![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 17, Issue 11, 4896-4910, November 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Biochemical Sciences, Anatomy, Histology, and Forensic Medicine, and *Physiological Sciences, University of Florence, Interuniversity Institute of Myology, Florence I-50134, Italy
Submitted March 28, 2006;
Accepted August 28, 2006
Monitoring Editor: Asma Nusrat
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
130–136 reduced gap junction communication and totally inhibited S1P-induced expression of the myogenic markers, myogenin, myosin heavy chain, caveolin-3, and myotube formation. Notably, in S1P-stimulated myoblasts, endogenous or wild-type Cx43 protein, but not the mutated form, coimmunoprecipitated and colocalized with F-actin and cortactin in a p38 MAPK-dependent manner. These data, together with the known role of actin remodeling in cell differentiation, strongly support the important contribution of gap junctional communication, Cx43 expression and Cx43/cytoskeleton interaction in skeletal myogenesis elicited by S1P. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Adult skeletal muscle have the ability to regenerate after injury from quiescent mononucleated satellite cells which, lying between the sarcolemma and the basal lamina, use the same differentiation program as developing myoblasts (Hawke and Garry, 2001; Grounds et al., 2002). Although much remains to be learned on the inductive factors and molecular mechanisms involved in the myogenesis, it is well established that diverse intercellular signaling pathways may influence the regulation of myoblast differentiation during development and regeneration of skeletal muscle. One of them is mediated by gap junctions, specialized membrane regions composed of aggregate of intercellular channels connecting directly the adjacent cells (Simon and Goodenough, 1998). Each intercellular channel is formed by the conjunction of two hemichannels composed of six protein subunits belonging to the connexin family, whose connexin (Cx) 43 is the most widely expressed member (Sàez et al., 2003). Although absent in adult skeletal muscle fibers, Cx43 is present in the early stages of myogenesis, and Cx43-containing gap junctions are required for determining the correct cellular specification during myogenesis (Araya et al., 2003). Indeed, Cx43 is transiently expressed in myoblasts being down-regulated before their fusion into multinucleated myotubes (Gorbe et al., 2005). Moreover, the application of connexin channel blockers (Proulx et al., 1997a) as well as the inducible deletion of Cx43 protein (Araya et al., 2005) have been shown to dramatically affect myogenic differentiation, whereas the overexpression of Cx43 by rhabdomyosarcoma cells has been described as enhancing the differentiation capacity (Proulx et al., 1997b). In general, the effects of Cx43 expression have been attributed to the role of gap junctions in the establishment of organized pathways for the intercellular transfer of small metabolites and messenger molecules necessary for the coordination and guide of the interacting myoblasts to their final differentiation (Goldberg et al., 1999). However, evidence is accumulating that connexins may have additional functions independent of their gap channel–forming ability (Giepmans, 2004; Stout et al., 2004; Jiang and Gu, 2005). Indeed, several lines of evidences have shown that Cx43 regulates cell growth and migration by mechanisms that do not require intercellular communication in normal and transformed neuronal and epithelial cells (Huang et al., 1998a, 1998b; Omori and Yamasaki, 1998; Moorby and Patel, 2001; Qin et al., 2002). Moreover, the exogenous expression of mutant nonfunctional connexins has been reported to protect glial cells against injury and apoptotic cell death (Lin et al., 1998). So far, no evidence of the existence of a direct action of the Cx43 protein on the regulation of cell differentiation and skeletal muscle formation has been reported.
Sphingosine 1-phosphate (S1P) is a bioactive lipid that participates in the regulation of numerous cell processes, such as cell proliferation, differentiation, migration, and apoptosis, and acts as intracellular mediator and ligand for specific S1P receptors (Saba, 2004). We have recently shown that S1P is a potent inducer of skeletal muscle differentiation (Donati et al., 2005), and its specific Edg5/S1P2 receptor is down-regulated during myogenesis (Meacci et al., 2003). Notably, we have also demonstrated that the activity and protein content of sphingosine kinase, the enzyme catalyzing the formation of S1P, is greatly enhanced in differentiating C2C12 myoblasts, and its silencing delays myoblast maturation, thus implicating a physiological role of S1P in myogenesis (Meacci, E., Nuti, F., Donati C., Cencetti, F., Farnararo, M., and Bruni, P., unpublished results).
On the basis of the above reported observations, in the present study we investigated whether the regulation and assembly of Cx43 into gap junctions could represent a critical event in C2C12 myoblast differentiation elicited by S1P and whether Cx43 protein per se could contribute to this process.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
50% confluent. For myogenic differentiation experiments, cells were grown in 100-mm dishes or six-well plates until 95% confluent and induced to differentiate by switching to differentiation medium (DM), DMEM containing 2% horse serum (HS, Sigma) for different times (24, 48, and 72 h and 5 d) in the presence or absence of S1P (1 µM, 2 mM stock solution in dimethylsulfoxide, Calbiochem, La Jolla, CA).
Cell Treatments
C2C12 cells were challenged with 5 µM of the specific p38 MAPK inhibitor SB239063 (Tocris Cookson, Bristol, United Kingdom) and 10 µM of the ERK1/ERK2 pathway inhibitor PD98059 (Calbiochem) prepared in 0.05% DMSO, 30 min before agonist addition. The specific effect of the various inhibitors was tested by Western blot analysis evaluating the phosphorylation status of p38 MAPK and ERK1/2. To investigate calcium-dependent events, C2C12 cells were incubated in the dark for 1 h before S1P challenge with 15 µM of the Ca2+ chelator 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid/acetoxymethyl ester (BAPTA/AM, Calbiochem) prepared in 100 mM Tris/HCl, pH 7.0, and 0.1% Pluronic F-127 as previously described (Meacci et al., 2002b). The BAPTA/AM efficacy was tested by Western blot analysis examining the inhibition of S1P-induced PKC
translocation to the membrane fraction that, in C2C12 cells, occurs via a Ca2+-dependent mechanism (Meacci et al., personal communication).
Silencing of Cx43 by siRNA
To silence the expression of Cx43, short interfering RNA duplexes (siRNA) were used (Santa Cruz Biotechnology, Santa Cruz, CA) corresponding to three distinct regions of the DNA sequence of mouse Cx43 gene (NM_010288
[GenBank]
): 5'CCCAACUGAACCUUAAGAA3', 5'CCUCACCAAAUGA UUUCUA3', and 5'CCUACCAGUUUCUUCAAGU3'. The sequences were evaluated against the database using the NIH Blast program to test for specificity. A nonspecific scrambled (SCR) siRNA was used as control. C2C12 cells grown into 60-mm dishes in DMEM supplemented with 10% FCS were transfected with the mixed combination of the above reported three RNA duplexes, using Lipofectamine 2000 reagent (1 mg/ml; Invitrogen, Carlsbad, CA) according to manufacturer's instructions. Briefly, Lipofectamine 2000 was incubated with Cx43-siRNA (ratio 2:1) at room temperature for 20 min, and successively the lipid/RNA complexes were added with gentle agitation to C2C12 cells. Twenty-four hours after transfection, cells were shifted to DM in the presence or absence of S1P for a further 48 h and used for the experiments. Longer incubation times had deleterious effects on C2C12 cell viability and survival, as evaluated by visual inspection and MTS-dye reduction assay (Promega, Madison, WI). To evaluate the specific knock-down of Cx43, cell lysates from myoblasts transfected with Cx43- or SCR-siRNA were immunoblotted, and protein was detected using specific anti-Cx43 antibodies.
Construction of GFP-wtCx43 and Mutated GFP-Cx43130–136 Expression Vectors
Cx43 cDNA was obtained by reverse transcription of 1 µg of total RNA extracted from C2C12 myoblasts using TRIREAGENT (Sigma), according to the manufacturer's protocol and amplified using SuperScriptOne-Step RT-PCR System (Invitrogen) and the following mouse gene-specific primers designed in the coding region: forward primer 1: 5'ATGGGTGACTGGAGCAGCG CCTTG3' and reverse primer 1: 5'GGCAGCTTGAT GTTCAAGCCTG3'and). A cDNA fragment corresponding to mouse Cx43 with a deletion of amino acids 130–136 (Krutovskikh et al., 1998; Upham et al., 2003) was obtained by the amplification of two overlapped fragments: fragment A amplified using forward primer 1 and the reverse primer 2 (5'TTCAATCCCAAT CTGTTCAGGTGCAT3') and fragment B amplified using forward primer 2 (5'AAGCAGATTGGGATTGAAGAACACGGC3') and reverse primer 1. Cx43 (wtCx43) or Cx43130–136 (DNCx43) cDNAs were subcloned into the mammalian expression vector pcDNA3.1/NT-GFP-TOPO using the TA cloning kit and following the manufacturer's supplied protocol (Invitrogen). The nucleotide sequences of all PCR products were confirmed by automated DNA sequencing.
Stable Cell Transfections
To obtain cells stably overexpressing GFP-wtCx43 or GFP-DNCx43, myoblasts were plated onto 60-mm dishes and transfected using Lipofectamine 2000 reagent (1 mg/ml) mixed with pGFP-wtCx43, pGFP-DNCx43, or plasmid alone. After 36 h, the cells were replated in the presence of G418 (300 µg/ml; Invitrogen) and expanded under selective conditions. Selected bulk population was used to avoid potential phenotypic changes due to selection and propagation of clones from single individual cells. Ectopic Cx43 expression levels were routinely monitored by Western blot analysis using specific anti-Cx43 or anti-GFP antibodies (Santa Cruz). Empty vector-transfected cells were utilized as control. Because previous studies have shown that enforced expression of connexins can affect cell survival, MTS-dye reduction assay (Promega) in vector control and GFP-wtCx43– or GFP-DNCx43–transfected cells was performed. The capability of reducing MTS dye after 24 h of serum deprivation evaluated in GFP-wtCx43– or GFP-DNCx43–expressing myoblasts was not significantly different from that in control cells transfected with empty vector alone (0.76, 0.81, and 0.79 arbitrary units, respectively; data are media ± SEM; n = 3 for independent experiments performed in quadruplicate, with SEM always <15%).
Reverse Transcription and cDNA Amplification
Total RNA (1 µg), isolated using TRIREAGENT (Sigma) from cells incubated in the presence or the absence of S1P for 24, 48, and 72 h was added to 4 µl of 2.5 mM dNTP and 1 µl of 0.5 mg/ml random primers. Reverse transcription was performed at 42°C for 60 min using Superscript II reverse transcriptase (Invitrogen) as described in the manufacturer's protocols. Different amount of reverse transcription reaction were used for semiquantitative PCR in the presence of mouse Cx43 gene-specific primers designed in the coding region: forward primer 1 (5'ATGGGTGACTGGAGC AGCGCCTTG3') and the reverse primer 2 (5'TTCAATCCCAATC TGTTCAGGTGCAT3'). Amplified DNA was separated by electrophoresis onto 1.8% agarose gel, and exact size was evaluated by comparison with PCR 100-base pair Low Ladder (Sigma). 
-actin, was amplified using specific primers (forward: 5' TCATGTTTGAGACCTTCAACACCC3'; reverse: 5'GATGGAATTGAA TGTAGTTTC3'; Invitrogen) and used as an internal reference control to normalize relative levels of gene expression.
Lysate Preparation and Western Blot Analysis
Native, silenced, and stable overexpressing C2C12 myoblasts were incubated in the presence or the absence of S1P and/or inhibitors, washed twice in cold PBS, scraped, and lysed for 30 min at 4°C in lysis buffer containing 50 mM Tris, pH 7.5, 120 mM NaCl, 1 mM EDTA, 6 mM EGTA, 15 mM Na4P2O7, 20 mM NaF, 1% Nonidet, and protease inhibitor cocktail (1.04 mM AEBSF, 0.08 µM aprotinin, 0.02 mM leupeptin, 0.04 mM bestatin, 15 µM pepstatin A, and 14 µM E-64, Sigma) essentially as previously described (Kaliman et al., 1999). Lysates were centrifuged at 10,000 x g for 10 min at 4°C, and protein concentration was measured using the Bradford microassay (Bio-Rad, Hercules, CA). For Western blot analysis, proteins from cell lysates were subjected to SDS-PAGE. To immunodetect endogenous Cx43, specific monoclonal anti-Cx43 antibodies (1:1000, Chemicon, Temecula, CA) directed against a synthetic peptide corresponding to position 252–270 of the mouse sequence or polyclonal antibodies directed against C-terminal region of the protein (C6219, Sigma) were used. Rabbit polyclonal anti-Cx39 antibodies (kindly provided by Drs. Willecke and von Maltzahn, Institut fur Genetik, Abteilung Molekulargenetik, Universitat Bonn, Germany) direct against the C-terminal region of rat protein were also used (von Maltzahn et al., 2004). Overexpression of recombinant GFP-wtCx43 or GFP-DNCx43 protein were tested using monoclonal anti-Cx43 or anti-GFP (1:1000; Santa Cruz). For myogenic differentiation experiments, polyclonal anti-myogenin (clone F5D, Sigma), monoclonal anti-skeletal fast myosin heavy chain (MHC; clone MY-32, Sigma), monoclonal anti-caveolin-3 (cav-3; Transduction Laboratories, Lexington, KY), and monoclonal anti--actin (Cytoskeleton, Denver, CO) were used. Bound antibodies were detected by anti-rabbit and anti-goat immunoglobulin G1 conjugated to horseradish peroxidase (Santa Cruz) and ECL reagents (Amersham Pharmacia Biotech, Uppsala, Sweden).
Confocal Immunofluorescence
C2C12 cells grown on glass coverslips were incubated with S1P (1 µM) for the indicated times, fixed in 0.5% buffered paraformaldehyde for 10 min at room temperature, permeabilized with cold acetone for 3 min, blocked with PBS containing 0.5% bovine serum albumin (Sigma) and 3% glycerol, and immunostained (1 h at room temperature) with primary antibodies: monoclonal anti-Cx43 (1:250, Chemicon) and polyclonal anti-cortactin (1:50, Santa Cruz). After washing, cells were further incubated (1 h at room temperature) with Alexa 488- or Cy5-conjugated IgG (1:100, Molecular Probes, Eugene, OR), rinsed, and mounted with an antifade mounting medium (Biomeda Gel mount, Electron Microscopy Sciences, Foster City, CA). Negative controls were carried out by replacing the primary antibody with nonimmune mouse serum. Counterstaining was performed with either tetramethyl rhodamine-isothiocyanate (TRITC)-labeled phalloidin (1:100; Sigma) to reveal F-actin or with propidium iodide (PI, 1:30; Molecular Probes) to reveal nuclei. Cells were then examined with a Bio-Rad MCR 1024 ES confocal laser scanning microscope (Bio-Rad) equipped with a Krypton/Argon laser (15 mW) for fluorescence measurements and with differential interference contrast optics. Fluorescence was collected by a Nikon PlanApo 60x oil immersion objective (Melville, NY). Series of optical sections (512 x 512 pixels) at intervals of 0.4 µm were taken and superimposed as a single composite image. The laser potency, photomultiplier, and pin-hole size were kept constant. The optical density of Cx43 immunoreactivity was also measured to quantify Cx43 expression in myoblasts during differentiation. In each experimental group, at least 30 different cells were analyzed, and the mean optical density (±SEM) was calculated.
Lucifer Yellow Dye Transfer Analyses
To reveal functional gap junctions, the gap junction-permeant dye Lucifer yellow (20% in PBS; Molecular Probes) was microinjected into single cells under a phase-contrast microscope using a pressure injection system (Femtojet InjectMan NI2, Eppendorf, Hamburg, Germany) as previously described (Formigli et al., 2005a). The fluorescent coupling was viewed under a Nikon Diaphot 300 microscope equipped with fluorescence illumination and FITC filters (excitation 488 nm, emission 512 nm) and photographed using a Nikon digital camera (1 image per second). The specificity of dye transfer was tested by pretreatment with heptanol (1 mM, Sigma), a blocker of gap junction coupling. The extent of gap junction intercellular communication was quantified by counting the number of fluorescent cells surrounding each injected cell (number of dye-coupled cells/microinjection). At least 20 independent microinjections were performed for each sample (n = 3).
Electrophysiological Measurements
Electrophysiological properties of both gap junctions and hemichannels were investigated. Experiments aimed to study gap junction channels were achieved in C2C12 cell pairs by dual whole cell patch-clamp, as previously described (Formigli et al., 2005a, 2005b). C2C12 myoblasts were used after 24 h of culture in DM in the presence or absence of S1P. Initially, the membrane potentials of cell 1 (V1) and 2 (V2) were clamped to the same value, V1 = V2. V1 was then changed to establish a transjunctional voltage Vj = V2 – V1. Cell 1 was stepped using a bipolar pulse protocol. The pulses were 4.7 s long. Currents recorded from cell 1 represented the sum of two components: the transjunctional current (Ij) and the membrane current of cell 1. Currents recorded from cell 2 corresponded to –Ij. The electrophysiological properties of connexin hemichannel, IhCh current, and GhCh conductance, and the IhCh-V relationship were studied in single cells using a single pulse protocol from –70 to 70 mV in 10-mV increments. The pulses were 4.7 s long. Holding potential was –60 mV. The amplitudes of IhCh were determined at the beginning (IhCh,inst) and at the end of each pulse (IhCh,ss) to estimate the conductances GhCh,inst and GhCh,ss. The normalized GhCh,ss values were calculated from the ratios IhCh,ss/V, normalized to the maximal IhCh,ss at 70 mV, averaged, and plotted versus V. The normalized GhCh,ss-V plots were fitted by the Boltzmann equation: GhCh,ss = (GhCh,max – GhCh,min)/(1 + e(A(V – V0)) + GhCh,min, where GhCh,max and GhCh,min are the maximal and minimal conductance at large positive and negative Vm, respectively. V0 corresponds to V at which GhCh,ss is half-maximally activated. In some experiments, we used the Tyrode' solution or a bath solution as that previously reported by (Valiunas, 2002). In the presence of both solutions we observed an outward K+ current that appeared at positive potentials. This indicated that some voltage-dependent K+ channels were not activated by an holding potential of 0 mV (Kondo et al., 2000). Therefore, to block K+ channels and to improve the open state of hemichannels (Valiunas, 2002), a bath solution containing TEA and low Ca2+ concentration: 122.5 mM NaCl, 0.5 mM CaCl2, 20 TEA-OH, and 10 mM HEPES were used.
Creatine Kinase Assay
After 72 h of culture, cells were washed with PBS and homogenized in 20 mM Tris-HCl buffer, containing 1 mM EDTA, pH 7.2. The 20,000 x g supernatant was used to measure the activity of muscle creatine kinase (CK), as previously described (Naro et al., 1999). CK-specific activity was calculated and expressed as arbitrary units/mg.
Immunoprecipitation
Stable overexpressing myoblasts were grown in DMEM supplemented with 10% FCS to confluence and switched to DM. Native cells were incubated in growing medium and switched to DM in the presence or absence of 5 ìM SB239063, 30 min before S1P stimulation. After 24 h both cell preparations were washed in PBS and harvested on ice in 200 µl of precipitation assay lysis buffer (25 mM Tris-HCl, 100 mM NaCl, 10 mM EDTA, 50 mM NaF, 500 µM Na3VO4, 0.5% Triton X-100, and protease inhibitors (Sigma), and 2 mM phenylmethylsulfonyl fluoride, pH 7.2) as previously described (Singh et al., 2005). Lysates were cleared by centrifugation at 10,000 x g for 10 min, and the cell supernatant was used. For immunoprecipitations, polyclonal anti-Cx43 antibodies were incubated with cell lysates for 3 h followed by immunoprecipitation with protein A-Sepharose beads for 1 h. The beads were washed extensively in PBS, and bound proteins were eluted in Laemmli sample buffer followed by separation on SDS-PAGE and immunodetected using anti-cortactin and anti-actin antibodies (Cytoskeleton) or anti-Cx43 as described in Western Blot Analysis above.
Presentation of Data and Statistical Analysis
Results are expressed as mean ± SEM. Statistical significance was determined by Student's t test, with a value of p < 0.05 considered significant. In RT-PCR and immunoblot experiments, densitometric analysis of the band intensities was performed using Imaging and Analysis Software by Bio-Rad (Quantity-One), determined by calculating the Cx43/-actin ratios as percentage of control (set at 100), and reported as means ± SEM. Densitometric analysis of the intensity of the immunostaining for Cx43 was carried out on digitized images using NIH ImageJ software (NIH). In electrophysiological experiments, statistical analysis of differences between the experimental groups was performed by one-way ANOVA and Newman-Keuls post-test (p < 0.05 was considered significant). Calculations were made with Graph Pad Prism statistical program (GraphPad Software, San Diego, CA). pClamp9 (Axon Instruments, Foster City, CA), SigmaPlot and SigmaStat (Jandel Scientific, San Rafael, CA) were used for mathematical and statistical analysis of electrophysiological data.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
43 kDa in control cells and as multiple bands of 40–46 kDa in S1P-treated myoblasts, suggesting that the bioactive lipid could also affect Cx43 posttranslation modifications. Parallel experiments were performed to verify whether S1P treatment affected the expression of other connexin such as Cx39, an isoform recently identified in differentiating myoblasts (von Maltzahn et al., 2004, 2006; Belluardo et al., 2005). As shown in Figure 1B, Cx39 was weakly detectable in C2C12 myoblasts, and its expression was not affected by S1P, at least in the early hours of differentiation (24–48 h). However, the expression level of Cx39 increased significantly in differentiating cells starting from 72 up to 120 h of incubation in DM, especially in the presence of S1P (Figure 1).
|
The increase of immunoreactive Cx43 at the appositional plasma membranes between adjacent myoblasts after S1P stimulation was consistent with the functional differences in the gap junction permeability, as detected by Lucifer yellow dye-transfer assay (Figure 2A). The efficacy of dye spreading in control was very low, with 20% of the cells showing dye coupling with only one neighboring cell. After 24 and 48 h of incubation in DM the extent of dye transfer slightly increased, with 30% of the cells showing 1–2 or 2–3 coupled cells, respectively. The long-term treatment with S1P significantly increased the extent of gap junction communication over that evaluated in controls, with 50 and 70% of the cells showing 1–2 and 3–4 coupled cells per injection, after 24 and 48 h of stimulation, respectively.
|
; von Maltzahn et al., 2006), we suggested that the asymmetric Bolzmann parameters were predominantly due to the inside-outside voltage dependence of Cx43 Gj previously described (White et al., 1994). However, the plot became symmetric after treatment with S1P and showed a slower inactivation compared with control, suggesting that S1P could affect the inside-outside voltage-dependence of Cx43-containing gap junctions, by reducing the fast gating, acting in the same manner as other chemicals (Bukauskas et al., 2001). Finally, we demonstrated that S1P affected the hemichannel conductance in myoblastic cells, because IhCh as well as its voltage sensitivity were significantly increased in S1P-treated cells compared with control, as indicated by the A parameter (Figure 2C, Table 1).
|
Calcium Increase and p38 MAPK Activity Are Involved in S1P-induced Cx43 Expression
Because gap junctions are required for normal myogenesis (Araya et al., 2005), we next investigated whether known mediators of the myogenic program and known targets of S1P, such as Ca2+ and p38 MAPK (Meacci et al., 2002a; Porter et al., 2002; Cabane et al., 2003; Donati et al., 2005), could also play a role in the regulation of Cx43 expression induced by the bioactive lipid. To this end, we used BAPTA/AM (15 µM), a calcium chelator capable of preventing intracellular calcium increase, or SB239063 (5 µM), a specific inhibitor of p38 MAPK, and focused our observations on the time period where the effect of S1P on protein expression was predominant (48 h). As shown in Figure 3, depletion of Ca2+ by BAPTA/AM as well as inhibition of p38 MAPK activity by SB239063 prevented S1P-induced Cx43 up-regulation and strongly reduced expression of myogenin (Figure 3) and myosin heavy chain (MHC) and caveolin-3 (cav-3; unpublished data). Notably, no significant change was observed in the expression of Cx43 as well as of the other myogenic markers in myoblasts treated with PD98057 before S1P addition, suggesting that ERK1/2 activity was not required for Cx43 expression and myogenesis. Moreover, BAPTA/AM or PD98057 was unable to affect basal Cx43 and myogenin expression, whereas SB239063 strongly reduced Cx43 expression below the control. Taken together, these results indicated that S1P regulated the expression of Cx43 through the activation of both Ca2+- and p38 MAPK-dependent pathways.
|
130–136 or wild-type Cx43 fused to GFP (GFP-DNCx43, GFP-wtCx43) and examined for myogenic marker expression after 48 h of incubation in DM. Preliminary experiments were performed to verify the expression level of Cx43 in silenced and stable overexpressing myoblasts. As shown in Figure 4, A and B, Cx43 was significantly down-regulated in Cx43-siRNA-treated myoblasts both in unstimulated and stimulated cells. A band of 75 kDa, consistent with the predicted molecular weight of Cx43 protein fused to GFP, was immunodetected in GFP-DNCx43–, as well as in GFP-wtCx43–overexpressing myoblasts, and its expression appeared not to be affected by S1P treatment (Figure 4C). Confocal microscopy, performed to reveal the in situ localization of recombinant Cx43, showed that both GFP-wtCx43 and GFP-DNCx43 were present in the cytoplasm as well as at the plasma membrane. However, the localization of the mutated protein at cell–cell contacts, was less clear than that of wild-type Cx43, indicating some alterations in the organization of gap junctional plaques in GFP-DNCx43 myoblasts (Figure 4D).
|
|
60% in GFP-DNCx43 myoblasts as compared with those of vector and C2C12 cells (Figure 6). In particular, C2C12 myoblasts overexpressing GFP-wtCx43 showed a symmetrical current-voltage plot, whereas those overexpressing GFP-DNCx43 exhibited an asymmetrical relationship as in control cells (Figure 6, Table 2). Similarly, the hemichannel voltage sensitivity increased in GFP-wtCx43- and decreased in GFP-DNCx43-expressing myoblasts (Figure 6, Table 2). Collectively, these data indicated a channel-dependent role for Cx43 in the regulation of skeletal myogenesis.
|
|
|
|
; Formigli et al., 2007).
Colocalization of Cx43 with F-actin and cortactin, an F-actin–binding protein present in the cortical structures (Wu and Parsons, 1993; Wu and Montone, 1998), was investigated by confocal immunofluorescence followed by high-resolution deconvolution of the fluorescence images. Colabeling with Cx43 and anti-cortactin antibodies and/or TRITC-phalloidin revealed that the gap junctional protein colocalized with cortactin and, to a lesser extent, with F-actin in GFP-wtCx43–overexpressing cells (Figure 8A). By contrast, mutated Cx43 did not colocalized with F-actin and cortactin in basal conditions (unpublished data) as well as after S1P stimulation (Figure 8A). Similarly, the treatment with SB was able to prevent the interactions between F-actin and Cx43 in native C2C12 myoblasts (Figure 8B). The physical association of Cx43 with cytoskeletal proteins was verified by coimmunoprecipitation experiments. As shown in Figure 8C, endogenous Cx43 and GFP-wtCx43, but not GFP-DNCx43, coimmunoprecipitated with cortactin and skeletal actin. Of note, we found that S1P positively affected Cx43 interaction with cortactin in native C2C12 cells and such association was dependent on the activation of p38 MAPK pathways.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In line with previous reports (Proulx et al., 1997a; Constantin and Cronier, 2000; Gorbe et al., 2005), Cx43 protein was transiently up-regulated in differentiating C2C12 myoblasts: Cx43 appeared early in proliferating cells, followed by a progressive increase in the cytoplasm and cell-membrane domains of adjacent myoblasts until fusion into myotubes, where the expression decreased rapidly. Moreover, we demonstrated that S1P was a potent inducer of Cx43 expression in these cells. This finding, together with our previous data showing that S1P is a stimulator of myogenesis in C2C12 cells (Donati et al., 2005), provides the basis for considering Cx43 protein as an new intracellular target of S1P action during myogenesis. Enhanced expression synthesis of Cx43 by S1P was accompanied by increased gap junctional communication, as demonstrated by Lucifer yellow dye transfer after microinjection and the evaluation of gap junctional conductance using dual patch-clamp method. In particular, the transjunctional currents between undifferentiated myoblastic pairs exhibited an asymmetrical voltage dependence, indicating the involvement of heterotypic gap junctional channels in C2C12 intercellular coupling as previously reported (Beyer, 1990; Brink et al., 1997; Sakai et al., 2003; Yao et al., 2003). Interestingly, the transjunctional current showed a symmetrical behavior in S1P-stimulated cells, consistent with the prevalence of Cx43-homotypic channels and the ability of the bioactive lipid to affect preferentially the expression of only one connexin isoform (i.e., Cx43). In agreement, the expression of Cx39, weakly detectable at basal level, was not affected by S1P in the early stages of myoblast differentiation. However, consistent with previous reports (von Maltzahn et al., 2004, 2006; Belluardo et al., 2005) the level of this protein increased in differentiated C2C12 cells, especially upon S1P treatment. We also demonstrated that S1P-dependent up-regulation of Cx43 was dependent on the intracellular p38 MAP kinase signaling and Ca2+ mobilization, in agreement with our previous data showing a clear correlation between Ca2+ concentration and Cx43 protein expression (Formigli et al., 2005a). On the other hand, we showed that S1P likely affected the degradative process of Cx43 in conditions where Ca2+ had been depleted and p38 MAP kinase was inhibited. Despite the evidence suggesting a role for ERK1/2 signaling pathway in the regulation of Cx43 expression (Warn-Cramer et al., 1998; Hossain et al., 1999), we showed here that ERK1/2 inactivation by PD98057 treatment did not modify the synthesis of the protein in C2C12 cells stimulated with S1P consistently with the reported inability of ERK1/2 inhibition to affect S1P-induced myogenesis in C2C12 cells (Donati et al., 2005).
Gap junctional communications have been long thought to play an important role in the coordination of numerous cell functions, including maintenance of the cellular homeostasis and the regulation of cell growth, differentiation, and development. In particular, several studies have proposed that gap junctions are required for skeletal muscle development and regeneration, because the blockade of the intercellular coupling with channel blockers, octanol and 18beta-glycyrrhetinic acid, or the inducible deletion of Cx43 in transgenic mice, inhibit the expression of myogenic markers in differentiating myoblasts (Kalderon et al., 1977; Araya et al., 2003). Based on these findings, it has been proposed a possible role for gap junctions in allowing the intercellular spread of second messengers and coordination of the cell functions in a network of cells (Simon and Goodenough, 1998). To verify whether the intercellular communication was critical during myogenesis in C2C12 cells, we silenced Cx43 expression, and prepared myoblasts expressing a dominant negative form of Cx43, which formed gap junction channels with reduced permeability. In both conditions we found that cells expressing mutated Cx43 failed to enter the myogenic program elicited by the bioactive lipid, supporting the idea that gap junction functionality was essential for the promotion of myogenesis by S1P. However, myogenesis appeared not to be fully dependent on the extent of gap junctional communication. In fact, it was found an almost complete inhibition of the expression of myogenic markers in GFP-DNCx43–expressing cells despite a 50% decrease in the transjunctional conductance compared with that of controls. Such discrepancy was even greater in GFP-DNCx43 myoblasts incubated with S1P for,one d, in which the gap junctional conductance was increased upon the basal levels and similar in amplitude to that of native unstimulated cells, which, instead, underwent normal differentiation. We explained the persistence of the cell-to-cell coupling in S1P-stimulated GFP-DNCx43 myoblasts by the ability of mutated connexin to form with the endogenous protein, up-regulated by the bioactive lipid, an ample range of connexons, whose function was dependent on the proportion of the endogenous and mutant form. It was likely that the different structure of connexons in S1P-treated GFP-DNCx43 cells compared with that of control cells (heteromeric vs. homomeric), despite the similar residual conductance, could explain the different capability to differentiate observed in the two cell populations. We suggested the possibility that Cx43 expression per se, in addition to its channel forming ability, could influence skeletal myogenesis of C2C12 cells elicited by S1P. Consistent with this assumption, several lines of evidences have recently shown that the expression of mutated Cx43 with no intrinsic channel activity are as effective as the wild-type protein in the regulation of several biological processes, including cell growth and survival (Lin et al., 1998; Dang et al., 2003). In such a view, it is very likely that Cx43, similarly to other proteins localized at the intercellular junctions, such as E-cadherin and -catenin (Giepmans, 2004), may exert multiple functions with different domains and play an important role as intermediate protein in the transduction of signals from the membrane to nucleus.
Recent investigations have suggested an involvement for actin and actin-binding proteins in the regulation of myogenesis, and several mechanisms have been proposed to explain the effect of cytoskeleton on skeletal differentiation (Qu et al., 1997). Accumulating data have demonstrated a direct interaction of the Cx43 C-terminus, with cytoskeletal proteins displaying signal transduction activity, including drebrin (Butkevich et al., 2004), ZO-1 (zonula occludens 1 (Toyofuku et al., 2001), and c-Src (Giepmans et al., 2003). Therefore, we analyzed the ability of the mutated and wild-type protein to interact with the cytoskeleton. Of note, endogenous connexin and recombinant wild-type Cx43, but not DNCx43, were physically associated with skeletal actin as well as cortactin, strongly supporting the idea that the interaction between Cx43 protein and cytoskeleton may be involved in the accomplishment of myogenesis in C2C12 cells. We also showed that the interaction between the gap junction protein and cortactin is regulated by S1P and is dependent on p38 MAPK activation, pointing to the phosphorylation of Cx43 as an additional step in S1P regulation of gap junction protein function. The physical association of Cx43 with F-actin modulated by S1P is of particular interest in view of our recent observations, showing that actin remodeling is crucial for myogenic process elicited by S1P in the same cells (Formigli et al., 2005a; Formigli et al., 2007). Collectively, these data in combination with those reported in the literature showing that the lack of a correct gap-junctional assembly of Cx43 on the cell surface hampers several cellular processes, including growth, proliferation, and differentiation (Moorby and Patel, 2001; Dang et al., 2003; Li et al., 2006), are consistent with the emerging idea that Cx43 may also act as an adaptor protein and function through gap-independent mechanisms.
In conclusion, the results of the present study provide the first experimental evidence that up-regulation of Cx43 protein and the subsequent increase in gap junction functionality are important mechanism by which S1P promotes myogenesis in C2C12 myoblasts. Notably, our data, although not excluding that the exchange of molecules through functional gap junctions plays a dominant role in skeletal muscle differentiation, suggest that the interaction between Cx43 and cytoskeletal proteins may represent a possible molecular mechanism by which Cx43 per se affects cellular differentiation.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
The online version of this contains supplemental material at MBC Online (http://www.molbiolcell.org). 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-03-0243) on September 6, 2006.
Address correspondence to: Elisabetta Meacci (elisabetta.meacci{at}unifi.it)
Abbreviations used: S1P, sphingosine 1-phosphate; wtCx43, wild-type connexin 43; DNCx43, dominant negative connexin 43; PBS, phosphate buffer solution; FCS, fetal calf serum; DM, differentiation medium; HS, horse serum; MAPK, mitogen-activated protein kinase; ERK1/2, p44/42 MAPK; siRNA, short interfering RNA; GFP, green fluorescent protein; MHC, myosin heavy chain.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Araya, R., Eckardt, D., Riquelme, M. A., Willecke, K., Saez, J. C. (2003). Presence and importance of connexin43 during myogenesis. Cell Commun. Adhes 10, 451–456.[Medline]
Belluardo, N., Trovato-Salinaro, A., Mudo, G., Condorelli, D. F. (2005). Expression of the rat connexin 39 (rCx39) gene in myoblasts and myotubes in developing and regenerating skeletal muscles: an in situ hybridization study. Cell Tissue Res 320, 299–310.[CrossRef][Medline]
Beyer, E. C. (1990). Molecular cloning and developmental expression of two chick embryo gap junction proteins. J. Biol. Chem 265, 14439–14443.
Brink, P. R., Cronin, K., Banach, K., Peterson, E., Westphale, E. M., Seul, K. H., Ramanan, S. V., Beyer, E. C. (1997). Evidence for heteromeric gap junction channels formed from rat connexin43 and human connexin37. Am. J. Physiol 273, C1386–C1396.
Butkevich, E., Hulsmann, S., Wenzel, D., Shiraro, T., Duden, R., Majoul, I. (2004). Drebrin is a novel connexin-43 binding partner that links gap junctions to the submembrane cytoskeleton. Curr. Biol 14, 650–658.[CrossRef][Medline]
Bukauskas, F. F., Bukauskiene, A., Bennett, M. V., Verselis, V. K. (2001). Gating properties of gap junction channels assembled from connexin43 and connexin43 fused with green fluorescent protein. Biophys. J 81, 137–152.[Medline]
Cabane, C., Englaro, W., Yeow, K., Ragno, M., Derijard, B. (2003). Regulation of C2C12 myogenic terminal differentiation by MKK3/p38alpha pathway. Am. J. Physiol. Cell Physiol 284, C658–C666.
Constantin, B. and Cronier, L. (2000). Involvement of gap junctional communication in myogenesis. Int. Rev. Cytol 196, 1–65.[Medline]
Dang, X., Doble, B. W., Kardami, E. (2003). The carboxy-tail of connexin-43 localizes to the nucleus and inhibits cell growth. Mol. Cell Biochem 242, 35–38.[CrossRef][Medline]
Donati, C., Meacci, E., Nuti, F., Becciolini, L., Farnararo, M., Bruni, P. (2005). Sphingosine 1-phosphate regulates myogenic differentiation: a major role for S1P2 receptor. FASEB J 19, 449–451.
Formigli, L. (2005a). Morphofunctional integration between skeletal myoblasts and adult cardiomyocytes in coculture is favored by direct cell-cell contacts and relaxin treatment. Am. J. Physiol. Cell Physiol 288, C795–C804.
Formigli, L. (2005b). Sphingosine 1-phosphate induces cytoskeletal reorganization in C2C12 myoblasts: physiological relevance for stress fibres in the modulation of ion current through stretch-activated channels. J. Cell Sci 118, 1161–1171.
Formigli, L., Meacci, E., Sassoli, C., Squecco, R., Nosi, D., Chellini, F., Naro, F., Francini, F., Zecchi Orlandini, S. (2007). Actin cytoskeleton/stretch-activated ion channels interaction regulates myogenic differentiation of skeletal myoblasts. J. Cell Physiol (in press).
Giepmans, B. N. (2004). Gap junctions and connexin-interacting proteins. Cardiovasc. Res 62, 233–245.
Giepmans, B. N., Feiken, E., Gebbink, M. F., Moolenaar, W. H. (2003). Association of connexin43 with a receptor protein tyrosine phosphatase. Cell Commun. Adhes 10, 201–205.[Medline]
Goldberg, G. S., Lampe, P. D., Nicholson, B. J. (1999). Selective transfer of endogenous metabolites through gap junctions composed of different connexins. Nat. Cell Biol 1, 457–459.[CrossRef][Medline]
Gorbe, A., Becker, D. L., Dux, L., Stelkovics, E., Krenacs, L., Bagdi, E., Krenacs, T. (2005). Transient upregulation of connexin43 gap junctions and synchronized cell cycle control precede myoblast fusion in regenerating skeletal muscle in vivo. Histochem. Cell Biol 123, 573–583.[CrossRef][Medline]
Grounds, M. D., White, J. D., Rosenthal, N., Bogoyevitch, M. A. (2002). The role of stem cells in skeletal and cardiac muscle repair. J. Histochem. Cytochem 50, 589–610.
Hawke, T. J. and Garry, D. J. (2001). Myogenic satellite cells: physiology to molecular biology. J. Appl. Physiol 91, 534–551.
Hossain, M. Z., Jagdale, A. B., Boynton, A. L. (1999). Mitogen-activated protein kinase and phosphorylation of connexin43 are not sufficient for the disruption of gap junctional communication by platelet-derived growth factor and tetradecanoylphorbol acetate. J. Cell Physiol 179, 87–96.[CrossRef][Medline]
Huang, G. Y., Cooper, E. S., Waldo, K., Kirby, M. L., Gilula, N. B., Lo, C. W. (1998a). Gap junction-mediated cell-cell communication modulates mouse neural crest migration. J. Cell Biol 143, 1725–1734.
Huang, R. P., Fan, Y., Hossain, M. Z., Peng, A., Zeng, Z. L., Boynton, A. L. (1998b). Reversion of the neoplastic phenotype of human glioblastoma cells by connexin 43 (cx43). Cancer Res 58, 5089–5096.
Kalderon, N., Epstein, M. L., Gilula, N. B. (1977). Cell-to-cell communication and myogenesis. J. Cell Biol 75, 788–806.
Kaliman, P., Canicio, J., Testar, X., Palacin, M., Zorzano, A. (1999). Insulin-like growth factor-II, phosphatidylinositol 3-kinase, nuclear factor-kappaB and inducible nitric-oxide synthase define a common myogenic signaling pathway. J. Biol. Chem 274, 17437–17444.
Komati, H., Naro, F., Mebarek, S., De Arcangelis, V., Adamo, S., Lagarde, M., Prigent, A. F., Nemoz, G. (2005). Phospholipase D is involved in myogenic differentiation through remodeling of actin cytoskeleton. Mol. Biol. Cell 16, 1232–1244.
Kondo, R. P., Wang, S. Y., John, S. A., Weiss, J. N., Goldhaber, J. I. (2000). Metabolic inhibition activates a non-selective current through connexin hemichannels in isolated ventricular myocytes. J. Mol. Cell. Cardiol 32, 1859–1872.[CrossRef][Medline]
Krutovskikh, V. A., Yamasaki, H., Tsuda, H., Asamoto, M. (1998). Inhibition of intrinsic gap junction intercellular communication and enhancement of tumorigenicity of the rat bladder carcinoma cell line BC31 by a dominant-negative connexin 43 mutant. Mol. Carcinog 23, 254–261.[CrossRef][Medline]
Jiang, J. X. and Gu, S. (2005). Gap junction- and hemichannel-independent actions of connexins. Biochim. Biophys. Acta 1711, 208–214.[Medline]
Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., Weintraub, H. (1989). MyoD is a sequence-specific DNA binding protein requiring a region of myc homology to bind to the muscle creatine kinase enhancer. Cell 58, 823–831.[CrossRef][Medline]
Li, Z., Zhou, Z., Saunders, M. M., Donahue, H. J. (2006). Modulation of connexin43 alters expression of osteoblastic differentiation markers. Am. J. Physiol. Cell Physiol 290, C1248–C1255.
Lin, J. H., Weigel, H., Cotrina, M. L., Liu, S., Bueno, E., Hansen, A. J., Hansen, T. W., Goldman, S., Nedergaard, M. (1998). Gap junction-mediated propagation and amplification of cell injury. Nat. Neurosci 1, 743–749.
Meacci, E., Becciolini, L., Nuti, F., Donati, C., Cencetti, F., Farnararo, M., Bruni, P. (2002a). A role for calcium in sphingosine 1-phosphate-induced phospholipase D activity in C2C12 myoblasts. FEBS Lett 521, 200–204.[CrossRef][Medline]
Meacci, E., Cencetti, F., Formigli, L., Squecco, R., Donati, C., Tiribilli, B., Quercioli, F., Zecchi Orlandini, S., Francini, F., Bruni, P. (2002b). Sphingosine 1-phosphate evokes calcium signals in C2C12 myoblasts via Edg3 and Edg5 receptors. Biochem. J 362, 349–357.[CrossRef][Medline]
Meacci, E., Cencetti, F., Donati, C., Nuti, F., Farnararo, M., Kohno, T., Igarashi, Y., Bruni, P. (2003). Down-regulation of EDG5/S1P2 during myogenic differentiation results in the specific uncoupling of sphingosine 1-phosphate signalling to phospholipase D. Biochim. Biophys. Acta 1633, 133–142.[Medline]
Moorby, C. and Patel, M. (2001). Dual functions for connexins: Cx43 regulates growth independently of gap junction formation. Exp. Cell Res 271, 238–248.[CrossRef][Medline]
Naro, F., Sette, C., Vicini, E., De Arcangelis, V., Grange, M., Conti, M., Lagarde, M., Molinaro, M., Adamo, S., Nemoz, G. (1999). Involvement of type 4 cAMP-phosphodiesterase in the myogenic differentiation of L6 cells. Mol. Biol. Cell 10, 4355–4367.
Omori, Y. and Yamasaki, H. (1998). Mutated connexin43 proteins inhibit rat glioma cell growth suppression mediated by wild-type connexin43 in a dominant-negative manner. Int. J. Cancer 78, 446–453.[CrossRef][Medline]
Porter, G. A. Jr, Makuck, R. F., Rivkees, S. A. (2002). Reduction in intracellular calcium levels inhibits myoblast differentiation. J. Biol. Chem 277, 28942–28947.
Proulx, A. M., Merrifield, P. A., Naus, C. C. (1997a). Blocking gap junctional intercellular communication in myoblasts inhibits myogenin and MRF4 expression. Dev. Genet 20, 133–144.[CrossRef][Medline]
Proulx, A. A., Lin, Z. X., Naus, C. C. (1997b). Transfection of rhabdomyosarcoma cells with connexin43 induces myogenic differentiation. Cell Growth Differ 8, 533–540.[Abstract]
Qin, H., Shao, Q., Curtis, H., Galipeau, J., Belliveau, D. J., Wang, T., Alaoui-Jamali, M. A., Laird, D. W. (2002). Retroviral delivery of connexin genes to human breast tumor cells inhibits in vivo tumor growth by a mechanism that is independent of significant gap junctional intercellular communication. J. Biol. Chem 277, 29132–29138.
Qu, G., Yan, H., Strauch, A. R. (1997). Actin isoform utilization during differentiation and remodeling of BC3H1 myogenic cells. J. Cell Biochem 67, 514–527.[CrossRef][Medline]
Saba, J. D. (2004). Lysophospholipids in development: miles apart and edging in. J. Cell Biochem 92, 967–992.[CrossRef][Medline]
Sàez, J. C., Berthoud, V. M., Branes, M. C., Martinez, A. D., Beyer, E. (2003). Plasma membrane channels form by connexin: their regulation and function. Physiol. Rev 83, 1359–1400.
Sakai, R., Elfgang, C., Vogel, R., Willecke, K., Weingart, R. (2003). The electrical behaviour of rat connexin46 gap junction channels expressed in transfected HeLa cells. Pfluegers Arch 446, 714–727.[CrossRef][Medline]
Simon, A. M. and Goodenough, D. A. (1998). Diverse functions of vertebrate gap junctions. Trends Cell Biol 8, 477–483.[CrossRef][Medline]
Singh, D., Solan, J. L., Taffet, S. M., Javier, R., Lampe, P. D. (2005). Connexin 43 interacts with zona occludens-1 and -2 proteins in a cell cycle stage-specific manner. J. Biol. Chem 280, 30416–30421.
Stout, C., Goodenough, D. A., Paul, D. L. (2004). Connexins: functions without junctions. Curr. Opin. Cell Biol 16, 507–512.[CrossRef][Medline]
Toyofuku, T., Akamatsu, Y., Zhang, H., Kuzuya, T., Tada, M., Hori, M. (2001). c-Src regulates the interaction between connexin-43 and ZO-1 in cardiac myocytes. J. Biol. Chem 276, 1780–1788.
Upham, B. L., Suzuki, J., Chen, G., Trosko, J. E., Wang, Y., McCabe, L. R., Chang, C. C., Krutovskikh, V. A., Yamasaki, H. (2003). Reduced gap junctional intercellular communication and altered biological effects in mouse osteoblast and rat liver oval cell lines transfected with dominant-negative connexin 43. Mol. Carcinog 37, 192–201.[CrossRef][Medline]
Valiunas, V. (2002). Biophysical properties of connexin-45 gap junction hemichannels studied in vertebrate cells. J. Gen. Physiol 119, 147–164.
von Maltzahn, J., Euwens, C., Willecke, K., Sohl, G. (2004). The novel mouse connexin39 gene is expressed in developing striated muscle fibers. J. Cell Sci 117, 5381–5392.
von Maltzahn, J., Wulf, V., Willecke, K. (2006). Spatiotemporal expression of connexin 39 and -43 during myoblast differentiation in cultured cells and in the mouse embryo. Cell Commun. Adhes 13, 55–60.[CrossRef][Medline]
Warn-Cramer, B. J., Trevor Cottrell, G., Burt, J. M., Lau, A. F. (1998). Regulation of connexin-43 gap junctional intercellular communication by mitogen-activated protein kinase. J. Biol. Chem 273, 9188–9196.
White, T. W., Bruzzone, R., Wolfram, S., Paul, D. L., Goodenough, D. A. (1994). Selective interactions among the multiple connexin proteins expressed in the vertebrate lens: the second extracellular domain is a determinant of compatibility between connexins. J. Cell Biol 125, 879–892.
Wu, H. and Montone, K. T. (1998). Cortactin localization in actin-containing adult and fetal tissues. J. Histochem. Cytochem 46, 1189–1191.
Wu, H. and Parsons, J. T. (1993). Cortactin, an 80/85-kilodalton pp60src substrate, is a filamentous actin-binding protein enriched in the cell cortex. J. Cell Biol 120, 1417–1426.
Yao, J. A., Gutstein, D. E., Liu, F., Fishman, G. I., Wit, A. L. (2003). Cell coupling between ventricular myocyte pairs from connexin43-deficient murine hearts. Circ. Res 93, 736–743.
This article has been cited by other articles:
|
|
 |
|
  D. Danieli-Betto, S. Peron, E. Germinario, M. Zanin, G. Sorci, S. Franzoso, D. Sandona, and R. Betto Sphingosine 1-phosphate signaling is involved in skeletal muscle regeneration Am J Physiol Cell Physiol, March 1, 2010; 298(3): C550 - C558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Gundry, K. Raginski, Y. Tarasova, I. Tchernyshyov, D. Bausch-Fluck, S. T. Elliott, K. R. Boheler, J. E. Van Eyk, and B. Wollscheid The Mouse C2C12 Myoblast Cell Surface N-Linked Glycoproteome: IDENTIFICATION, GLYCOSITE OCCUPANCY, AND MEMBRANE ORIENTATION Mol. Cell. Proteomics, November 1, 2009; 8(11): 2555 - 2569. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Formigli, C. Sassoli, R. Squecco, F. Bini, M. Martinesi, F. Chellini, G. Luciani, F. Sbrana, S. Zecchi-Orlandini, F. Francini, et al. Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation J. Cell Sci., May 1, 2009; 122(9): 1322 - 1333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Schalper, N. Palacios-Prado, M. A. Retamal, K. F. Shoji, A. D. Martinez, and J. C. Saez Connexin Hemichannel Composition Determines the FGF-1-induced Membrane Permeability and Free [Ca2+]i Responses Mol. Biol. Cell, August 1, 2008; 19(8): 3501 - 3513. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Safdar, N. J. Yardley, R. Snow, S. Melov, and M. A. Tarnopolsky Global and targeted gene expression and protein content in skeletal muscle of young men following short-term creatine monohydrate supplementation Physiol Genomics, January 17, 2008; 32(2): 219 - 228. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and – – –) and S1P-stimulated cells (
and —). The related Boltzmann parameters are reported in 
) or absence of S1P (
) for 24 h were analyzed by dual (A) or single (B) patch clamp. Transfection with vector alone does not modify Gj,ss and GhCh,ss, whereas transfection with GFP-DNCx43 or with GFP-wtCx43 constructs decrease and increase both Gj,ss and GhCh,ss (*p < 0.05), respectively. S1P stimulation enhances the electrical coupling and hemichannel conductance in all the cell preparations (
p < 0.05 and 
; GFP-wtCx43, 
