QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 17, Issue 11, 4925-4935, November 2006

This Article Abstract Full Text (PDF) All Versions of this Article: E06-05-0433v1 17/11/4925    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pullar, C. E. Articles by Isseroff, R. R. Search for Related Content PubMed PubMed Citation Articles by Pullar, C. E. Articles by Isseroff, R. R.

4 Integrin and Epidermal Growth Factor Coordinately Regulate Electric Field-mediated Directional Migration via Rac1

Christine E. Pullar^*,, Brian S. Baier^*, Yoshinobu Kariya, Alan J. Russell^,, Basil A.J. Horst^,||, M. Peter Marinkovich^,¶, and R. Rivkah Isseroff^*,#

*Department of Dermatology, University of California, Davis, Davis, CA 95616; Program in Epithelial Biology, Stanford University School of Medicine, Stanford, CA 94305; ^#Dermatology Service, Northern California Health Care System, Department of Veterans Affairs, Mather, CA 95655; and ^¶VA Palo Alto Health Care System, Department of Veterans Affairs, Stanford, CA 94304

Submitted May 24, 2006; Revised July 21, 2006; Accepted August 9, 2006
Monitoring Editor: Mark Ginsberg

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Endogenous DC electric fields (EF) are present during embryogenesis and are generated in vivo upon wounding, providing guidance cues for directional cell migration (galvanotaxis) required in these processes. To understand the role of beta ()4 integrin in directional migration, the migratory paths of either primary human keratinocytes (NHK), 4 integrin-null human keratinocytes (4–), or those in which 4 integrin was reexpressed (4+), were tracked during exposure to EFs of physiological magnitude (100 mV/mm). Although the expression of 4 integrin had no effect on the rate of cell movement, it was essential for directional (cathodal) migration in the absence of epidermal growth factor (EGF). The addition of EGF potentiated the directional response, suggesting that at least two distinct but synergistic signaling pathways coordinate galvanotaxis. Expression of either a ligand binding–defective 4 (4+AD) or 4 with a truncated cytoplasmic tail (4+CT) resulted in loss of directionality in the absence of EGF, whereas inhibition of Rac1 blinded the cells to the EF even in the presence of EGF. In summary, both the 4 integrin ligand–binding and cytoplasmic domains together with EGF were required for the synergistic activation of a Rac-dependent signaling pathway that was essential for keratinocyte directional migration in response to a galvanotactic stimulus.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Directional migration is a fundamental process essential for numerous cellular responses including embryonic development, inflammation, and tumor metastasis as well as skin wound repair. When skin is wounded, keratinocytes migrate directionally into the wound bed to initiate reepithelialization, necessary for wound closure and restoration of barrier function. Many factors are involved in orchestrating the complex process of wound healing (Martin, 1997), and recent studies have led to the belief that a lateral electric field (EF) generated immediately upon wounding is one of the earliest signals to initiate directed cell migration (Ojingwa and Isseroff, 2003; McCaig et al., 2005). The lateral EF is driven by the transepithelial potential through the low-resistance wound pathway, creating a negative pole (cathode) at the center of the wound (Borgens et al., 1977). Endogenous DC EFs of 40–200 mV/mm have been measured near wounds in mammalian epithelia (Barker et al., 1982; McGinnis and Vanable, 1986; Chiang et al., 1992; Sta Iglesia et al., 1996; Sta Iglesia and Vanable, 1998). Skin-derived keratinocytes can sense an EF of this magnitude within minutes, reform their lamellipodia facing the cathode, and migrate directionally in vitro, a process known as galvanotaxis (Nishimura et al., 1996). The mechanism for keratinocyte sensing of the EF is largely unknown, but a role for Ca²⁺ influx (Trollinger et al., 2002; Fang et al., 1998), epidermal growth factor receptor (EGFR) phosphorylation (Fang et al., 1999), and cAMP-dependent PKA (Pullar et al., 2001; Pullar and Isseroff, 2005) have been implicated in previous work from this laboratory. Thus, in addition to providing a physiological mechanism for rapid orientation of directional migration of keratinocytes in wound healing, the galvanotaxis response of cells in vitro provides an experimental paradigm for dissecting the mechanisms that underlie directional migratory responses of cells.

64 integrin, a receptor for laminin 332, plays a critical structural role in keratinocytes, localizing to the hemidesmosome (HD) and providing tight anchorage of basal keratinocytes to the basement membrane (Sonnenberg et al., 1991). Indeed, in patients expressing a null mutation of the 4 integrin, epidermal blistering occurs because of the poor adhesion of the epidermis to the basement membrane (Niessen et al., 1996; van der Neut et al., 1996). However, the 64 integrin can switch from a structural adhesive role to a signaling component involved in cell migration. On wounding, growth factors secreted in the wound can transform basal wound edge keratinocytes from static cells to motile ones. This is accompanied by the disassembly of the HD and the relocalization of 64 integrin from the HD to the lamellipodia of migrating cells (Marikovsky et al., 1993; Mainiero et al., 1996; Martin, 1997; Santoro et al., 2003). The ligand for this integrin, laminin 332 (also called laminin 5), is secreted by keratinocytes both in culture (Marinkovich et al., 1992; Ryan et al., 1996) and at the leading edge of an epidermal outgrowth into the wound bed (Sonnenberg et al., 1991; Ryan et al., 1999), providing a suitable binding partner for the integrin as the cell migrates.

Previously, the 64 integrin has been implicated in the chemotaxis response of keratinocytes, where it plays a role in EGF-induced cell migration through the sustained activation of Rac1 (Russell et al., 2003). Mechanisms regulating directional migration in response to EF could be similar. Just as actin is polymerized preferentially at the leading edge of neutrophils during chemotaxis (Zigmond, 1977; Devreotes and Zigmond, 1988), it similarly accumulates at the cathodal-facing edge of corneal epithelial cells migrating directionally in an applied EF (Zhao et al., 1999). Additionally, the EGFR is polarized in both corneal epithelial cell (Zhao et al., 2002) and keratinocyte (Fang et al., 1998, 1999) galvanotaxis and is required for fibroblast directional migration toward fibronectin or laminin (Li et al., 1999). With this possible similarity in mind, we investigated the signaling roles of both the 64 integrin and EGFR in the galvanotaxis response in keratinocytes.

Here we describe the novel role for 4 integrin in keratinocyte galvanotaxis and delineate the corresponding signaling pathways. We report that although the expression of 4 integrin appears to have no effect on rate of migration on a collagen substrate, it is critical for EF-mediated directional migration. In the absence of exogenously supplied EGF, 4 integrin-null cells cannot respond with directional migration. The 4 integrin coordinates with EGF to initiate and maintain persistent, robust cathodal migration. The 4 integrin extracellular laminin-binding domain and its functional cytoplasmic domain are both required for 4 integrin–mediated galvanotaxis. We demonstrate that Rac1 is the common downstream target for both 4 integrin–mediated and EGF-mediated directional migration in an EF. Therefore, the molecular mechanisms underpinning both chemotaxis and galvanotaxis employ Rac1 as a critical mediator of directional responses.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Primary Human Keratinocytes
Primary human keratinocytes (NHK) were isolated from neonatal foreskins as we have reported previously (Isseroff et al., 1987; Pullar et al., 2006), under an approved exemption granted by the Internal Review Board at the University of California, Davis and cultured using a modification of the method of Rheinwald and Green (1975). NHKs were grown in keratinocyte growth medium (KGM; Epilife, 0.06 mM Ca²⁺; Cascade Biologics, Portland, OR), supplemented with human keratinocyte growth supplement (0.2 ng/ml EGF, 5 µg/ml insulin, 5 µg/ml transferrin, 0.18 µg/ml hydrocortisone, and 0.2% bovine pituitary extract; Cascade Biologics) and antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin; Gemini Bio-Products, Calabasas, CA) at 37°C in a humidified atmosphere of 5% CO₂. Cell strains isolated from at least three different foreskins were used in all experiments, performed with subcultured cells between passages 3 and 7.

Cell Lines
Primary human keratinocytes lacking 4 integrin were obtained from a patient with epidermolysis bullosa with pyloric atresia (EB-PA) resulting from a premature termination codon (C658X; Russell et al., 2003). Neonatal foreskin keratinocytes and EB-PA patient keratinocytes were immortalized with HPV18 E6 and E7 genes (Kaur et al., 1989) and designated NIK and 4–, respectively. Cells were cultured in equal parts defined keratinocyte serum free medium (SFM; Invitrogen, Carlsbad, CA) and keratinocyte medium 154 (Cascade Biologics). Culture media contained 100 IU/ml penicillin and 100 IU/ml streptomycin, and cells were cultured at 37°C in a humidified 5% CO₂ incubator.

cDNA Constructs and Vectors
The cloning of the 4 integrin gene (4+) and the adhesion defective 4 integrin gene (4+AD) have been described previously (Russell et al., 2003). The cDNAs for the constitutively active and inactive Rac1 mutants, V12Rac1 and N17Rac1, were a kind gift of Dr. Alan Hall (University College London, United Kingdom) and were cloned as EcoRI fragments into the retroviral expression vector LZRS (Kinsella and Nolan, 1996) containing the encephalomyocarditis virus (EMCV)-IRES and blasticidin-resistance sequences (Deng et al., 1998). To generate the 4 integrin construct with a truncated cytoplasmic domain, (4+CT) the WT 4 integrin cDNA was removed from the LZRS retroviral expression vector by EcoRI digestion and subsequently cloned into the EcoRI site of the pENTR1A vector (Invitrogen). The COOH-terminal region of the 4 cytoplasmic deletion mutant 4^1–1217 was obtained by PCR using 4-del (sac)-5' (AGTACTGGATTCAGGGTGACTCCG, sense) and 4-1217+EcoRV-3' (TAGATATCAGTGGGTGCGGCAGGACACCA, antisense) primers and subsequently exchanged with WT 4 in pENTR1A. The reverse primer included a stop codon followed by the EcoRV site. PCR was performed using Takara Ex Taq (Takara, Tokyo, Japan) with the 4 WT cDNA in LZRS as a template. The PCR fragment was cloned into a T-Easy vector (Promega, Madison, WI; 4^1–1217 in T-Easy), and its sequence was verified. The SacI/EcoRV fragment from 4^1–1217 in T-Easy was ligated into the SacI/EcoRV site within the WT 4 in pENTR1A. Finally, 4^1–1217 cDNA was recombined from the pENTR1A to the LZRS retroviral expression vector, including a Gateway cassette, using the LR Clonase II Enzyme mix (Invitrogen) by a recombination reaction.

Retroviral Transduction
Keratinocytes were transduced with retroviral vectors for the stable expression of WT 4 integrin (4+), 4+AD, V12Rac1, N17Rac1, and 4+CT constructs. Amphotropic retrovirus was produced in modified 293 cells as previously described (Kinsella and Nolan, 1996). Keratinocytes, 2 x 10⁵, were incubated in serum-free medium (SFM) containing 5 µg/ml poybrene for 15 min before infection. Medium was removed and 10 ml of retroviral supernatant containing 5 µg/ml polybrene (Sigma, St. Louis, MO) was added to both viral supernatant and keratinocyte media. Medium was removed, and 4 ml of retroviral supernatant was added. Plates were centrifuged at 300 x g for 1 h at 32°C using a Beckman GS-6R centrifuge (Beckman Coulter, Fullerton, CA). Cells were incubated at 37°C for 24 h followed by replacement with fresh SFM and selection with 5 µg/ml blasticidin (Calbiochem, La Jolla, CA). Selection was omitted for primary cell cultures.

Antibodies and Inhibitors
Mouse mAb 3E1 against 4 integrin (immunostaining) and ASC-8 were obtained from Chemicon (Temecula, CA). Mouse mAb ASC-8 is inhibitory to 64 attachment and was used in all inhibition assays at 10 µg/ml. Mouse monoclonal anti-vinculin antibody (h-vin-1) was purchased from Sigma. The specific Rac1 inhibitor 553502 was purchased from Calbiochem (San Diego, CA) in solution and used at a concentration of 100 µM.

Cell Treatments
Cells were starved of growth factors in basal medium (Epilife containing antibiotics [100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin]) for 16 h, before plating for galvanotaxis studies. Cells were plated in the presence or absence of epidermal growth factor (EGF; Invitrogen), 2 ng/ml for 3 h before EF application. ASC-8 was added to the cells for 10 min before plating. Cells were preincubated with the Rac1 inhibitor for 30 min before EF application. Galvanotaxis was performed in the presence or absence of EGF, ASC-8, or 553502.

Galvanotaxis
The galvanotaxis chamber construction and DC application were performed as described previously (Pullar and Isseroff, 2005). Briefly, the galvanotaxis chamber is composed of a rectangular Plexiglas frame with two medium reservoirs on opposite sides to which a 45 x 50-mm piece of No. 1.5 glass coverslip is attached to form the chamber bottom. This allows for continuous observation of the plated cells on an inverted microscope. Keratinocytes, 2 x 10⁴, are plated onto the collagen-coated center of the chamber between two 25 x 10-mm coverslip spacers and allowed to attach for 3 h at 37°C. A third 25-mm² coverslip is placed on top, straddling the two spacer coverslips and covering the cells plated on the collagen-coated center panel. This third coverslip rests 100–105 µm above the center panel and is sealed on top of the spacer coverslips with silicone high-vacuum grease (Dow Corning, Midland, MI). This small height is chosen to minimize the cross-sectional area through which current flows. A small cross-section creates a high-resistance pathway, resulting in a higher voltage gradient for a fixed current. The aqueduct allows for medium and current flow across the cells. The voltage across the coverslip is measured using a voltmeter via silver-sliver chloride (Ag-AgCl) wire electrodes inserted into both medium reservoirs on either side of the center panel. Six-centimeter-long 2% agar/phosphate-buffered saline–filled pieces of polypropylene tubing connect each end of the chamber to a medium-filled well in which the Ag-AgCl electrodes are placed, to separate possible electrode byproducts from the cells themselves. A 100-mV/mm current is applied across the chamber. The current is measured with an ammeter in series, and we only use chambers for which the current flow is kept below 0.6 mA, to minimize joule heating. Furthermore, temperature of the medium in the chambers is maintained at 36°C by placing the chamber on a metal plate heated to and maintained at 39°C. The temperature is continuously monitored during the experiment using a YSI 400 analog temperature probe (Yellow Springs Instrument Co., Yellow Springs, OH) directly attached to the metal plate and does not vary by more than 1°C over the course of the experiment.

Time-Course Observation and Data Analysis
The galvanotaxis chambers rest on inverted Nikon microscopes (Melville, NY), and control and test assays were run simultaneously on duplicate setups side by side. Time-lapse images of the cell migratory response are digitally captured every 10 min over a 1-h period by a QImaging Retiga-EX cameras (Burnaby, BC, Canada) controlled by a custom automation written in Improvision Openlab software (Lexington, MA) on a Macintosh G4 (Apple Computer, Cupertino, CA). After each cell's center of mass is tracked using the Openlab software, directionality of migration is calculated and imported to Excel (Microsoft, Redmond, WA). Cosine describes the direction of migration and is a measure of the persistence of cathodal directedness, where is the angle between the field axis and the vector drawn by the cell migration path. The average cosine = _i cos _i/N, where _i is the summation of 50–150 individual cells from at least three different cell strains. Angle zero ( = 0°) is assigned to the negative pole (cathode) and increasing angles assigned in a clockwise manner, with q = 180° aligned with the positive pole (anode). Therefore, the cosine will provide a number between –1 and +1, and the average of all of the separate cell events yields an index of directional migration. For example, if a cell were to move directly to the negative pole, the angle = 0° and the cosine = 1. "Cosine," therefore, refers to the average directional migration index of separate cell migration events at the end of a 1-h period. Results are given as average cosine ± the SEM. Significance is taken as p < 0.01, using Student's t test (unpaired) to compare the means of two cell populations.

The rate and directionality of migration can be clearly represented graphically using a polar plot. Each cell is placed at the origin of the circle at time 0, and its final position is plotted as a single point on the graph. The distance of the points from the origin provides an indication of cell migration rate and the distribution of points between the four quadrants indicates the direction of migration. The radius of each graph is 100 µM.

Immunofluorescence Staining and Microscopy
Sterile glass cover slips (Fisher Scientific, Pittsburgh, PA) were transferred into 12-well dishes and collagen-coated with 60 µg/ml collagen I (Vitrogen 100; Collagen, Palo Alto, CA) in KGM for 1 h at 37°C. Coverslips were washed three times with KGM, and 3 x 10⁴ cells were added per well and allowed to attach for 3 h. Coverslips were processed at room temperature unless otherwise noted. Coverslips were washed twice in PBS and fixed for 10 min in 4% paraformaldehyde. Coverslips were washed twice in PBS between each step. Cells were permeabilized for 5 min with 0.1% Triton X-100/PBS and blocked with 5% goat serum/PBS for 20 min. Primary monoclonal anti-4 integrin antibody (3E1; 1:50) or primary monoclonal anti-vinculin antibody (h-vin-1; 1:100) was added dropwise in 1% goat serum/PBS (1:100) and incubated for 1 h at 37°C. A goat anti-mouse cy3 antibody (Jackson ImmunoResearch Laboratory, West Grove, PA; 1:100) was added in 1% goat serum/PBS for 1 h at 37°C. Standard controls were performed. Coverslips were incubated with the primary antibody alone or the secondary antibody alone to ensure specificity. Finally, Prolong gold anti-fade reagent (Molecular Probes, Eugene, OR) was used according to manufacturer's instructions to mount the coverslips onto glass microscope slides. Slides were viewed on an inverted fluorescent Nikon Diaphot microscope using a 40x pan fluor objective. Images were captured using QImaging Retiga-EX cameras and are presented in gray scale (4 integrin) or pseudocolored red (vinculin).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Both 4 Integrin and EGF Are Required for Keratinocyte Directional Migration
Keratinocytes will quickly attach to collagen-coated culture plates, and within 3 h the majority of the cells will develop a motile phenotype, with a characteristic crescent shape and a broad lamellipodium along the convex side of the cell. They will begin to secrete laminin 332 during this time frame (Marinkovich et al., 1992), switching from collagen- to laminin-dependent adhesion and signaling (Nguyen et al., 2000a, 2000b; Frank and Carter, 2004).

To determine the role that 4 integrin plays in both keratinocyte motility and directional migration within a DC EF, human keratinocyte cell lines lacking the 4 integrin (4–), those in which the 4 integrin has been reexpressed (4+), or primary human keratinocytes (NHK) were examined for their migratory response in an EF. We have previously demonstrated that the application of a DC EF does not alter the keratinocyte migration rate (Nishimura et al., 1996; Pullar and Isseroff, 2005). The absence (4–) or presence (4+) of 4 integrin appears to have no effect on the rate of cell migration in this system, whereas the application of EGF significantly increases their speed by 81 and 57%, respectively (Figure 1A).

View larger version (20K): [in this window] [in a new window]   Figure 1. 4 integrin and EGF are both required for keratinocyte directional migration. 4+, 4–, and NHKs were starved for 16 h in basal medium containing no growth factors. Cells, 2 x 104,were plated in the presence or absence of 2 ng/ml EGF on the collagen-coated glass in the center of the galvanotaxis chambers as described in Materials and Methods. An electric field (EF) of 100 mV/mm was applied across the cells, and images were captured every 10 min over a 1-h period. The speed (µm/min; A) and directionality (cosine; B) of migration were calculated as described in Materials and Methods. (A) The speed of migration for 4– and 4+ cells in the presence and absence of EGF is shown. The number of cells is as follows: 4–, no EGF, n=64; 4+, no EGF, n=113; 4–, EGF, n=98 and 4+, EGF, n=81. *p < 0.01 between all conditions and those in the presence of EGF. (B) The cosine of migration for 4– and 4+ cells in the presence and absence of EGF is shown. *p < 0.01 between all conditions and 4+ + EGF. (C) To clearly demonstrate the directionality and rate of migration for each condition the data were plotted using a circle graph. Each cell's position at time (t)=0 is at the origin (0,0), and its final position is at the end of the 1-h exposure to the EF is plotted as a single point on the graph. The radius of each circle represents 100 µM of translocation distance. The cathode is at the top of each graph (0o) and the anode is at the bottom (180o). The data shown are combined from at least four independent experiments. (D) The speed and directionality for NHKs in the presence and absence of EGF is presented (NHK, no EGF, n=59; NHK, EGF, n=78). *p < 0.01 between all conditions and those in the presence of EGF. The data shown are combined from at least four independent experiments on three separate cell strains. Error bars, SEM.

4 Integrin Is Localized to Focal Adhesions within the Keratinocyte Lamellipodium
Actin remodeling plays an important role in cell polarization (Ridley et al., 2003), essential for chemoattractant-driven (Merlot and Firtel, 2003) and EF-driven (Zhao et al., 2002) directional migration and motility (Pantaloni et al., 2001). Actin filaments terminate in focal adhesions (FAs), signaling centers that mediate the mechanical attachment of cells to the extra cellular matrix (Gilmore and Burridge, 1996), and regulate gene expression, cell growth, and survival (Sastry and Burridge, 2000). We reasoned that if the 4 integrin is localized within FAs, then binding to its ligand, laminin 332, could initiate the signaling required for 4 integrin–mediated directional migration. We found that after plating on collagen for 3 h, the keratinocytes exhibit 4 integrin staining within linear focal adhesions (identified as vinculin immunopositive structures) localized at the leading edge of the migrating cells (unpublished data), supporting this hypothesis.

Laminin 332-mediated Ligation of 4 Integrin Is Required for Keratinocyte Directional Migration in the Absence of EGF
To determine if ligand binding to laminin 332 was required for the directional response, we expressed an adhesion-defective mutant of 4 integrin that fails to bind laminin 332 (4+AD) in the 4– cells and observed their migratory response in an applied EF. Loss of adhesion by laminin 332 has no effect on rate of migration in the presence or absence of EGF (unpublished data). In stark contrast, however, 4+AD cells are blinded to the EF in the absence of EGF and migrate randomly (Figure 2A). The inclusion of EGF in the medium recovers some of the directional deficit, as it does in the 4– cells. Indeed, their responses to the EF are very similar to 4– cells (Figure 2A).

View larger version (9K): [in this window] [in a new window]   Figure 2. Laminin 332–mediated ligation of 4 integrin is required for keratinocyte directional migration in the absence of EGF. 4+, 4+ADs were starved for 16 h in basal medium containing no growth factors, and experiments were performed as described in the legend for Figure 1. (A) The cosine of migration for 4+ and 4+AD cells in the presence and absence of EGF is shown. The number of cells is as follows: 4–, no EGF, n = 64; 4+, no EGF, n = 113; 4+AD, no EGF, n = 73; 4–, EGF, n = 98; 4+, EGF n = 81; and 4+AD EGF, n = 82. The data shown are combined from at least four independent experiments. Error bars, SEM. *p < 0.01 between all conditions and 4+ cells in the presence of EGF. (B) 4+ and NHKs were starved for 16 h in basal medium containing no growth factors, and experiments were performed as described in the legend for Figure 1. The cosine of migration for 4+ cells in the presence and absence of ASC-8 and EGF is shown. The number of cells is as follows: 4–, no EGF, n = 64; 4+, no EGF, n = 113; 4+, no EGF + ASC-8, n = 75; 4–, EGF, n = 98; 4+, EGF, n = 81; and 4+, EGF +l ASC-8, n = 114). The data shown are combined from at least four independent experiments. Error bars, SEM. *p < 0.01 between all conditions and 4+ in the presence of EGF. (C) The cosine of migration for NHKs in the presence and absence of ASC-8 and EGF is shown. The number of cells is as follows: NHK, no EGF, n = 59; NHK, no EGF + ASC-8, n = 70; NHK, EGF, n = 78; and NHK, EGF + ASC-8, n = 62. The data shown are combined from at least four independent experiments on three separate cell strains. Error bars, SEM. *p < 0.01 between all conditions and NHK in the presence of EGF.

The Cytoplasmic Tail of 4 Integrin Is Essential for 4 Integrin–mediated Keratinocyte Directional Migration in the Absence of EGF
Integrins transmit signals from the extracellular matrix by the association of adapter proteins with their cytoplasmic tails (CT; Giancotti and Ruoslahti, 1999). Previously, it has been demonstrated that the cytoplasmic tail of 4 integrin is essential for the 64-mediated activation of signaling pathways required for the anchorage-independent survival of mammary tumors (Zahir et al., 2003) and for epidermal growth and wound healing (Nikolopoulos et al., 2005). To further examine the role of the 4 integrin in EF-mediated directional migration, we expressed a 4 integrin construct lacking a cytoplasmic tail in 4– cells (4+CT). There was no decrease in the rate of migration between 4+ and 4+CT cells in the absence or presence of EGF (unpublished data), suggesting that the B4 cytoplasmic tail and its downstream signaling are not critical components for motility per se. In contrast, however, the 4+CT cells are unable to sense and respond with directional migration to the EF in the absence of EGF, indicating the requirement of the 4 cytoplasmic tail for the response (Figure 3). Addition of EGF partially rescues the directional response in the 4+CT cells, again suggesting that a second, 4 integrin–independent, EGF-mediated signaling pathway is required for a directional migratory response to an applied EF (Figure 3).

View larger version (13K): [in this window] [in a new window]   Figure 3. The cytoplasmic tail of 4 integrin is essential for 4 integrin–mediated keratinocyte directional migration in the absence of EGF. 4+, 4+CTs were starved for 16 h in basal medium containing no growth factors, and experiments were performed as described in the legend for Figure 1. The cosine of migration for 4+ and 4+CT cells in the presence and absence of EGF is shown. The number of cells is as follows: 4–, no EGF, n = 64; 4+, no EGF, n = 113; 4+CT, no EGF, n = 116; 4–, EGF, n = 98; 4+, EGF, n = 81; and 4+CT, EGF, n = 141. The data shown are combined from at least four independent experiments. Error bars, SEM. *p < 0.01 between all conditions and 4+ in the presence of EGF. #p < 0.01 between 4+ in the absence of EGF and both 4– and 4+CT in the absence of EGF.

Rac1 Is the Common Downstream Target for Both 4 Integrin- and EGF-mediated Directional Migration in an EF

View larger version (18K): [in this window] [in a new window]   Figure 4. Rac1 is the common downstream target for both 4 integrin– and EGF-mediated keratinocyte directional migration in an EF. 4+, 4–, and NIK-N17Rac1s were starved for 16 h in basal medium containing no growth factors, and experiments were performed as described in the legend for Figure 1. (A) The cosine of migration for 4–, 4+, and NIK-N17Rac1 cells in the presence and absence of EGF is shown. The number of cells is as follows: 4–, no EGF, n = 64; 4+, no EGF, n = 113; NIK-N17Rac1, no EGF, n= 58; 4–, EGF, n = 98; 4+, EGF, n = 81; and NIK-N17Rac1, EGF, n = 54. *p < 0.01 between all conditions and 4+ + EGF. #p < 0.01 between NIK-N17Rac1 and 4–/+ cells in both the presence and absence of EGF. The data shown are combined from at least four independent experiments. Error bars, SEM. 4+ cells, 2 x 104, were plated, in the presence of 2 ng/ml EGF, on the collagen-coated glass in the center of the galvanotaxis chambers as described in Materials and Methods. Thirty minutes before EF application 100 µM 553502 (Rac1 inhibitor) was added to the medium of half the prepared chambers. Galvanotaxis was performed in the presence or absence of 553502, as described in Materials and Methods. (B) The speed and directionality of migration for 4+ in the presence and absence of 553502 are shown. The number of cells is as follows: 4+, EGF, n = 81 and 4+ + 553502, EGF, n = 117. *p < 0.01. The data shown are combined from at least four independent experiments. Error bars, SEM.

Activated Rac1 Cannot Rescue Keratinocyte Directional Migration in 4 Integrin-Null Cells

View larger version (11K): [in this window] [in a new window]   Figure 5. Activated Rac1 cannot rescue keratinocyte directional migration in 4 integrin-null cells. 4–, 4+, and 4-V12Rac1 cells were starved for 16 h in basal medium containing no growth factors, and experiments were performed as described in the legend for Figure 1. The cosine of migration for 4– and 4-V12Rac1 cells in the presence of EGF is shown. The number of cells is as follows: 4–, EGF, n = 98; 4+, EGF, n = 81; and 4-V12Rac1, EGF, n = 129. *p < 0.01 between all conditions and 4+ + EGF. The data shown are combined from at least four independent experiments. Error bars, SEM.

Activated Rac1 Fully Restores 4 Integrin–mediated Keratinocyte Directional Migration in the Absence of Laminin 332 Ligation

The expression of the active Rac1 mutant has no effect on migration rate in both the presence and absence of EGF (unpublished data); however, 4+AD cells are now able to fully respond to an applied EF. Indeed, they exhibit a robust directional response in the presence of EGF, and in its absence they are indistinguishable from 4+ cells (Figure 6).

View larger version (16K): [in this window] [in a new window]   Figure 6. Activated Rac1 fully restores 4 integrin–mediated keratinocyte directional migration in the absence of laminin 332 ligation. 4–, 4+AD, 4+AD-V12Rac1, and 4+ cells were starved for 16 h in basal medium containing no growth factors, and experiments were performed as described in the legend for Figure 1. The cosine of migration for 4–, 4+AD, 4+AD-V12Rac1 cells in the presence or absence of EGF is shown. The number of cells is as follows: 4–, no EGF, n = 64; 4+AD, no EGF, n = 73; 4+AD-V12Rac1, no EGF, n = 75; 4+, no EGF, n = 113; 4–, EGF, n = 98; 4+AD, EGF, n = 82; 4+AD-V12Rac1, EGF, n = 102; and 4+, EGF, n = 81. *p < 0.01 between all conditions and 4+AD-V12Rac1 + EGF. The data shown are combined from at least four independent experiments. Error bars, SEM.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

View larger version (13K): [in this window] [in a new window]   Figure 7. A diagrammatic illustration is shown outlining the synergistic pathways required for keratinocyte EF-mediated directional migration.

Previously, we have demonstrated that EGF enhances both keratinocyte motility and EF-mediated directional migration (Fang et al., 1998), as we also demonstrate here. However, the current studies reveal a novel and absolute requirement for the coordinated action of both EGF and 4 integrin to initiate and maintain robust EF-mediated directional migration. It is known that EGFR and 64 integrin cross-talk. 64 integrin can physically interact with a number of receptor tyrosine kinases including the EGFR, ErbB-2, Ron, and Met (Falcioni et al., 1997; Hintermann et al., 2001; Mariotti et al., 2001; Trusolino et al., 2001), and EGF induces tyrosine phosphorylation of the 4 integrin cytoplasmic tail, which has been implicated in hemidesmosome disassembly and epithelial motility (Mainiero et al., 1996). Additionally, integrin adhesion can result in the phosphorylation of the EGFR on numerous tyrosine residues (Moro et al., 2002) and can potentiate signaling pathways in response to EGF, PDGF, FGF, VEGF, and insulin (reviewed by (Schwartz and Baron, 1999). A considerable amount of evidence supports a role for integrin-mediated adhesion in coordinating growth-factor–mediated responses (reviewed by Cabodi et al., 2004). Integrin-mediated signaling is required for EGF-dependent proliferation, survival, and migration, demonstrating that a cooperative interaction is necessary to achieve full biological responses (Cabodi et al., 2004). It appears that 64 integrin and EGF also cooperate to support robust keratinocyte directional migration in response to an applied EF cue.

4 integrin has been demonstrated to localize to lamellipodia and filopodia of migrating carcinoma cells and associate with F-actin (Rabinovitz and Mercurio, 1997). Indeed, inhibition of 64 function resulted in the collapse of lamellipodia and filopodia (Rabinovitz and Mercurio, 1997; Rabinovitz et al., 1999). 64 has also been localized to actin-containing structures in keratinocytes (Geuijen and Sonnenberg, 2002; Santoro et al., 2003; Spinardi et al., 2004), but we observe its presence in fine linear structures at the leading edge, suggesting that in migrating keratinocytes, 4 integrin becomes incorporated within focal adhesion sites, centers for traction control (Ridley et al., 2003).

The cytoplasmic tail of 4 integrin is unique with no known homology to other subunits. It is unusually long (1000 amino acids), associates with the hemidesmosome cytoskeleton (Sonnenberg et al., 1991) via HD 1/plectin (Nievers et al., 2000) and contains a tyrosine activation motif (TAM) that can facilitate the docking of src homology 2 (SH2) domains while phosphorylated. In primary keratinocytes both Shc and Grb2 are recruited to the 4 integrin–phosphorylated TAM sequentially activating MAP kinase pathways and promoting proliferation (Mainiero et al., 1995, 1997). Furthermore, 64 can activate phosphoinositide 3-kinase (PI3-K), increasing the invasive capacity of breast and colon carcinoma cells (Shaw et al., 1997).

The loss of the 4 integrin cytoplasmic tail has a negative effect on the ability of the cells to sense and respond to the applied EF in the absence of EGF. 4+CT-expressing cells are blinded to the applied EF and migrate randomly, reminiscent of 4+AD cells. It appears that a fully functional 4 integrin ligand-binding domain and a fully functional 4 integrin cytoplasmic tail are both required in order for keratinocytes to respond to an applied EF in the absence of EGF and respond robustly in the presence of EGF. This suggests that in the absence of EGF, ligation of 4 integrin by laminin 332 transmits a signal via its cytoplasmic tail to initiate and respond to an applied EF, allowing the cell to form a new lamellipodium facing the cathode, turn, and migrate directionally.

The ability of a cell to respond to an applied EF requires the formation of a new lamellipodium facing the cathode. Rac1 plays a role in lamellipodial formation (Hall, 1998) and expression of a constitutively active Rac1 mutant accelerates cutaneous wound repair (Hassanain et al., 2005). Previously, it has been demonstrated that 4 integrin can activate the PI3 kinase signaling pathway (Shaw et al., 1997; Gambaletta et al., 2000; Shaw, 2001) resulting in Rac1 activation (Shaw et al., 1997). Our studies highlight Rac1 as a critical convergence point and pivotal regulator of both 4 integrin– and EGF-mediated keratinocyte galvanotaxis, coordinating the signals to allow cells to migrate directionally in response to the applied EF. Although the expression of a dominant negative Rac1 mutant or the application of a specific Rac inhibitor slows keratinocyte migration, it prevents galvanotaxis in both the presence and absence of EGF. Importantly, we demonstrate that 4 integrin expression is essential for keratinocytes to sense and respond to an EF with robust directional migration, because a constitutively active Rac1 mutant cannot restore directional migration in cells lacking 4 integrin expression. Meanwhile, expression of the constitutively active Rac1 mutant in cells expressing adhesion-defective 4 integrin has no effect on migration rate but fully restores keratinocyte galvanotaxis. It has been suggested that while growth factors can activate Rac globally within the cell, integrins determine the specific locality where Rac will bind to its effectors, thus determining where to extend lamellipodia, facilitating directional migration (Del Pozo et al., 2002; Grande-Garcia et al., 2005). Although lamellipodial formation is absent in Rac1 genetic null cells (Vidali et al., 2006), a partial, rather than total, decrease in levels can actually increase persistent directional motility by suppressing peripheral and sustaining dominant lamellipodial formation (Pankov et al., 2005). Indeed, here it appears that 4 integrin coordinates with EGF to localize Rac1 activation to the dominant lamellipodium, initiate and maintain Rac1-dependent persistent directional migration in response to EF cueing.

In conclusion, we describe a role for 64 integrin in sustaining directional migration in keratinocytes in response to an applied EF and demonstrate that the cooperative interaction of both EGF and 4 integrin is necessary to achieve the full biological response of EF-mediated directional migration. Rac1 is critical for both EGF-mediated and 4 integrin–mediated keratinocyte directional migration in an applied EF as well as in EGF-driven chemotaxis (Russell et al., 2003). Perhaps underpinning the role of 4 integrin in directional migration is its ability to regulate cell turning or mediate stabilization of the site at which the new lamellipodium will form to allow migration in the direction of the applied gradient. Studying EF-induced directional migration will improve our understanding of directional sensing and the signaling mechanisms required for these biological processes that play important roles in embryonic development, inflammation, tumor metastasis, and wound repair.

	ACKNOWLEDGMENTS

 
This work was supported in part by the VA Palo Alto Office of Research and Development (M.P.M.) and National Institutes of Health Grants K01-AR48827 (C.E.P.), P01-AR44012 and R01-AR47223 (M.P.M.), and R01-AR44518 (R.R.I.).

	Footnotes

 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-05-0433) on August 16, 2006.

Present addresses: Department of Cell Physiology and Pharmacology, University of Leicester, Leicester LE1 9HN, United Kingdom;

Molecular and Cellular Biology, Cytokinetics Inc., 280 East Grand Avenue, South San Francisco, CA 94080;

^|| Department of Pathology, Columbia University College of Physicians and Surgeons, New York, NY 11032.

Address correspondence to: R. Rivkah Isseroff (rrisseroff{at}ucdavis.edu)

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Barker, A. T., Jaffe, L. F., Vanable, J. W. Jr. (1982). The glabrous epidermis of cavies contains a powerful battery. Am. J. Physiol 242, R358–R366.[Medline]

Borgens, R. B., Vanable, J. W. Jr, Jaffe, L. F. (1977). Bioelectricity and regeneration: large currents leave the stumps of regenerating newt limbs. Proc. Natl. Acad. Sci. USA 74, 4528–4532.[Abstract/Free Full Text]

Cabodi, S., Moro, L., Bergatto, E., Boeri Erba, E., Di Stefano, P., Turco, E., Tarone, G., Defilippi, P. (2004). Integrin regulation of epidermal growth factor (EGF) receptor and of EGF-dependent responses. Biochem. Soc. Trans 32, 438–442.[CrossRef][Medline]

Carter, W. G., Ryan, M. C., Gahr, P. J. (1991). Epiligrin, a new cell adhesion ligand for integrin alpha 3 beta 1 in epithelial basement membranes. Cell 65, 599–610.[CrossRef][Medline]

Chiang, M., Robinson, K. R., Vanable, J. W. Jr. (1992). Electrical fields in the vicinity of epithelial wounds in the isolated bovine eye. Exp. Eye Res 54, 999–1003.[CrossRef][Medline]

Del Pozo, M. A., Kiosses, W. B., Alderson, N. B., Meller, N., Hahn, K. M., Schwartz, M. A. (2002). Integrins regulate GTP-Rac localized effector interactions through dissociation of Rho-GDI. Nat. Cell Biol 4, 232–239.[CrossRef][Medline]

Deng, H., Choate, K. A., Lin, Q., Khavari, P. A. (1998). High-efficiency gene transfer and pharmacologic selection of genetically engineered human keratinocytes. Biotechniques 25, 274–280.[Medline]

Devreotes, P. N. and Zigmond, S. H. (1988). Chemotaxis in eukaryotic cells: a focus on leukocytes and Dictyostelium. Annu. Rev. Cell Biol 4, 649–686.[CrossRef][Medline]

Falcioni, R., Antonini, A., Nistico, P., Di Stefano, S., Crescenzi, M., Natali, P. G., Sacchi, A. (1997). Alpha 6 beta 4 and alpha 6 beta 1 integrins associate with ErbB-2 in human carcinoma cell lines. Exp. Cell Res 236, 76–85.[CrossRef][Medline]

Fang, K. S., Farboud, B., Nuccitelli, R., Isseroff, R. R. (1998). Migration of human keratinocytes in electric fields requires growth factors and extracellular calcium. J. Invest. Dermatol 111, 751–756.[CrossRef][Medline]

Fang, K. S., Ionides, E., Oster, G., Nuccitelli, R., Isseroff, R. R. (1999). Epidermal growth factor receptor relocalization and kinase activity are necessary for directional migration of keratinocytes in DC electric fields. J. Cell Sci 112, 1967–1978.[Abstract]

Frank, D. E. and Carter, W. G. (2004). Laminin 5 deposition regulates keratinocyte polarization and persistent migration. J. Cell Sci 117, 1351–1363.[Abstract/Free Full Text]

Gambaletta, D., Marchetti, A., Benedetti, L., Mercurio, A. M., Sacchi, A., Falcioni, R. (2000). Cooperative signaling between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote phosphatidylinositol 3-kinase-dependent invasion. J. Biol. Chem 275, 10604–10610.[Abstract/Free Full Text]

Geuijen, C. A. and Sonnenberg, A. (2002). Dynamics of the alpha6beta4 integrin in keratinocytes. Mol. Biol. Cell 13, 3845–3858.[Abstract/Free Full Text]

Giancotti, F. G. and Ruoslahti, E. (1999). Integrin signaling. Science 285, 1028–1032.[Abstract/Free Full Text]

Gilmore, A. P. and Burridge, K. (1996). Molecular mechanisms for focal adhesion assembly through regulation of protein-protein interactions. Structure 4, 647–651.[Medline]

Goldfinger, L. E., Hopkinson, S. B., deHart, G. W., Collawn, S., Couchman, J. R., Jones, J. C. (1999). The alpha3 laminin subunit, alpha6beta4 and alpha3beta1 integrin coordinately regulate wound healing in cultured epithelial cells and in the skin. J. Cell Sci 112, Pt 162615–2629.[Abstract]

Grande-Garcia, A., Echarri, A., Del Pozo, M. A. (2005). Integrin regulation of membrane domain trafficking and Rac targeting. Biochem. Soc. Trans 33, 609–613.[CrossRef][Medline]

Hall, A. (1998). Rho GTPases and the actin cytoskeleton. Science 279, 509–514.[Abstract/Free Full Text]

Hassanain, H. H., Irshaid, F., Wisel, S., Sheridan, J., Michler, R. E., Goldschmidt-Clermont, P. J. (2005). Smooth muscle cell expression of a constitutive active form of human Rac 1 accelerates cutaneous wound repair. Surgery 137, 92–101.[CrossRef][Medline]

Hintermann, E., Bilban, M., Sharabi, A., Quaranta, V. (2001). Inhibitory role of alpha 6 beta 4-associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on alpha 3 beta 1 integrin. J. Cell Biol 153, 465–478.[Abstract/Free Full Text]

Isseroff, R. R., Ziboh, V. A., Chapkin, R. S., Martinez, D. T. (1987). Conversion of linoleic acid into arachidonic acid by cultured murine and human keratinocytes. J. Lipid Res 28, 1342–1349.[Abstract]

Kaur, P., McDougall, J. K., Cone, R. (1989). Immortalization of primary human epithelial cells by cloned cervical carcinoma DNA containing human papillomavirus type 16 E6/E7 open reading frames. J. Gen. Virol 70, Pt 51261–1266.[Abstract/Free Full Text]

Kinsella, T. M. and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene. Ther 7, 1405–1413.[Medline]

Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J., Takada, Y., Carter, W. G. (1998). Cellular interaction of integrin alpha3beta1 with laminin 5 promotes gap junctional communication. J. Cell Biol 143, 1735–1747.[Abstract/Free Full Text]

Li, J., Lin, M. L., Wiepz, G. J., Guadarrama, A. G., Bertics, P. J. (1999). Integrin-mediated migration of murine B82L fibroblasts is dependent on the expression of an intact epidermal growth factor receptor. J. Biol. Chem 274, 11209–11219.[Abstract/Free Full Text]

Mainiero, F., Murgia, C., Wary, K. K., Curatola, A. M., Pepe, A., Blumemberg, M., Westwick, J. K., Der, C. J., Giancotti, F. G. (1997). The coupling of alpha6beta4 integrin to Ras-MAP kinase pathways mediated by Shc controls keratinocyte proliferation. EMBO J 16, 2365–2375.[CrossRef][Medline]

Mainiero, F., Pepe, A., Wary, K. K., Spinardi, L., Mohammadi, M., Schlessinger, J., Giancotti, F. G. (1995). Signal transduction by the alpha 6 beta 4 integrin: distinct beta 4 subunit sites mediate recruitment of Shc/Grb2 and association with the cytoskeleton of hemidesmosomes. EMBO J 14, 4470–4481.[Medline]

Mainiero, F., Pepe, A., Yeon, M., Ren, Y., Giancotti, F. G. (1996). The intracellular functions of alpha6beta4 integrin are regulated by EGF. J. Cell Biol 134, 241–253.[Abstract/Free Full Text]

Marikovsky, M., Breuing, K., Liu, P. Y., Eriksson, E., Higashiyama, S., Farber, P., Abraham, J., Klagsbrun, M. (1993). Appearance of heparin-binding EGF-like growth factor in wound fluid as a response to injury. Proc. Natl. Acad. Sci. USA 90, 3889–3893.[Abstract/Free Full Text]

Marinkovich, M. P., Lunstrum, G. P., Keene, D. R., Burgeson, R. E. (1992). The dermal-epidermal junction of human skin contains a novel laminin variant. J. Cell Biol 119, 695–703.[Abstract/Free Full Text]

Mariotti, A., Kedeshian, P. A., Dans, M., Curatola, A. M., Gagnoux-Palacios, L., Giancotti, F. G. (2001). EGF-R signaling through Fyn kinase disrupts the function of integrin alpha6beta4 at hemidesmosomes: role in epithelial cell migration and carcinoma invasion. J. Cell Biol 155, 447–458.[Abstract/Free Full Text]

Martin, P. (1997). Wound healing—aiming for perfect skin regeneration. Science 276