biochem. Biophys. Res. Commun 236, 473–478.[CrossRef][Medline]
Brocke, L., Chiang, L. W., Wagner, P. D., Schulman, H. (1999). Functional implications of the subunit composition of neuronal CaM kinase II. J. Biol. Chem 274, 22713–22722.
Brocke, L., Srinivasan, M., Schulman, H. (1995). Developmental and regional expression of multifunctional Ca2+/calmodulin-dependent protein kinase isoforms in rat brain. J. Neurosci 15, 6797–6808.
Burgin, K. E., Waxham, M. N., Rickling, S., Westgate, S. A., Mobley, W. C., Kelly, P. T. (1990). In situ hybridization histochemistry of Ca2+/calmodulin-dependent protein kinase in developing rat brain. J. Neurosci 10, 1788–1798.[Abstract]
Caran, N., Johnson, L. D., Jenkins, K. J., Tombes, R. M. (2001). Cytosolic targeting domains of gamma and delta calmodulin-dependent protein kinase II. J. Biol. Chem 276, 42514–42519.
Chang, B. H., Mukherji, S., Soderling, T. R. (2001). Calcium/calmodulin-dependent protein kinase II inhibitor protein: localization of isoforms in rat brain. Neuroscience 102, 767–777.[CrossRef][Medline]
Colbran, R. J. (1993). Inactivation of Ca2+/calmodulin-dependent protein kinase II by basal autophosphorylation. J. Biol. Chem 268, 7163–7170.
Colbran, R. J. and Brown, A. M. (2004). Calcium/calmodulin-dependent protein kinase II and synaptic plasticity. Curr. Opin. Neurobiol 14, 318–327.[CrossRef][Medline]
de Groot, M., de Haan, B. J., Keizer, P. P., Schuurs, T. A., van Schilfgaarde, R., Leuvenink, H. G. (2004). Rat islet isolation yield and function are donor strain dependent. Lab. Anim 38, 200–206.
De Koninck, P. and Schulman, H. (1998). Sensitivity of CaM kinase II to the frequency of Ca2+ oscillations. Science 279, 227–230.
Easom, R. A. (1999). CaM kinase II: a protein kinase with extraordinary talents germane to insulin exocytosis. Diabetes 48, 675–684.[Abstract]
Erondu, N. E. and Kennedy, M. B. (1985). Regional distribution of type II Ca2+/calmodulin-dependent protein kinase in rat brain. J. Neurosci 5, 3270–3277.[Abstract]
Fink, C. C., Bayer, K. U., Myers, J. W., Ferrell, J. E. Jr, Schulman, H., Meyer, T. (2003). Selective regulation of neurite extension and synapse formation by the beta but not the alpha isoform of CaMKII. Neuron 39, 283–297.[CrossRef][Medline]
Fischer, M., Kaech, S., Wagner, U., Brinkhaus, H., Matus, A. (2000). Glutamate receptors regulate actin-based plasticity in dendritic spines. Nat. Neurosci 3, 887–894.[CrossRef][Medline]
Gaudreault, N., Santure, M., Pitre, M., Nadeau, A., Marette, A., Bachelard, H. (2001). Effects of insulin on regional blood flow and glucose uptake in Wistar and Sprague-Dawley rats. Metabolism 50, 65–73.[CrossRef][Medline]
Giese, K. P., Fedorov, N. B., Filipkowski, R. K., Silva, A. J. (1998). Autophosphorylation at Thr286 of the alpha calcium-calmodulin kinase II in LTP and learning. Science 279, 870–873.
Griffith, L. C. (2004). Calcium/calmodulin-dependent protein kinase II: an unforgettable kinase. J. Neurosci 24, 8391–8393.
Hain, J., Onoue, H., Mayrleitner, M., Fleischer, S., Schindler, H. (1995). Phosphorylation modulates the function of the calcium release channel of sarcoplasmic reticulum from cardiac muscle. J. Biol. Chem 270, 2074–2081.
Hanson, P. I., Meyer, T., Stryer, L., Schulman, H. (1994). Dual role of calmodulin in autophosphorylation of multifunctional CaM kinase may underlie decoding of calcium signals. Neuron 12, 943–956.[CrossRef][Medline]
Heist, E. K., Srinivasan, M., Schulman, H. (1998). Phosphorylation at the nuclear localization signal of Ca2+/calmodulin-dependent protein kinase II blocks its nuclear targeting. J. Biol. Chem 273, 19763–19771.
Hoelz, A., Nairn, A. C., Kuriyan, J. (2003). Crystal structure of a tetradecameric assembly of the association domain of Ca2+/calmodulin-dependent kinase II. Mol. Cell 11, 1241–1251.[CrossRef][Medline]
Hudmon, A. and Schulman, H. (2002). Neuronal CA2+/calmodulin-dependent protein kinase II: the role of structure and autoregulation in cellular function. Annu. Rev. Biochem 71, 473–510.[CrossRef][Medline]
Huntley, G. W., Benson, D. L., Colman, D. R. (2002). Structural remodeling of the synapse in response to physiological activity. Cell 108, 1–4.[CrossRef][Medline]
Ishida, A., Kameshita, I., Okuno, S., Kitani, T., Fujisawa, H. (1995). A novel highly specific and potent inhibitor of calmodulin-dependent protein kinase II. Biochem. Biophys. Res. Commun 212, 806–812.[CrossRef][Medline]
Kim, C. H. and Lisman, J. E. (1999). A role of actin filament in synaptic transmission and long-term potentiation. J. Neurosci 19, 4314–4324.
Kolodziej, S. J., Hudmon, A., Waxham, M. N., Stoops, J. K. (2000). Three-dimensional reconstructions of calcium/calmodulin-dependent (CaM) kinase II and truncated CaM kinase II reveal a unique organization for its structural core and functional domains. J. Biol. Chem 275, 14354–14359.
Krapivinsky, G., Medina, I., Krapivinsky, L., Gapon, S., Clapham, D. E. (2004). SynGAP-MUPP1-CaMKII synaptic complexes regulate p38 MAP kinase activity and NMDA receptor-dependent synaptic AMPA receptor potentiation. Neuron 43, 563–574.[CrossRef][Medline]
Krucker, T., Siggins, G. R., Halpain, S. (2000). Dynamic actin filaments are required for stable long-term potentiation (LTP) in area CA1 of the hippocampus. Proc. Natl. Acad. Sci. USA 97, 6856–6861.
Lamprecht, R. and LeDoux, J. (2004). Structural plasticity and memory. Nat. Rev. Neurosci 5, 45–54.[CrossRef][Medline]
Lantsman, K. and Tombes, R. M. (2005). CaMK-II oligomerization potential determined using CFP/YFP FRET. Biochim. Biophys. Acta 1746, 45–54.[Medline]
Lisman, J., Schulman, H., Cline, H. (2002). The molecular basis of CaMKII function in synaptic and behavioural memory. Nat. Rev. Neurosci 3, 175–190.[CrossRef][Medline]
Lisman, J. E. and McIntyre, C. C. (2001). Synaptic plasticity: a molecular memory switch. Curr. Biol 11, R788–R791.[CrossRef][Medline]
Malenka, R. C. and Nicoll, R. A. (1999). Long-term potentiation–a decade of progress? Science 285, 1870–1874.
Malinow, R., Schulman, H., Tsien, R. W. (1989). Inhibition of postsynaptic PKC or CaMKII blocks induction but not expression of LTP. Science 245, 862–866.
Mayford, M., Baranes, D., Podsypanina, K., Kandel, E. R. (1996). The 3'-untranslated region of CaMKII alpha is a cis-acting signal for the localization and translation of mRNA in dendrites. Proc. Natl. Acad. Sci. USA 93, 13250–13255.
McGee, A. W. and Bredt, D. S. (2003). Assembly and plasticity of the glutamatergic postsynaptic specialization. Curr. Opin. Neurobiol 13, 111–118.[CrossRef][Medline]
Meyer, T., Hanson, P. I., Stryer, L., Schulman, H. (1992). Calmodulin trapping by calcium-calmodulin-dependent protein kinase. Science 256, 1199–1202.
Morris, E. P. and Torok, K. (2001). Oligomeric structure of alpha-calmodulin-dependent protein kinase II. J. Mol. Biol 308, 1–8.[CrossRef][Medline]
Ohta, Y., Nishida, E., Sakai, H. (1986). Type II Ca2+/calmodulin-dependent protein kinase binds to actin filaments in a calmodulin-sensitive manner. FEBS Lett 208, 423–426.[CrossRef][Medline]
Okamoto, K., Nagai, T., Miyawaki, A., Hayashi, Y. (2004). Rapid and persistent modulation of actin dynamics regulates postsynaptic reorganization underlying bidirectional plasticity. Nat. Neurosci 7, 1104–1112.[CrossRef][Medline]
Osterhoff, M., Mohlig, M., Schwanstecher, M., Seufert, J., Ortmann, J., Schatz, H., Pfeiffer, A. F. (2003). Ca2+/calmodulin-dependent protein kinase II delta2 regulates gene expression of insulin in INS-1 rat insulinoma cells. Cell Calcium 33, 175–184.[CrossRef][Medline]
Penzes, P., Beeser, A., Chernoff, J., Schiller, M. R., Eipper, B. A., Mains, R. E., Huganir, R. L. (2003). Rapid induction of dendritic spine morphogenesis by trans-synaptic ephrinB-EphB receptor activation of the Rho-GEF kalirin. Neuron 37, 263–274.[CrossRef][Medline]
Rich, R. C. and Schulman, H. (1998). Substrate-directed function of calmodulin in autophosphorylation of Ca2+/calmodulin-dependent protein kinase II. J. Biol. Chem 273, 28424–28429.
Rochlitz, H., Voigt, A., Lankat-Buttgereit, B., Goke, B., Heimberg, H., Nauck, M. A., Schiemann, U., Schatz, H., Pfeiffer, A. F. (2000). Cloning and quantitative determination of the human Ca2+/calmodulin-dependent protein kinase II (CaMK II) isoforms in human beta cells. Diabetologia 43, 465–473.[CrossRef][Medline]
Rosenberg, O. S., Deindl, S., Sung, R. J., Nairn, A. C., Kuriyan, J. (2005). Structure of the autoinhibited kinase domain of CaMKII and SAXS analysis of the holoenzyme. Cell 123, 849–860.[CrossRef][Medline]
Rosenberg, O. S., Deindl, S., Comolli, L. R., Hoelz, A., Downing, K. H., Nairn, A. C., Kuriyan, J. (2006). Oligomerization states of the association domain and the holoenyzme of Ca/CaM kinase II. FEBS J 273, 682–694.[CrossRef][Medline]
Segal, M. (2005). Dendritic spines and long-term plasticity. Nat. Rev. Neurosci 6, 277–284.[CrossRef][Medline]
Shen, K. and Meyer, T. (1999). Dynamic control of CaMKII translocation and localization in hippocampal neurons by NMDA receptor stimulation. Science 284, 162–166.
Shen, K., Teruel, M. N., Subramanian, K., Meyer, T. (1998). CaMKIIbeta functions as an F-actin targeting module that localizes CaMKIIalpha/beta heterooligomers to dendritic spines. Neuron 21, 593–606.[CrossRef][Medline]
Silva, A. J., Stevens, C. F., Tonegawa, S., Wang, Y. (1992). Deficient hippocampal long-term potentiation in alpha-calcium-calmodulin kinase II mutant mice. Science 257, 201–206.
Singla, S. I., Hudmon, A., Goldberg, J. M., Smith, J. L., Schulman, H. (2001). Molecular characterization of calmodulin trapping by calcium/calmodulin-dependent protein kinase II. J. Biol. Chem 276, 29353–29360.
Soderling, T. R., Chang, B., Brickey, D. (2001). Cellular signaling through multifunctional Ca2+/calmodulin-dependent protein kinase II. J. Biol. Chem 276, 3719–3722.
Srinivasan, M., Edman, C. F., Schulman, H. (1994). Alternative splicing introduces a nuclear localization signal that targets multifunctional CaM kinase to the nucleus. J. Cell Biol 126, 839–852.
Star, E. N., Kwiatkowski, D. J., Murthy, V. N. (2002). Rapid turnover of actin in dendritic spines and its regulation by activity. Nat. Neurosci 5, 239–246.[CrossRef][Medline]
Sumi, M., Kiuchi, K., Ishikawa, T., Ishii, A., Hagiwara, M., Nagatsu, T., Hidaka, H. (1991). The newly synthesized selective Ca2+/calmodulin dependent protein kinase II inhibitor KN-93 reduces dopamine contents in PC12h cells. Biochem. Biophys. Res. Commun 181, 968–975.[CrossRef][Medline]
Tabuchi, H., Yamamoto, H., Matsumoto, K., Ebihara, K., Takeuchi, Y., Fukunaga, K., Hiraoka, H., Sasaki, Y., Shichiri, M., Miyamoto, E. (2000). Regulation of insulin secretion by overexpression of Ca2+/calmodulin-dependent protein kinase II in insulinoma MIN6 cells. Endocrinology 141, 2350–2360.
Tobimatsu, T. and Fujisawa, H. (1989). Tissue-specific expression of four types of rat calmodulin-dependent protein kinase II mRNAs. J. Biol. Chem 264, 17907–17912.
Tombes, R. M., Faison, M. O., Turbeville, J. M. (2003). Organization and evolution of multifunctional Ca(2+)/CaM-dependent protein kinase genes. Gene 322, 17–31.[CrossRef][Medline]
Urquidi, V. and Ashcroft, S. J. (1995). A novel pancreatic beta-cell isoform of calcium/calmodulin-dependent protein kinase II (beta 3 isoform) contains a proline-rich tandem repeat in the association domain. FEBS Lett 358, 23–26.[CrossRef][Medline]
Wang, J. and Best, P. M. (1992). Inactivation of the sarcoplasmic reticulum calcium channel by protein kinase. Nature 359, 739–741.[CrossRef][Medline]
Wasmeier, C and Hutton, J. C. (1999). Secretagogue-dependent phosphorylation of phogrin, an insulin granule membrane protein tyrosine phosphatase homologue. Biochem. J 341, 563–569.[CrossRef][Medline]
Xu, A., Hawkins, C., Narayanan, N. (1993). Phosphorylation and activation of the Ca(2+)-pumping ATPase of cardiac sarcoplasmic reticulum by Ca2+/calmodulin-dependent protein kinase. J. Biol. Chem 268, 8394–8397.
Zacharias, D. A., Violin, J. D., Newton, A. C., Tsien, R. Y. (2002). Partitioning of lipid-modified monomeric GFPs into membrane microdomains of live cells. Science 296, 913–916.
This article has been cited by other articles:
|
|
 |
|
  H. Sanabria, M. T. Swulius, S. J. Kolodziej, J. Liu, and M. N. Waxham {beta}CaMKII Regulates Actin Assembly and Structure J. Biol. Chem., April 10, 2009; 284(15): 9770 - 9780. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Diaz-Hernandez, A. del Puerto, J. I. Diaz-Hernandez, M. Diez-Zaera, J. J. Lucas, J. J. Garrido, and M. T. Miras-Portugal Inhibition of the ATP-gated P2X7 receptor promotes axonal growth and branching in cultured hippocampal neurons J. Cell Sci., November 15, 2008; 121(22): 3717 - 3728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. Lin and L. Redmond CaMKII{beta} binding to stable F-actin in vivo regulates F-actin filament stability PNAS, October 14, 2008; 105(41): 15791 - 15796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Vest, K. D. Davies, H. O'Leary, J. D. Port, and K. U. Bayer Dual Mechanism of a Natural CaMKII Inhibitor Mol. Biol. Cell, December 1, 2007; 18(12): 5024 - 5033. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-I. Okamoto, R. Narayanan, S. H. Lee, K. Murata, and Y. Hayashi The role of CaMKII as an F-actin-bundling protein crucial for maintenance of dendritic spine structure PNAS, April 10, 2007; 104(15): 6418 - 6423. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
