![]() |
|
|
Vol. 17, Issue 11, 4925-4935, November 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4 Integrin and Epidermal Growth Factor Coordinately Regulate Electric Field-mediated Directional Migration via Rac1


,
,||
,¶
*Department of Dermatology, University of California, Davis, Davis, CA 95616;
Program in Epithelial Biology, Stanford University School of Medicine, Stanford, CA 94305; #Dermatology Service, Northern California Health Care System, Department of Veterans Affairs, Mather, CA 95655; and ¶VA Palo Alto Health Care System, Department of Veterans Affairs, Stanford, CA 94304
Submitted May 24, 2006;
Revised July 21, 2006;
Accepted August 9, 2006
Monitoring Editor: Mark Ginsberg
| ABSTRACT |
|---|
|
|
|---|
)4 integrin in directional migration, the migratory paths of either primary human keratinocytes (NHK),
4 integrin-null human keratinocytes (
4), or those in which
4 integrin was reexpressed (
4+), were tracked during exposure to EFs of physiological magnitude (100 mV/mm). Although the expression of
4 integrin had no effect on the rate of cell movement, it was essential for directional (cathodal) migration in the absence of epidermal growth factor (EGF). The addition of EGF potentiated the directional response, suggesting that at least two distinct but synergistic signaling pathways coordinate galvanotaxis. Expression of either a ligand bindingdefective
4 (
4+AD) or
4 with a truncated cytoplasmic tail (
4+CT) resulted in loss of directionality in the absence of EGF, whereas inhibition of Rac1 blinded the cells to the EF even in the presence of EGF. In summary, both the
4 integrin ligandbinding and cytoplasmic domains together with EGF were required for the synergistic activation of a Rac-dependent signaling pathway that was essential for keratinocyte directional migration in response to a galvanotactic stimulus. | INTRODUCTION |
|---|
|
|
|---|
6
4 integrin, a receptor for laminin 332, plays a critical structural role in keratinocytes, localizing to the hemidesmosome (HD) and providing tight anchorage of basal keratinocytes to the basement membrane (Sonnenberg et al., 1991
). Indeed, in patients expressing a null mutation of the
4 integrin, epidermal blistering occurs because of the poor adhesion of the epidermis to the basement membrane (Niessen et al., 1996
; van der Neut et al., 1996
). However, the
6
4 integrin can switch from a structural adhesive role to a signaling component involved in cell migration. On wounding, growth factors secreted in the wound can transform basal wound edge keratinocytes from static cells to motile ones. This is accompanied by the disassembly of the HD and the relocalization of
6
4 integrin from the HD to the lamellipodia of migrating cells (Marikovsky et al., 1993
; Mainiero et al., 1996
; Martin, 1997
; Santoro et al., 2003
). The ligand for this integrin, laminin 332 (also called laminin 5), is secreted by keratinocytes both in culture (Marinkovich et al., 1992
; Ryan et al., 1996
) and at the leading edge of an epidermal outgrowth into the wound bed (Sonnenberg et al., 1991
; Ryan et al., 1999
), providing a suitable binding partner for the integrin as the cell migrates.
Previously, the
6
4 integrin has been implicated in the chemotaxis response of keratinocytes, where it plays a role in EGF-induced cell migration through the sustained activation of Rac1 (Russell et al., 2003
). Mechanisms regulating directional migration in response to EF could be similar. Just as actin is polymerized preferentially at the leading edge of neutrophils during chemotaxis (Zigmond, 1977
; Devreotes and Zigmond, 1988
), it similarly accumulates at the cathodal-facing edge of corneal epithelial cells migrating directionally in an applied EF (Zhao et al., 1999
). Additionally, the EGFR is polarized in both corneal epithelial cell (Zhao et al., 2002
) and keratinocyte (Fang et al., 1998
, 1999
) galvanotaxis and is required for fibroblast directional migration toward fibronectin or laminin (Li et al., 1999
). With this possible similarity in mind, we investigated the signaling roles of both the
6
4 integrin and EGFR in the galvanotaxis response in keratinocytes.
Here we describe the novel role for
4 integrin in keratinocyte galvanotaxis and delineate the corresponding signaling pathways. We report that although the expression of
4 integrin appears to have no effect on rate of migration on a collagen substrate, it is critical for EF-mediated directional migration. In the absence of exogenously supplied EGF,
4 integrin-null cells cannot respond with directional migration. The
4 integrin coordinates with EGF to initiate and maintain persistent, robust cathodal migration. The
4 integrin extracellular laminin-binding domain and its functional cytoplasmic domain are both required for
4 integrinmediated galvanotaxis. We demonstrate that Rac1 is the common downstream target for both
4 integrinmediated and EGF-mediated directional migration in an EF. Therefore, the molecular mechanisms underpinning both chemotaxis and galvanotaxis employ Rac1 as a critical mediator of directional responses.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines
Primary human keratinocytes lacking
4 integrin were obtained from a patient with epidermolysis bullosa with pyloric atresia (EB-PA) resulting from a premature termination codon (C658X; Russell et al., 2003
). Neonatal foreskin keratinocytes and EB-PA patient keratinocytes were immortalized with HPV18 E6 and E7 genes (Kaur et al., 1989
) and designated NIK and
4, respectively. Cells were cultured in equal parts defined keratinocyte serum free medium (SFM; Invitrogen, Carlsbad, CA) and keratinocyte medium 154 (Cascade Biologics). Culture media contained 100 IU/ml penicillin and 100 IU/ml streptomycin, and cells were cultured at 37°C in a humidified 5% CO2 incubator.
cDNA Constructs and Vectors
The cloning of the
4 integrin gene (
4+) and the adhesion defective
4 integrin gene (
4+AD) have been described previously (Russell et al., 2003
). The cDNAs for the constitutively active and inactive Rac1 mutants, V12Rac1 and N17Rac1, were a kind gift of Dr. Alan Hall (University College London, United Kingdom) and were cloned as EcoRI fragments into the retroviral expression vector LZRS (Kinsella and Nolan, 1996
) containing the encephalomyocarditis virus (EMCV)-IRES and blasticidin-resistance sequences (Deng et al., 1998
). To generate the
4 integrin construct with a truncated cytoplasmic domain, (
4+CT) the WT
4 integrin cDNA was removed from the LZRS retroviral expression vector by EcoRI digestion and subsequently cloned into the EcoRI site of the pENTR1A vector (Invitrogen). The COOH-terminal region of the
4 cytoplasmic deletion mutant
411217 was obtained by PCR using
4-del (sac)-5' (AGTACTGGATTCAGGGTGACTCCG, sense) and
4-1217+EcoRV-3' (TAGATATCAGTGGGTGCGGCAGGACACCA, antisense) primers and subsequently exchanged with WT
4 in pENTR1A. The reverse primer included a stop codon followed by the EcoRV site. PCR was performed using Takara Ex Taq (Takara, Tokyo, Japan) with the
4 WT cDNA in LZRS as a template. The PCR fragment was cloned into a T-Easy vector (Promega, Madison, WI;
411217 in T-Easy), and its sequence was verified. The SacI/EcoRV fragment from
411217 in T-Easy was ligated into the SacI/EcoRV site within the WT
4 in pENTR1A. Finally,
411217 cDNA was recombined from the pENTR1A to the LZRS retroviral expression vector, including a Gateway cassette, using the LR Clonase II Enzyme mix (Invitrogen) by a recombination reaction.
Retroviral Transduction
Keratinocytes were transduced with retroviral vectors for the stable expression of WT
4 integrin (
4+),
4+AD, V12Rac1, N17Rac1, and
4+CT constructs. Amphotropic retrovirus was produced in modified 293 cells as previously described (Kinsella and Nolan, 1996
). Keratinocytes, 2 x 105, were incubated in serum-free medium (SFM) containing 5 µg/ml poybrene for 15 min before infection. Medium was removed and 10 ml of retroviral supernatant containing 5 µg/ml polybrene (Sigma, St. Louis, MO) was added to both viral supernatant and keratinocyte media. Medium was removed, and 4 ml of retroviral supernatant was added. Plates were centrifuged at 300 x g for 1 h at 32°C using a Beckman GS-6R centrifuge (Beckman Coulter, Fullerton, CA). Cells were incubated at 37°C for 24 h followed by replacement with fresh SFM and selection with 5 µg/ml blasticidin (Calbiochem, La Jolla, CA). Selection was omitted for primary cell cultures.
Antibodies and Inhibitors
Mouse mAb 3E1 against
4 integrin (immunostaining) and ASC-8 were obtained from Chemicon (Temecula, CA). Mouse mAb ASC-8 is inhibitory to
6
4 attachment and was used in all inhibition assays at 10 µg/ml. Mouse monoclonal anti-vinculin antibody (h-vin-1) was purchased from Sigma. The specific Rac1 inhibitor 553502 was purchased from Calbiochem (San Diego, CA) in solution and used at a concentration of 100 µM.
Cell Treatments
Cells were starved of growth factors in basal medium (Epilife containing antibiotics [100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin]) for 16 h, before plating for galvanotaxis studies. Cells were plated in the presence or absence of epidermal growth factor (EGF; Invitrogen), 2 ng/ml for 3 h before EF application. ASC-8 was added to the cells for 10 min before plating. Cells were preincubated with the Rac1 inhibitor for 30 min before EF application. Galvanotaxis was performed in the presence or absence of EGF, ASC-8, or 553502.
Galvanotaxis
The galvanotaxis chamber construction and DC application were performed as described previously (Pullar and Isseroff, 2005
). Briefly, the galvanotaxis chamber is composed of a rectangular Plexiglas frame with two medium reservoirs on opposite sides to which a 45 x 50-mm piece of No. 1.5 glass coverslip is attached to form the chamber bottom. This allows for continuous observation of the plated cells on an inverted microscope. Keratinocytes, 2 x 104, are plated onto the collagen-coated center of the chamber between two 25 x 10-mm coverslip spacers and allowed to attach for 3 h at 37°C. A third 25-mm2 coverslip is placed on top, straddling the two spacer coverslips and covering the cells plated on the collagen-coated center panel. This third coverslip rests
100105 µm above the center panel and is sealed on top of the spacer coverslips with silicone high-vacuum grease (Dow Corning, Midland, MI). This small height is chosen to minimize the cross-sectional area through which current flows. A small cross-section creates a high-resistance pathway, resulting in a higher voltage gradient for a fixed current. The aqueduct allows for medium and current flow across the cells. The voltage across the coverslip is measured using a voltmeter via silver-sliver chloride (Ag-AgCl) wire electrodes inserted into both medium reservoirs on either side of the center panel. Six-centimeter-long 2% agar/phosphate-buffered salinefilled pieces of polypropylene tubing connect each end of the chamber to a medium-filled well in which the Ag-AgCl electrodes are placed, to separate possible electrode byproducts from the cells themselves. A 100-mV/mm current is applied across the chamber. The current is measured with an ammeter in series, and we only use chambers for which the current flow is kept below 0.6 mA, to minimize joule heating. Furthermore, temperature of the medium in the chambers is maintained at 36°C by placing the chamber on a metal plate heated to and maintained at 39°C. The temperature is continuously monitored during the experiment using a YSI 400 analog temperature probe (Yellow Springs Instrument Co., Yellow Springs, OH) directly attached to the metal plate and does not vary by more than 1°C over the course of the experiment.
Time-Course Observation and Data Analysis
The galvanotaxis chambers rest on inverted Nikon microscopes (Melville, NY), and control and test assays were run simultaneously on duplicate setups side by side. Time-lapse images of the cell migratory response are digitally captured every 10 min over a 1-h period by a QImaging Retiga-EX cameras (Burnaby, BC, Canada) controlled by a custom automation written in Improvision Openlab software (Lexington, MA) on a Macintosh G4 (Apple Computer, Cupertino, CA). After each cell's center of mass is tracked using the Openlab software, directionality of migration is calculated and imported to Excel (Microsoft, Redmond, WA). Cosine
describes the direction of migration and is a measure of the persistence of cathodal directedness, where
is the angle between the field axis and the vector drawn by the cell migration path. The average cosine
=
i cos
i/N, where
i is the summation of 50150 individual cells from at least three different cell strains. Angle zero (
= 0°) is assigned to the negative pole (cathode) and increasing angles assigned in a clockwise manner, with q = 180° aligned with the positive pole (anode). Therefore, the cosine
will provide a number between 1 and +1, and the average of all of the separate cell events yields an index of directional migration. For example, if a cell were to move directly to the negative pole, the angle
= 0° and the cosine
= 1. "Cosine," therefore, refers to the average directional migration index of separate cell migration events at the end of a 1-h period. Results are given as average cosine
± the SEM. Significance is taken as p < 0.01, using Student's t test (unpaired) to compare the means of two cell populations.
The rate and directionality of migration can be clearly represented graphically using a polar plot. Each cell is placed at the origin of the circle at time 0, and its final position is plotted as a single point on the graph. The distance of the points from the origin provides an indication of cell migration rate and the distribution of points between the four quadrants indicates the direction of migration. The radius of each graph is 100 µM.
Immunofluorescence Staining and Microscopy
Sterile glass cover slips (Fisher Scientific, Pittsburgh, PA) were transferred into 12-well dishes and collagen-coated with 60 µg/ml collagen I (Vitrogen 100; Collagen, Palo Alto, CA) in KGM for 1 h at 37°C. Coverslips were washed three times with KGM, and 3 x 104 cells were added per well and allowed to attach for 3 h. Coverslips were processed at room temperature unless otherwise noted. Coverslips were washed twice in PBS and fixed for 10 min in 4% paraformaldehyde. Coverslips were washed twice in PBS between each step. Cells were permeabilized for 5 min with 0.1% Triton X-100/PBS and blocked with 5% goat serum/PBS for 20 min. Primary monoclonal anti-
4 integrin antibody (3E1; 1:50) or primary monoclonal anti-vinculin antibody (h-vin-1; 1:100) was added dropwise in 1% goat serum/PBS (1:100) and incubated for 1 h at 37°C. A goat anti-mouse cy3 antibody (Jackson ImmunoResearch Laboratory, West Grove, PA; 1:100) was added in 1% goat serum/PBS for 1 h at 37°C. Standard controls were performed. Coverslips were incubated with the primary antibody alone or the secondary antibody alone to ensure specificity. Finally, Prolong gold anti-fade reagent (Molecular Probes, Eugene, OR) was used according to manufacturer's instructions to mount the coverslips onto glass microscope slides. Slides were viewed on an inverted fluorescent Nikon Diaphot microscope using a 40x pan fluor objective. Images were captured using QImaging Retiga-EX cameras and are presented in gray scale (
4 integrin) or pseudocolored red (vinculin).
| RESULTS |
|---|
|
|
|---|
4 Integrin and EGF Are Required for Keratinocyte Directional Migration
To determine the role that
4 integrin plays in both keratinocyte motility and directional migration within a DC EF, human keratinocyte cell lines lacking the
4 integrin (
4), those in which the
4 integrin has been reexpressed (
4+), or primary human keratinocytes (NHK) were examined for their migratory response in an EF. We have previously demonstrated that the application of a DC EF does not alter the keratinocyte migration rate (Nishimura et al., 1996
; Pullar and Isseroff, 2005
). The absence (
4) or presence (
4+) of
4 integrin appears to have no effect on the rate of cell migration in this system, whereas the application of EGF significantly increases their speed by 81 and 57%, respectively (Figure 1A).
|
4 integrin. The
4 cells, in the absence of EGF, are blinded to the directional stimulus (Figure 1B) and migrate randomly. Reexpression of
4 integrin (
4+) partially (61%) restores directional migration in the absence of EGF, whereas the directional responses of
4 and
4+ cells are both potentiated in the presence of EGF (Figure 1B).
4+ cells are 69% more directional than
4 cells in the presence of EGF. To clearly demonstrate these differences, the rate and directionality of migration for the
4 and
4+ cells are represented graphically using a polar plot as described. Although the distance from the origin of
4 and
4+ cells is similar in the absence of EGF, more cells are present in the top two quadrants in the presence of
4 integrin, demonstrating that reexpression of the
4 integrin partially restores directional migration in
4 cells and fully restores directional migration in
4+ cells (as visualized by the majority of cells plotted in the top two quadrants in polar plot Figure 1C). In primary human keratinocytes (NHK; Figure 1D), EGF also potentiates both motility and directional migration in response to the applied EF. It appears, therefore, that there are at least two distinct but synergistic signaling pathways that can coordinate EF-mediated keratinocyte directional migration, a
4 integrin and an EGF-dependent pathway.
4 Integrin Is Localized to Focal Adhesions within the Keratinocyte Lamellipodium
Actin remodeling plays an important role in cell polarization (Ridley et al., 2003
), essential for chemoattractant-driven (Merlot and Firtel, 2003
) and EF-driven (Zhao et al., 2002
) directional migration and motility (Pantaloni et al., 2001
). Actin filaments terminate in focal adhesions (FAs), signaling centers that mediate the mechanical attachment of cells to the extra cellular matrix (Gilmore and Burridge, 1996
), and regulate gene expression, cell growth, and survival (Sastry and Burridge, 2000
). We reasoned that if the
4 integrin is localized within FAs, then binding to its ligand, laminin 332, could initiate the signaling required for
4 integrinmediated directional migration. We found that after plating on collagen for 3 h, the keratinocytes exhibit
4 integrin staining within linear focal adhesions (identified as vinculin immunopositive structures) localized at the leading edge of the migrating cells (unpublished data), supporting this hypothesis.
Laminin 332-mediated Ligation of
4 Integrin Is Required for Keratinocyte Directional Migration in the Absence of EGF
To determine if ligand binding to laminin 332 was required for the directional response, we expressed an adhesion-defective mutant of
4 integrin that fails to bind laminin 332 (
4+AD) in the
4 cells and observed their migratory response in an applied EF. Loss of adhesion by laminin 332 has no effect on rate of migration in the presence or absence of EGF (unpublished data). In stark contrast, however,
4+AD cells are blinded to the EF in the absence of EGF and migrate randomly (Figure 2A). The inclusion of EGF in the medium recovers some of the directional deficit, as it does in the
4 cells. Indeed, their responses to the EF are very similar to
4 cells (Figure 2A).
|
4+ cells and NHKs with an antibody known to inhibit the attachment of
4 integrin to laminin 332 (ASC-8). The effect of ASC-8 on EF-mediated directional migration of
4+ cells and NHKs is similar. The antibody blinds both
4+ cells and NHKs to the EF in the absence of EGF and they migrate randomly, whereas the ability to sense and respond to the EF is partially restored by EGF to 43 and 54% of the directionality observed for
4+ cells, respectively (Figure 2, B and C).
The Cytoplasmic Tail of
4 Integrin Is Essential for
4 Integrinmediated Keratinocyte Directional Migration in the Absence of EGF
Integrins transmit signals from the extracellular matrix by the association of adapter proteins with their cytoplasmic tails (CT; Giancotti and Ruoslahti, 1999
). Previously, it has been demonstrated that the cytoplasmic tail of
4 integrin is essential for the
6
4-mediated activation of signaling pathways required for the anchorage-independent survival of mammary tumors (Zahir et al., 2003
) and for epidermal growth and wound healing (Nikolopoulos et al., 2005
). To further examine the role of the
4 integrin in EF-mediated directional migration, we expressed a
4 integrin construct lacking a cytoplasmic tail in
4 cells (
4+CT). There was no decrease in the rate of migration between
4+ and
4+CT cells in the absence or presence of EGF (unpublished data), suggesting that the B4 cytoplasmic tail and its downstream signaling are not critical components for motility per se. In contrast, however, the
4+CT cells are unable to sense and respond with directional migration to the EF in the absence of EGF, indicating the requirement of the
4 cytoplasmic tail for the response (Figure 3). Addition of EGF partially rescues the directional response in the
4+CT cells, again suggesting that a second,
4 integrinindependent, EGF-mediated signaling pathway is required for a directional migratory response to an applied EF (Figure 3).
|
4 Integrin- and EGF-mediated Directional Migration in an EF
4 integrinmediated EGF-dependent chemotaxis (Russell et al., 2003
4 integrinmediated or the EGFR-mediated galvanotaxis response, or both. To test this hypothesis, a dominant inhibitory form of Rac1, N17Rac1, was expressed in an immortalized human keratinocyte line (NIK) and N17Rac1 cells were monitored for migration rate and directionality in an applied EF. Expression of N17Rac1 decreases the rate of migration by 26 and 46% in the absence and presence of EGF, respectively (unpublished data). However, NIK-N17Rac1 cells were unable to sense and respond to the applied EF, even in the presence of EGF (Figure 4A). To confirm that Rac1 is essential for both
4 integrin and EGF-mediated directional migration in an EF, we preincubated
4+ cells in a Rac inhibitor (553502) before monitoring motility and directionality. In the presence of the Rac inhibitor, the speed of
4+ cell migration is reduced by 24%, whereas the cells are completely blinded to the EF and migrated randomly (Figure 4B).
|
4 Integrin-Null Cells
4 integrin. For example, expression of a constitutively active Rac mutant (V12Rac1) can sustain the viability of mammary tumors lacking
4 integrin (Zahir et al., 2003
4 cells. There is no significant difference in the rate of migration of
4 and
4-V12Rac1 cells (unpublished data). Although the V12Rac1 cells exhibit partial EF-mediated directional migration in the presence of EGF (35%), the constitutively active Rac mutant is not sufficient to compensate for absence of the
4 integrin (Figure 5).
|
4 Integrinmediated Keratinocyte Directional Migration in the Absence of Laminin 332 Ligation
4 integrin, we wondered if it could compensate for the lack of laminin 332mediated ligation in cells expressing a functional cytoplasmic tail (
4+AD).
4+AD cells have a truncated Rac1 activation profile, similar to
4 cells and fail to sustain lamellipodial induction beyond 20 min (Russell et al., 2003
The expression of the active Rac1 mutant has no effect on migration rate in both the presence and absence of EGF (unpublished data); however,
4+AD cells are now able to fully respond to an applied EF. Indeed, they exhibit a robust directional response in the presence of EGF, and in its absence they are indistinguishable from
4+ cells (Figure 6).
|
| DISCUSSION |
|---|
|
|
|---|
6
4 integrin for regulating cell polarity and maintaining directional migration in response to the cueing signal provided by an applied DC electric field. We demonstrate that although the expression of
4 integrin appears to have no effect on the rate of keratinocyte migration, it is essential for EF-mediated directional migration in the absence of EGF. In the presence of EGF, the signaling pathway initiated by
4 integrin ligandbinding converges with that of EGF receptor activation to initiate and maintain robust, persistent directional (cathodal) migration. Adhesion to laminin 332 and a functional cytoplasmic domain are both required for the
4 integrinmediated directional migratory response, and Rac1 activation is a required downstream element for both
4 integrin and EGF-mediated cathodal directional migration (Figure 7). We believe that this is the first description of a role for
4 integrin in sensing and responding to an EF-mediated directional signal.
|
6
4 (Sonnenberg et al., 1991
3
1 (Carter et al., 1991
3
1-mediated migration and form the foundation of a new basement membrane during reepithelialization (Goldfinger et al., 1999
3
1 interaction with laminin 332 (Lampe et al., 1998
4 integrin, suggesting that laminin-5dependent keratinocyte migration is occurring exclusively via
3
1 in our system.
Previously, we have demonstrated that EGF enhances both keratinocyte motility and EF-mediated directional migration (Fang et al., 1998
), as we also demonstrate here. However, the current studies reveal a novel and absolute requirement for the coordinated action of both EGF and
4 integrin to initiate and maintain robust EF-mediated directional migration. It is known that EGFR and
6
4 integrin cross-talk.
6
4 integrin can physically interact with a number of receptor tyrosine kinases including the EGFR, ErbB-2, Ron, and Met (Falcioni et al., 1997
; Hintermann et al., 2001
; Mariotti et al., 2001
; Trusolino et al., 2001
), and EGF induces tyrosine phosphorylation of the
4 integrin cytoplasmic tail, which has been implicated in hemidesmosome disassembly and epithelial motility (Mainiero et al., 1996
). Additionally, integrin adhesion can result in the phosphorylation of the EGFR on numerous tyrosine residues (Moro et al., 2002
) and can potentiate signaling pathways in response to EGF, PDGF, FGF, VEGF, and insulin (reviewed by (Schwartz and Baron, 1999
). A considerable amount of evidence supports a role for integrin-mediated adhesion in coordinating growth-factormediated responses (reviewed by Cabodi et al., 2004
). Integrin-mediated signaling is required for EGF-dependent proliferation, survival, and migration, demonstrating that a cooperative interaction is necessary to achieve full biological responses (Cabodi et al., 2004
). It appears that
6
4 integrin and EGF also cooperate to support robust keratinocyte directional migration in response to an applied EF cue.
4 integrin has been demonstrated to localize to lamellipodia and filopodia of migrating carcinoma cells and associate with F-actin (Rabinovitz and Mercurio, 1997
). Indeed, inhibition of
6
4 function resulted in the collapse of lamellipodia and filopodia (Rabinovitz and Mercurio, 1997
; Rabinovitz et al., 1999
).
6
4 has also been localized to actin-containing structures in keratinocytes (Geuijen and Sonnenberg, 2002
; Santoro et al., 2003
; Spinardi et al., 2004
), but we observe its presence in fine linear structures at the leading edge, suggesting that in migrating keratinocytes,
4 integrin becomes incorporated within focal adhesion sites, centers for traction control (Ridley et al., 2003
).
The cytoplasmic tail of
4 integrin is unique with no known homology to other
subunits. It is unusually long (
1000 amino acids), associates with the hemidesmosome cytoskeleton (Sonnenberg et al., 1991
) via HD 1/plectin (Nievers et al., 2000
) and contains a tyrosine activation motif (TAM) that can facilitate the docking of src homology 2 (SH2) domains while phosphorylated. In primary keratinocytes both Shc and Grb2 are recruited to the
4 integrinphosphorylated TAM sequentially activating MAP kinase pathways and promoting proliferation (Mainiero et al., 1995
, 1997
). Furthermore,
6
4 can activate phosphoinositide 3-kinase (PI3-K), increasing the invasive capacity of breast and colon carcinoma cells (Shaw et al., 1997
).
The loss of the
4 integrin cytoplasmic tail has a negative effect on the ability of the cells to sense and respond to the applied EF in the absence of EGF.
4+CT-expressing cells are blinded to the applied EF and migrate randomly, reminiscent of
4+AD cells. It appears that a fully functional
4 integrin ligand-binding domain and a fully functional
4 integrin cytoplasmic tail are both required in order for keratinocytes to respond to an applied EF in the absence of EGF and respond robustly in the presence of EGF. This suggests that in the absence of EGF, ligation of
4 integrin by laminin 332 transmits a signal via its cytoplasmic tail to initiate and respond to an applied EF, allowing the cell to form a new lamellipodium facing the cathode, turn, and migrate directionally.
The ability of a cell to respond to an applied EF requires the formation of a new lamellipodium facing the cathode. Rac1 plays a role in lamellipodial formation (Hall, 1998
) and expression of a constitutively active Rac1 mutant accelerates cutaneous wound repair (Hassanain et al., 2005
). Previously, it has been demonstrated that
4 integrin can activate the PI3 kinase signaling pathway (Shaw et al., 1997
; Gambaletta et al., 2000
; Shaw, 2001
) resulting in Rac1 activation (Shaw et al., 1997
). Our studies highlight Rac1 as a critical convergence point and pivotal regulator of both
4 integrin and EGF-mediated keratinocyte galvanotaxis, coordinating the signals to allow cells to migrate directionally in response to the applied EF. Although the expression of a dominant negative Rac1 mutant or the application of a specific Rac inhibitor slows keratinocyte migration, it prevents galvanotaxis in both the presence and absence of EGF. Importantly, we demonstrate that
4 integrin expression is essential for keratinocytes to sense and respond to an EF with robust directional migration, because a constitutively active Rac1 mutant cannot restore directional migration in cells lacking
4 integrin expression. Meanwhile, expression of the constitutively active Rac1 mutant in cells expressing adhesion-defective
4 integrin has no effect on migration rate but fully restores keratinocyte galvanotaxis. It has been suggested that while growth factors can activate Rac globally within the cell, integrins determine the specific locality where Rac will bind to its effectors, thus determining where to extend lamellipodia, facilitating directional migration (Del Pozo et al., 2002
; Grande-Garcia et al., 2005
). Although lamellipodial formation is absent in Rac1 genetic null cells (Vidali et al., 2006
), a partial, rather than total, decrease in levels can actually increase persistent directional motility by suppressing peripheral and sustaining dominant lamellipodial formation (Pankov et al., 2005
). Indeed, here it appears that
4 integrin coordinates with EGF to localize Rac1 activation to the dominant lamellipodium, initiate and maintain Rac1-dependent persistent directional migration in response to EF cueing.
In conclusion, we describe a role for
6
4 integrin in sustaining directional migration in keratinocytes in response to an applied EF and demonstrate that the cooperative interaction of both EGF and
4 integrin is necessary to achieve the full biological response of EF-mediated directional migration. Rac1 is critical for both EGF-mediated and
4 integrinmediated keratinocyte directional migration in an applied EF as well as in EGF-driven chemotaxis (Russell et al., 2003
). Perhaps underpinning the role of
4 integrin in directional migration is its ability to regulate cell turning or mediate stabilization of the site at which the new lamellipodium will form to allow migration in the direction of the applied gradient. Studying EF-induced directional migration will improve our understanding of directional sensing and the signaling mechanisms required for these biological processes that play important roles in embryonic development, inflammation, tumor metastasis, and wound repair.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present addresses:
Department of Cell Physiology and Pharmacology, University of Leicester, Leicester LE1 9HN, United Kingdom; ![]()
Molecular and Cellular Biology, Cytokinetics Inc., 280 East Grand Avenue, South San Francisco, CA 94080; ![]()
|| Department of Pathology, Columbia University College of Physicians and Surgeons, New York, NY 11032. ![]()
Address correspondence to: R. Rivkah Isseroff (rrisseroff{at}ucdavis.edu)
| REFERENCES |
|---|
|
|
|---|
Borgens, R. B., Vanable, J. W. Jr, Jaffe, L. F. (1977). Bioelectricity and regeneration: large currents leave the stumps of regenerating newt limbs. Proc. Natl. Acad. Sci. USA 74, 45284532.
Cabodi, S., Moro, L., Bergatto, E., Boeri Erba, E., Di Stefano, P., Turco, E., Tarone, G., Defilippi, P. (2004). Integrin regulation of epidermal growth factor (EGF) receptor and of EGF-dependent responses. Biochem. Soc. Trans 32, 438442.[CrossRef][Medline]
Carter, W. G., Ryan, M. C., Gahr, P. J. (1991). Epiligrin, a new cell adhesion ligand for integrin alpha 3 beta 1 in epithelial basement membranes. Cell 65, 599610.[CrossRef][Medline]
Chiang, M., Robinson, K. R., Vanable, J. W. Jr. (1992). Electrical fields in the vicinity of epithelial wounds in the isolated bovine eye. Exp. Eye Res 54, 9991003.[CrossRef][Medline]
Del Pozo, M. A., Kiosses, W. B., Alderson, N. B., Meller, N., Hahn, K. M., Schwartz, M. A. (2002). Integrins regulate GTP-Rac localized effector interactions through dissociation of Rho-GDI. Nat. Cell Biol 4, 232239.[CrossRef][Medline]
Deng, H., Choate, K. A., Lin, Q., Khavari, P. A. (1998). High-efficiency gene transfer and pharmacologic selection of genetically engineered human keratinocytes. Biotechniques 25, 274280.[Medline]
Devreotes, P. N. and Zigmond, S. H. (1988). Chemotaxis in eukaryotic cells: a focus on leukocytes and Dictyostelium. Annu. Rev. Cell Biol 4, 649686.[CrossRef][Medline]
Falcioni, R., Antonini, A., Nistico, P., Di Stefano, S., Crescenzi, M., Natali, P. G., Sacchi, A. (1997). Alpha 6 beta 4 and alpha 6 beta 1 integrins associate with ErbB-2 in human carcinoma cell lines. Exp. Cell Res 236, 7685.[CrossRef][Medline]
Fang, K. S., Farboud, B., Nuccitelli, R., Isseroff, R. R. (1998). Migration of human keratinocytes in electric fields requires growth factors and extracellular calcium. J. Invest. Dermatol 111, 751756.[CrossRef][Medline]
Fang, K. S., Ionides, E., Oster, G., Nuccitelli, R., Isseroff, R. R. (1999). Epidermal growth factor receptor relocalization and kinase activity are necessary for directional migration of keratinocytes in DC electric fields. J. Cell Sci 112, 19671978.[Abstract]
Frank, D. E. and Carter, W. G. (2004). Laminin 5 deposition regulates keratinocyte polarization and persistent migration. J. Cell Sci 117, 13511363.
Gambaletta, D., Marchetti, A., Benedetti, L., Mercurio, A. M., Sacchi, A., Falcioni, R. (2000). Cooperative signaling between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote phosphatidylinositol 3-kinase-dependent invasion. J. Biol. Chem 275, 1060410610.
Geuijen, C. A. and Sonnenberg, A. (2002). Dynamics of the alpha6beta4 integrin in keratinocytes. Mol. Biol. Cell 13, 38453858.
Giancotti, F. G. and Ruoslahti, E. (1999). Integrin signaling. Science 285, 10281032.
Gilmore, A. P. and Burridge, K. (1996). Molecular mechanisms for focal adhesion assembly through regulation of protein-protein interactions. Structure 4, 647651.[Medline]
Goldfinger, L. E., Hopkinson, S. B., deHart, G. W., Collawn, S., Couchman, J. R., Jones, J. C. (1999). The alpha3 laminin subunit, alpha6beta4 and alpha3beta1 integrin coordinately regulate wound healing in cultured epithelial cells and in the skin. J. Cell Sci 112, Pt 1626152629.[Abstract]
Grande-Garcia, A., Echarri, A., Del Pozo, M. A. (2005). Integrin regulation of membrane domain trafficking and Rac targeting. Biochem. Soc. Trans 33, 609613.[CrossRef][Medline]
Hall, A. (1998). Rho GTPases and the actin cytoskeleton. Science 279, 509514.
Hassanain, H. H., Irshaid, F., Wisel, S., Sheridan, J., Michler, R. E., Goldschmidt-Clermont, P. J. (2005). Smooth muscle cell expression of a constitutive active form of human Rac 1 accelerates cutaneous wound repair. Surgery 137, 92101.[CrossRef][Medline]
Hintermann, E., Bilban, M., Sharabi, A., Quaranta, V. (2001). Inhibitory role of alpha 6 beta 4-associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on alpha 3 beta 1 integrin. J. Cell Biol 153, 465478.
Isseroff, R. R., Ziboh, V. A., Chapkin, R. S., Martinez, D. T. (1987). Conversion of linoleic acid into arachidonic acid by cultured murine and human keratinocytes. J. Lipid Res 28, 13421349.[Abstract]
Kaur, P., McDougall, J. K., Cone, R. (1989). Immortalization of primary human epithelial cells by cloned cervical carcinoma DNA containing human papillomavirus type 16 E6/E7 open reading frames. J. Gen. Virol 70, Pt 512611266.
Kinsella, T. M. and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene. Ther 7, 14051413.[Medline]
Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J., Takada, Y., Carter, W. G. (1998). Cellular interaction of integrin alpha3beta1 with laminin 5 promotes gap junctional communication. J. Cell Biol 143, 17351747.
Li, J., Lin, M. L., Wiepz, G. J., Guadarrama, A. G., Bertics, P. J. (1999). Integrin-mediated migration of murine B82L fibroblasts is dependent on the expression of an intact epidermal growth factor receptor. J. Biol. Chem 274, 1120911219.
Mainiero, F., Murgia, C., Wary, K. K., Curatola, A. M., Pepe, A., Blumemberg, M., Westwick, J. K., Der, C. J., Giancotti, F. G. (1997). The coupling of alpha6beta4 integrin to Ras-MAP kinase pathways mediated by Shc controls keratinocyte proliferation. EMBO J 16, 23652375.[CrossRef][Medline]
Mainiero, F., Pepe, A., Wary, K. K., Spinardi, L., Mohammadi, M., Schlessinger, J., Giancotti, F. G. (1995). Signal transduction by the alpha 6 beta 4 integrin: distinct beta 4 subunit sites mediate recruitment of Shc/Grb2 and association with the cytoskeleton of hemidesmosomes. EMBO J 14, 44704481.[Medline]
Mainiero, F., Pepe, A., Yeon, M., Ren, Y., Giancotti, F. G. (1996). The intracellular functions of alpha6beta4 integrin are regulated by EGF. J. Cell Biol 134, 241253.
Marikovsky, M., Breuing, K., Liu, P. Y., Eriksson, E., Higashiyama, S., Farber, P., Abraham, J., Klagsbrun, M. (1993). Appearance of heparin-binding EGF-like growth factor in wound fluid as a response to injury. Proc. Natl. Acad. Sci. USA 90, 38893893.
Marinkovich, M. P., Lunstrum, G. P., Keene, D. R., Burgeson, R. E. (1992). The dermal-epidermal junction of human skin contains a novel laminin variant. J. Cell Biol 119, 695703.
Mariotti, A., Kedeshian, P. A., Dans, M., Curatola, A. M., Gagnoux-Palacios, L., Giancotti, F. G. (2001). EGF-R signaling through Fyn kinase disrupts the function of integrin alpha6beta4 at hemidesmosomes: role in epithelial cell migration and carcinoma invasion. J. Cell Biol 155, 447458.
Martin, P. (1997). Wound healingaiming for perfect skin regeneration. Science 276, 7581.
McCaig, C. D., Rajnicek, A. M., Song, B., Zhao, M. (2005). Controlling cell behavior electrically: current views and future potential. Physiol. Rev 85, 943978.
McGinnis, M. E. and Vanable, J. W. Jr. (1986). Voltage gradients in newt limb stumps. Prog. Clin. Biol. Res 210, 231238.[Medline]
Merlot, S. and Firtel, R. A. (2003). Leading the way: Directional sensing through phosphatidylinositol 3-kinase and other signaling pathways. J. Cell Sci 116, 34713478.
Miyamoto, S., Teramoto, H., Gutkind, J. S., Yamada, K. M. (1996). Integrins can collaborate with growth factors for phosphorylation of receptor tyrosine kinases and MAP kinase activation: roles of integrin aggregation and occupancy of receptors. J. Cell Biol 135, 16331642.
Moro, L. (2002). Integrin-induced epidermal growth factor (EGF) receptor activation requires c-Src and p130Cas and leads to phosphorylation of specific EGF receptor tyrosines. J. Biol. Chem 277, 94059414.
Nguyen, B. P., Gil, S. G., Carter, W. G. (2000a). Deposition of laminin 5 by keratinocytes regulates integrin adhesion and signaling. J. Biol. Chem 275, 3189631907.
Nguyen, B. P., Ryan, M. C., Gil, S. G., Carter, W. G. (2000b). Deposition of laminin 5 in epidermal wounds regulates integrin signaling and adhesion. Curr. Opin. Cell Biol 12, 554562.[CrossRef][Medline]
Niessen, C. M., van der Raaij-Helmer, M. H., Hulsman, E. H., van der Neut, R., Jonkman, M. F., Sonnenberg, A. (1996). Deficiency of the integrin beta 4 subunit in junctional epidermolysis bullosa with pyloric atresia: consequences for hemidesmosome formation and adhesion properties. J. Cell Sci 109, Pt 71695706.[Abstract]
Nievers, M. G., Kuikman, I., Geerts, D., Leigh, I. M., Sonnenberg, A. (2000). Formation of hemidesmosome-like structures in the absence of ligand binding by the (alpha)6(beta)4 integrin requires binding of HD1/plectin to the cytoplasmic domain of the (beta)4 integrin subunit. J. Cell Sci 113, Pt 696373.[Abstract]
Nikolopoulos, S. N., Blaikie, P., Yoshioka, T., Guo, W., Puri, C., Tacchetti, C., Giancotti, F. G. (2005). Targeted deletion of the integrin beta4 signaling domain suppresses laminin-5-dependent nuclear entry of mitogen-activated protein kinases and NF-kappaB, causing defects in epidermal growth and migration. Mol. Cell. Biol 25, 60906102.
Nishimura, K. Y., Isseroff, R. R., Nuccitelli, R. (1996). Human keratinocytes migrate to the negative pole in direct current electric fields comparable to those measured in mammalian wounds. J. Cell Sci 109, 199207.[Abstract]
O'Toole, E. A., Marinkovich, M. P., Hoeffler, W. K., Furthmayr, H., Woodley, D. T. (1997). Laminin-5 inhibits human keratinocyte migration. Exp. Cell Res 233, 330339.[CrossRef][Medline]
Ojingwa, J. C. and Isseroff, R. R. (2003). Electrical stimulation of wound healing. J. Invest. Dermatol 121, 112.[CrossRef][Medline]
Pankov, R., Endo, Y., Even-Ram, S., Araki, M., Clark, K., Cukierman, E., Matsumoto, K., Yamada, K. M. (2005). A Rac switch regulates random versus directionally persistent cell migration. J. Cell Biol 170, 793802.
Pantaloni, D., Le Clainche, C., Carlier, M. F. (2001). Mechanism of actin-based motility. Science 292, 15021506.
Pullar, C. E., Grahn, J. C., Liu, W., Isseroff, R. R. (2006). Beta2-adrenergic receptor activation delays wound healing. FASEB J 20, 7686.
Pullar, C. E. and Isseroff, R. R. (2005). Cyclic AMP mediates keratinocyte directional migration in an electric field. J. Cell Sci 118, 20232034.
Pullar, C. E., Isseroff, R. R., Nuccitelli, R. (2001). Cyclic AMP-dependent protein kinase A plays a role in the directed migration of human keratinocytes in a DC electric field. Cell Motil. Cytoskelet 50, 207217.[CrossRef][Medline]
Rabinovitz, I. and Mercurio, A. M. (1997). The integrin alpha6beta4 functions in carcinoma cell migration on laminin-1 by mediating the formation and stabilization of actin-containing motility structures. J. Cell Biol 139, 18731884.
Rabinovitz, I., Toker, A., Mercurio, A. M. (1999). Protein kinase C-dependent mobilization of the alpha6beta4 integrin from hemidesmosomes and its association with actin-rich cell protrusions drive the chemotactic migration of carcinoma cells. J. Cell Biol 146, 11471160.
Raymond, K., Kreft, M., Janssen, H., Calafat, J., Sonnenberg, A. (2005). Keratinocytes display normal proliferation, survival and differentiation in conditional beta4-integrin knockout mice. J. Cell Sci 118, 10451060.
Rheinwald, J. G. and Green, H. (1975). Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell 6, 331343.[CrossRef][Medline]
Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T., Horwitz, A. R. (2003). Cell migration: integrating signals from front to back. Science 302, 17041709.
Russell, A. J., Fincher, E. F., Millman, L., Smith, R., Vela, V., Waterman, E. A., Dey, C. N., Guide, S., Weaver, V. M., Marinkovich, M. P. (2003). Alpha 6 beta 4 integrin regulates keratinocyte chemotaxis through differential GTPase activation and antagonism of alpha 3 beta 1 integrin. J. Cell Sci 116, 35433556.
Ryan, M. C., Christiano, A. M., Engvall, E., Wewer, U. M., Miner, J. H., Sanes, J. R., Burgeson, R. E. (1996). The functions of laminins: lessons from in vivo studies. Matrix Biol 15, 369381.[CrossRef][Medline]
Ryan, M. C., Lee, K., Miyashita, Y., Carter, W. G. (1999). Targeted disruption of the LAMA3 gene in mice reveals abnormalities in survival and late stage differentiation of epithelial cells. J. Cell Biol 145, 13091323.
Santoro, M. M., Gaudino, G., Marchisio, P. C. (2003). The MSP receptor regulates alpha6beta4 and alpha3beta1 integrins via 14-3-3 proteins in keratinocyte migration. Dev. Cell 5, 257271.[CrossRef][Medline]
Sastry, S. K. and Burridge, K. (2000). Focal adhesions: a nexus for intracellular signaling and cytoskeletal dynamics. Exp. Cell Res 261, 2536.[CrossRef][Medline]
Schwartz, M. A. and Baron, V. (1999). Interactions between mitogenic stimuli, or, a thousand and one connections. Curr. Opin. Cell Biol 11, 197202.[CrossRef][Medline]
Shang, M., Koshikawa, N., Schenk, S., Quaranta, V. (2001). The LG3 module of laminin-5 harbors a binding site for integrin alpha3beta1 that promotes cell adhesion, spreading, and migration. J. Biol. Chem 276, 3304533053.
Shaw, L. M. (2001). Identification of insulin receptor substrate 1 (IRS-1) and IRS-2 as signaling intermediates in the alpha6beta4 integrin-dependent activation of phosphoinositide 3-OH kinase and promotion of invasion. Mol. Cell. Biol 21, 50825093.
Shaw, L. M., Rabinovitz, I., Wang, H. H., Toker, A., Mercurio, A. M. (1997). Activation of phosphoinositide 3-OH kinase by the alpha6beta4 integrin promotes carcinoma invasion. Cell 91, 949960.[CrossRef][Medline]
Sonnenberg, A., et al. (1991). Integrin alpha 6/beta 4 complex is located in hemidesmosomes, suggesting a major role in epidermal cell-basement membrane adhesion. J. Cell Biol 113, 907917.
Spinardi, L., Rietdorf, J., Nitsch, L., Bono, M., Tacchetti, C., Way, M., Marchisio, P. C. (2004). A dynamic podosome-like structure of epithelial cells. Exp. Cell Res 295, 360374.[CrossRef][Medline]
Sta Iglesia, D. D., Cragoe, E. J. Jr, Vanable, J. W. Jr. (1996). Electric field strength and epithelization in the newt (Notophthalmus viridescens). J. Exp. Zool 274, 5662.[CrossRef][Medline]
Sta Iglesia, D. D. and Vanable, J. W. Jr. (1998). Endogenous lateral electric fields around bovine corneal lesions are necessary for and can enhance normal rates of wound healing. Wound Repair Regen 6, 531542.[CrossRef][Medline]
Sun, C. X., Downey, G. P., Zhu, F., Koh, A. L., Thang, H., Glogauer, M. (2004). Rac1 is the small GTPase responsible for regulating the neutrophil chemotaxis compass. Blood 104, 37583765.
Trollinger, D. R., Isseroff, R. R., Nuccitelli, R. (2002). Calcium channel blockers inhibit galvanotaxis in human keratinocytes. J. Cell. Physiol 193, 19.[CrossRef][Medline]
Trusolino, L., Bertotti, A., Comoglio, P. M. (2001). A signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell 107, 643654.[CrossRef][Medline]
van der Neut, R., Krimpenfort, P., Calafat, J., Niessen, C. M., Sonnenberg, A. (1996). Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nat. Genet 13, 366369.[CrossRef][Medline]
Vidali, L., Chen, F., Cicchetti, G., Ohta, Y., Kwiatkowski, D. J. (2006). Rac1-null mouse embryonic fibroblasts are motile and respond to platelet-derived growth factor. Mol. Biol. Cell 17, 23772390.
Zahir, N., Lakins, J. N., Russell, A., Ming, W., Chatterjee, C., Rozenberg, G. I., Marinkovich, M. P., Weaver, V. M. (2003). Autocrine laminin-5 ligates alpha6beta4 integrin and activates RAC and NFkappaB to mediate anchorage-independent survival of mammary tumors. J. Cell Biol 163, 13971407.
Zhang, K. and Kramer, R. H. (1996). Laminin 5 deposition promotes keratinocyte motility. Exp. Cell Res 227, 309322.[CrossRef][Medline]
Zhao, M., Dick, A., Forrester, J. V., McCaig, C. D. (1999). Electric field-directed cell motility involves up-regulated expression and asymmetric redistribution of the epidermal growth factor receptors and is enhanced by fibronectin and laminin. Mol. Biol. Cell 10, 12591276.
Zhao, M., Jin, T., McCaig, C. D., Forrester, J. V., Devreotes, P. N. (2002). Genetic analysis of the role of G protein-coupled receptor signaling in electrotaxis. J. Cell Biol 157, 921927.
Zigmond, S. H. (1977). Ability of polymorphonuclear leukocytes to orient in gradients of chemotactic factors. J. Cell Biol 75, 606616.
This article has been cited by other articles:
![]() |
K. J. Hamill, S. B. Hopkinson, P. DeBiase, and J. C.R. Jones BPAG1e Maintains Keratinocyte Polarity through {beta}4 Integrin-mediated Modulation of Rac 1 and Cofilin Activities Mol. Biol. Cell, June 15, 2009; 20(12): 2954 - 2962. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lu, K. Simin, A. Khan, and A. M. Mercurio Analysis of Integrin {beta}4 Expression in Human Breast Cancer: Association with Basal-like Tumors and Prognostic Significance Clin. Cancer Res., February 15, 2008; 14(4): 1050 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pu, C. D. McCaig, L. Cao, Z. Zhao, J. E. Segall, and M. Zhao EGF receptor signalling is essential for electric-field-directed migration of breast cancer cells J. Cell Sci., October 1, 2007; 120(19): 3395 - 3403. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||