![]() |
|
|
Vol. 17, Issue 12, 5105-5114, December 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
*Department of Genetics,
Case Comprehensive Cancer Center, and
Center for RNA Molecular Biology, School of Medicine, Case Western Reserve University, Cleveland, OH 44106
Submitted February 3, 2006;
Revised September 8, 2006;
Accepted September 29, 2006
Monitoring Editor: Peter Walter
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Although recent studies have provided exciting insight into the distinct functions played by individual alternatively spliced protein isoforms during neuronal development, understanding of the regulatory mechanisms that control neuron-specific alternative splicing remains very limited. Despite the extensive nature of alternative splicing in the nervous system, only a small number of factors involved in regulation of alternative splicing in the nervous system of mammals have been identified and even fewer characterized (Black and Grabowski, 2003
). These factors include classical RRM-containing proteins such as nPTB/brPTB, NAPOR/CUGBP2, and Fox-1/Fox-2; KH-type proteins such as Nova; and the STAR/GRG family proteins such as QK1 (Ashiya and Grabowski, 1997
; Zhang et al., 1999
; Jensen et al., 2000
; Markovtsov et al., 2000
; Polydorides et al., 2000
; Wu et al., 2002
; Zhang et al., 2002
; Dredge and Darnell, 2003
; Ule et al., 2003
; Underwood et al., 2005
). All of these factors function by binding to their cognate target sequences on the pre-mRNA molecules and by modulating splicing of neuron-specifically processed exons either positively or negatively. In most cases, it is not clear how these factors interact with the basic splicing machinery to modulate splicing; however, one recent report demonstrated elegantly that the PTB protein blocks entry of U2AF into the presplicesomal E complex, thereby suppressing inclusion of the neuron-specific c-src N1 exon in nonneuronal cells; suppression is relieved in neuronal cells by the replacement of the ubiquitous form of PTB with a different form of PTB, nPTB/brPTB (Sharma et al., 2005
). A clue to how alternative splicing regulates brain-specific functions came from a study by Ule and colleagues, in which they provided compelling evidence to support the existence of a multi-tiered network regulated by Nova. They demonstrated that, in a coordinated manner, Nova regulates the exon content of RNAs encoding a large number of proteins that interact in the synapse, which accounts for 7% of the brain-specific alternative splicing in the neocortex (Ule et al., 2005
).
Mammalian Hu proteins are a group of RNA-binding proteins consisting of four family members: HuA (HuR in human), HuB (HelN1 in human), HuC, and HuD. Similar to Nova1 and Nova2, which are autoimmune targets in paraneoplastic opsoclonus myoclonus ataxia (Buckanovich et al., 1996
), HuD was originally cloned by screening a cerebellar expression library by using antisera from patients with paraneoplastic encephalomyelitis, one form of paraneoplatic syndrome in which Hu proteins are the autoimmune antigens (Szabo et al., 1991
). All three neuron-specific members of the Hu family, HuB, HuC, and HuD, were shown to be autoimmune antigens of the Hu syndrome (Posner and Dalmau, 1997
). Several in vivo and in vitro experiments indicate an important role of neuron-specific Hu proteins in neuronal differentiation (Wakamatsu and Weston, 1997
; Akamatsu et al., 1999
, 2005
; Anderson et al., 2000
). At the molecular level, all members of the Hu protein family, including HuA (HuR) have been shown to play important roles in the cytoplasm. They interact with AU-rich elements (AREs) in 3'-untranslated regions (UTRs) to regulate mRNA stability (Jain et al., 1997
; Myer et al., 1997
; Anderson et al., 2000
); the human HuB and HuD proteins have also been shown to modulate translation (Antic et al., 1999
; Kullmann et al., 2002
).
Despite evidence of nuclear-cytoplasmic shuttling (Fan and Steitz, 1998
; Burry and Smith, 2006
) and the predominant nuclear localization (Okano and Darnell, 1997
), none of the Hu proteins have been reported to have a nuclear function. However, in Drosophila, the Hu protein homologue, the embryonic lethal abnormal visual (ELAV) protein, has been shown to have a very important function in the nucleus. ELAV regulates alternative pre-mRNA processing in neurons (Lisbin et al., 2001
; Soller and White, 2003
, 2005
). Although the idea that Hu proteins may regulate alternative splicing in mammalian neurons seemed extremely promising, it remains a mystery whether Hu proteins can function as splicing regulators, because no target sequence of Hu proteins as alternative splicing regulators has been identified. In this report, we describe our finding of the first such target of Hu proteins, the human calcitonin/calcitonin gene-related peptide (CGRP) pre-mRNA.
Calcitonin/CGRP pre-mRNA represents one of many RNA transcripts that undergo neuron-specific regulation of alternative RNA processing. In a subset of neurons, the six exon-containing calcitonin/CGRP pre-mRNA is processed to skip the alternative 3'-terminal exon 4, leading to the production of the neurotransmitter CGRP, in contrast to thyroid C cells where this exon is included and exons 5 and 6 are skipped leading to the production of the peptide hormone calcitonin (Figure 1A) (Rosenfeld et al., 1982
). Previous studies demonstrated that the rate-limiting step for processing the calcitonin/CGRP pre-mRNA is the decision about whether to include or exclude the nonneuronal exon 4, which contains suboptimal RNA processing signals (Bovenberg et al., 1986
; Adema et al., 1990
). An enhancer element located downstream of exon 4 was demonstrated to promote inclusion of the exon partly through enhancing polyadenylation (Lou et al., 1996
). Although it was speculated that neuron-specific factors exist to regulate the CGRP-specific pathway (Leff et al., 1987
; Roesser et al., 1993
), previous studies have only identified a number of factors that affect the nonneuronal pathway (Lou and Gagel, 1999
; Tran et al., 2003
; Tran and Roesser, 2003
; Zhu et al., 2003
; Roesser, 2004
).
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
To generate cDNA sequences of the mouse HuB and HuC, reverse transcription (RT)-PCR was carried out using RNA isolated from the mouse F9 cells and mHuB- or mHuC-specific oligonucleotides (5'-GCGGATCCAATGGAAACACAACTGTCTAA and 5'-GCGAATTCTTAGGCTTTGTGCGTTTTGTT for mHuB and 5'-GCGGATCCAATGGTCACTCAGATACTGGG and 5'-GCGAATTCTCAGGCCTTGTGCTGCTTGC for mHuC). The PCR products were digested with BamHI and EcoRI and cloned into the BamHI and EcoRI sites in the pGEX-2TK (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) vector for glutathione S-transferase (GST) recombinant proteins production or the BamHI-EcoRI sites in the pcDNA3.1HisB (Invitrogen, Carlsbad, CA) vector for mammalian cell transfection. Truncated mHuC constructs were generated by similar PCR-directed cloning. mHuC RRM12 and mHuC RRM3 were created using oligonucleotide pairs 5'-GCGGATCCAATGGAAACACAACTGTCTAA and 5'-GAATTCGTTTGCGAACTTGACCGT, and 5'-GCGGATCCAAAGACAGGGCAGGCCCTGCT and 5'-GCGAATTCTCAGGCCTTGTGCTGCTTGC, respectively. The TIA-1-Rev and HuC-Rev plasmids were constructed by PCR amplifying TIA-1 or HuC and inserting the PCR product into the SphI and BglII sites of the PC12-Rev vector (a gift from Dr. Christine Herrmann, Baylor College of Medicine, Houston, TX). All of these plasmids were verified by DNA sequencing.
Cell Culture, P19 Differentiation, and Cell Transfection
HeLa, Chinese hamster ovary (CHO), F9, PC12 TT, SK-N-SH, and P19 cell lines were maintained according to instructions from American Type Culture Collection (Manassas, VA). CA77 cells, a cell line derived from rat medullary thyroid carcinoma (a gift from Drs. Alison Hall at Case Western Reserve University, Cleveland, OH, and Andrew Russo, University of Iowa, Iowa City, IA) were cultured in DMEM/F-12 (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) and 1% Pen/Strep (Invitrogen). For differentiation of P19 cells, cells were aggregated in bacterial culture dishes and either untreated or treated with 0.3 µM all-trans retinoid acid (Sigma-Aldrich, St. Louis, MO) or 1% dimethyl sulfoxide (DMSO) for 4 d and then plated in tissue culture dishes. Transfection of differentiated P19 cells was carried out 48 h after the cells were transferred to tissue culture dishes by using Lipofectamine (Invitrogen), and cells were collected 4 d after transfection for analysis. HeLa cells were transfected as described previously (Zhu et al., 2003
). Transfection of CA77 cells was carried out essentially the same as HeLa cells except that Lipofectamine 2000 (Invitrogen) was used, and cells were grown for 72 h before and after transfection. Cotransfections used 1 µg of the calcitonin/CGRP reporter plasmid and either 0.20.4 µg of TIA-1, Rev, TIA-1-Rev or HuC-Rev plasmids, or 12 µg of mHuC RRM12 or mHuC RRM3 plasmids.
RNA and Protein Analysis
Procedures for total RNA and protein isolation and RT-PCR analysis were described previously (Zhu et al., 2003
). Use of low cycle (1822) PCR permitted determination of the relative abundance of individual RNA species. Quantification of exon inclusion was determined using a PhosphorImager (GE Healthcare). The results shown are representative of at least three independent transfections for each experiment. The effect of TIA-1, Rev, TIA-1-Rev, HuC-Rev, mHuC RRM12, or mHuC RRM3 on RNA processing of the reporter pre-mRNA was calculated as percentage of the calcitonin exon inclusion [calcitonin exon inclusion/(calcitonin exon inclusion + CGRP exon inclusion)]. Western blot analysis using the proteins isolated from the untransfected or transfected cells was carried out with anti-Xpress antibody (Invitrogen) or anti-TIA-1/TIAR antibody (3E6) (Zhu et al., 2003
) and anti-Hu sera (a gift from Dr. Jerome Posner, Sloan Kettering Cancer Center, New York, NY). Because it is difficult to detect overexpressed proteins in CA77 cells due to the extremely low transfection efficiency, protein expression of Rev, TIA-1-Rev, mHuC-Rev, mHuC RRM12, and mHuC RRM3 was verified using HeLa cells.
In Vitro Assays
UV cross-linking reactions were carried out as described previously (Zhu et al., 2003
). Cross-linked polypeptides were immunoprecipitated using monoclonal antibodies against TIA-1 and TIAR (3E6) or anti-Hu sera. Gel-shift assays were performed using recombinant GST-TIAR or His-HuD prepared from bacteria and in vitro-transcribed RNA substrates. The reactions were described previously (Zhu et al., 2003
).
Immunoprecipitation of CA77 Nuclear Extract and RT-PCR Analysis
Eight hundred micrograms of CA77 cell nuclear extract proteins was immunoprecitated with anti-Hu sera in NET supplemented with RNase Out (Invitrogen). The pellet was washed five times in NET (150 mM NaCl, 50 mM Tris, pH 7.5, and 0.05% NP-40), treated with proteinase K, and extracted with phenol/chloroform, followed by RNA precipitation. RT-PCR was carried out as described previously (Zhu et al., 2003
). Oligonucleotides used for RT-PCR were TTAGCCCCGGAGGTTAAGCA and TTGATGCCACCTCTGAGCCT for calcitonin/CGRP (both in intron 4) and ACCTCCAAACTGAAGAGC and TGGCAGGTTTCTCCAGGCGGC for rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (in intron 3 and exon 5, respectively).
Nuclear Extract Preparation from HeLa and CA77 Cells
HeLa cell nuclear extracts were prepared using S3 suspension culture and standard techniques (Zhu et al., 2003
). To make nuclear extracts from CA77 cells, 100 100-mm dishes of monolayer of CA77 cells were collected and used following a standard procedure (Zhu et al., 2003
).
| RESULTS |
|---|
|
|
|---|
Several cell lines have been used in previous studies that recapitulate either the calcitonin- or CGRP-specific RNA processing pathway. In our studies, we use HeLa cells to mimic the calcitonin pathway, and CA77 cells derived from rat medullary thyroid carcinoma (MTC) to mimic the CGRP pathway. HeLa cells do not express the calcitonin/CGRP gene endogenously. However, when transfected with a calcitonin/CGRP reporter construct that contains a fragment of the human calcitonin/CGRP gene extending from the middle of intron 3 to the 3' end of the gene fused with a first exon and half of an intron from the major late transcription unit of adenovirus, these cells process the reporter pre-mRNA in the calcitonin-specific pathway (Figure 1, B and C, lane 1). To examine CGRP-specific processing, we chose CA77 cells in our current study. These cells provide an optimal system for our purposes because although the line is derived from a rat MTC, medullary thyroid carcinoma, the CA77 cells have a neuronal phenotype characterized by neurites and neuronal antigens (Russo et al., 1992
) (Figure 1C, right). Most relevant to us is the endogenous expression of the calcitonin/CGRP gene and the switch from 95% calcitonin to as high as 8090% CGRP mRNA production (Russo et al., 1992
). When CA77 cells are transfected with the reporter construct shown in Figure 1B, processing of the reporter pre-mRNA closely mimics that of the endogenous calcitonin/CGRP, with CGRP-specific processing as the predominant pathway (Figure 1C, lane 2) (Russo et al., 1992
).
To examine the expression level of Hu family members, proteins in the whole cell lysate isolated from eight cell lines were separated on SDS-PAGE and probed with anti-Hu sera derived from patients who suffer from a paraneoplastic syndrome in which Hu proteins are autoimmune antigens. The anti-Hu sera can detect all three neuron-specific Hu proteins (HuB, HuC, and HuD) but not the ubiquitously expressed HuA (HuR) in a Western blot analysis. Strong signals were observed in F9, PC12, TT, CA77, mouse embryonic stem (ES) cells, and SK-N-SH cells, where the CGRP pathway is preferred based on published and unpublished work (Bennett and Amara, 1992
; Russo et al., 1992
; our unpublished data). In contrast, no Hu signals were detected in the HeLa and CHO cells, where the calcitonin pathway is preferred (Figure 2A) (Lou et al., 1996
, 1998
). Expression of a group of generally expressed splicing regulators, TIA-1 and TIAR, did not show significant differences among these cell lines (Figure 2A). In an attempt to further correlate Hu protein expression level and CGRP production, we isolated total RNA from four cell lines that endogenously express both Hu proteins and the calcitonin/CGRP gene and carried out RT-PCR analysis. It is very clear that the highest CGRP expression was observed in the two cell lines that express very high levels of Hu proteins, F9 and mouse ES cells. Note that only one-sixth of the total protein lysate was loaded for these two cell lines in the blot probed with anti-Hu sera. In CA77 and TT cells, where the Hu protein level is much lower, a higher calcitonin expression level was observed (Figure 1A).
|
Hu Proteins and TIA-1/TIAR Compete for Binding to the Same U-rich Sequence Located in a Previously Characterized Intronic Enhancer
Hu proteins have been shown to have strong affinity for U-rich sequences (Chung et al., 1996
). They bind to ARE sequences in the 3'-UTRs of many mRNAs to regulate mRNA stability (Brennan and Steitz, 2001
; Keene, 2001
; Perrone-Bizzozero and Bolognani, 2002
). Previously, we identified a U-tract sequence located in an intronic element downstream of the calcitonin exon 4 and showed that it plays an important role in inclusion of this exon in nonneuronal cells (Lou et al., 1995
). Furthermore, we demonstrated that TIA-1/TIAR proteins bind to the U-tract sequence and promote inclusion of the exon (Zhu et al., 2003
). We hypothesized that in neurons, Hu proteins bind to the same sequence and block access by the TIA-1/TIAR proteins that are also present in neurons (Figure 2A). To determine whether the U-tract sequence is a Hu protein-binding target, UV cross-linking/immunoprecipitation (IP) was carried out in CA77 nuclear extract by using Hu anti-sera derived from patients with Hu syndrome. Hu proteins are abundantly expressed in these cells (Figure 2A). As expected, we detected a strong signal indicative of Hu proteins binding to an RNA substrate containing the U-rich sequence, but not to an RNA containing the mutated sequence (Figure 3, A and B). Note that the same mutations were also shown to abolish the binding of TIA-1/TIAR proteins (Zhu et al., 2003
). The gel mobility shift assay using the same wild-type and mutant RNA substrates showed a result consistent with the UV cross-linking/IP experiment (Figure 3C).
|
|
Tethering of TIA-1 Protein in the Vicinity of the U-Tract in CA77 Cells Promotes Exon 4 Inclusion
Our previous experiments using HeLa cells show that TIA-1/TIAR proteins are required for exon 4 inclusion (Zhu et al., 2003
). Because interaction of TIA-1/TIAR with the U-tract is dramatically reduced in CA77 cells, we reasoned that if we could increase binding of this protein, we might be able to increase exon 4 inclusion in these cells. We first tried to overexpress TIA-1 or TIAR in CA77 cells, but we observed no increase in exon 4 inclusion (our unpublished data). This result was not unexpected because binding of TIA-1/TIAR to the U-tract may remain low in CA77 cells even when the overall protein level is higher due to the presence of endogenous Hu proteins. Next, we took advantage of a well-established fusion protein approach to target TIA-1 to the vicinity of the U-tract sequence. This approach has been successfully used to bring protein factors to RNA targets (Tiley et al., 1992
) and is similar to the MS2-MS2 coat protein fusion approach. We introduced a human immunodeficiency virus RRE immediately upstream of the U-tract of the calcitonin/CGRP reporter gene (Figure 5A) and brought TIA-1 to the sequence through a TIA-1-Rev fusion protein. The introduced RRE sequence contains a minimal, 29-nucleotide single stem-loop structure shown to have strong binding for Rev (Tiley et al., 1992
). The resulting reporter construct behaved like the parental construct in that its pre-mRNA was processed to predominantly skip exon 4 (Figure 5B, lane 1, compare to lane 2 in Figure 1C). However, when a TIA-1-Rev fusion protein construct was cotransfected with the RRE-containing reporter gene, exon 4 inclusion was increased by 2- to 2.5-fold, whereas cotranfection of Rev alone construct did not significantly affect RNA processing of this reporter gene (Figure 5B, lanes 25). As expected, cotransfection of TIA-1 with the RRE-containing reporter did not change the splicing phenotype (our unpublished data). These experiments establish that reduced binding of TIA-1/TIAR at the U-tract sequence is responsible for the low level of exon 4 inclusion in CA77 cells.
|
When we cotransfected a construct containing the mouse HuC RRM3 together with the hinge domain with the calcitonin/CGRP reporter gene into CA77 cells, the production of CGRP was compromised and inclusion of the calcitonin exon was increased by approximately twofold compared with cells transfected without any Hu proteins (Figure 6, A and B, compare lane 1 with lanes 4 and 5. Transfection of the CA77 cells with the mHuC RRM12 construct did not significantly affect inclusion of the calcitonin exon (Figure 6, A and B, compare lane 1 with lanes 2 and 3).
|
Hu Proteins Interact with Endogenously Expressed Calcitonin/CGRP pre-mRNA
We took advantage of the fact that Hu proteins and calcitonin/CGRP are both endogenously expressed in CA77 cells and tested whether they interact in the natural environment of these cells. We immunoprecipitated the Hu protein-containing complex from a CA77 cell nuclear extract by using anti-Hu sera and examined the RNA in the complex by RT-PCR analysis. As shown in Figure 7, significant association of calcitonin/CGRP pre-mRNA was present in the immunoprecipitate, whereas no GAPDH pre-mRNA was brought down. PhosphorImager measurement of radioactivity in the RT-PCR products indicates that 55% of the imput calcitonin/CGRP pre-mRNA was pulled down by the anti- Hu sera. The strong association of Hu proteins and calcitonin/CGRP pre-mRNA supports the role of Hu proteins in regulating the neuron-specific RNA processing of this pre-mRNA.
|
| DISCUSSION |
|---|
|
|
|---|
It seems that the major function of Hu proteins upon binding to the intronic U-tract sequence in neuronal or neuron-like cells, such as CA77 cells, is to block the activity of TIA-1/TIAR proteins, which would otherwise promote the inclusion of the calcitonin exon 4 (Figure 5C). Of particular note is the fact that in the experiment where TIA-1-Rev fusion protein is cotransfected with the RRE-containing reporter construct into CA77 cells, Hu proteins are presumably still able to bind the U-tract immediately downstream of the RRE stem-loop structure. However, such binding does not impact the inclusion of the calcitonin exon if TIA-1-Rev is present. Likewise, increasing amounts of HuC protein did not change the outcome either if TIA-1-Rev is present (Figure 5C).
If the major function of Hu proteins is to block TIA-1 and TIAR proteins, why does the RRM3 domain, but not the RRM1 and RRM2 domains together, have a dominant-negative effect? The lack of a dominant-negative effect by RRM1 and RRM2 can be explained by the fact that this protein, although binding to RNA specifically, has lowered binding affinity as judged by RNA gel-shift analysis (our unpublished data). Consistent with our results, the study by Chung et al. (1996)
demonstrated that the RNA-binding affinity of the HuD full-length protein is almost 8 times greater than that of the HuDRRM1+ 2 protein. It is unclear at present how the RRM3 and hinge domains of Hu proteins functions as a dominant-negative protein. However, a hint came from the following studies. In one study, RRM3 of the human HuB protein interferes with the multimerization of the full-length proteins (Gao and Keene, 1996
). Two other studies indicated that HuD as well as ELAV, the Drosophila homologue of Hu proteins, exist as multimers (Kasashima et al., 2002
; Soller and White, 2005
). The study on ELAV further demonstrated that binding of the multimerized ELAV on ewg RNA is functionally important (Soller and White, 2005
). Thus, it is very tempting to suggest that multimerzation of Hu proteins is important for their functions as RNA processing factors, and overexpression of the RRM3 and hinge domains interferes with multimerization of the full-length proteins, which causes its dominant-negative effect.
Although in RNA gel mobility shift assay, recombinant proteins of the three neuron-specific Hu proteins show strong affinity for the calcitonin/CGRP intronic element containing the U-rich sequence (our unpublished data), our cell transfection experiments did not distinguish effect by individual Hu proteins (Figures 5 and 6). In CGRP-producing neurons, including hippocampus, dorsal root ganglia, and spinal cord, all three of the neuron-specific Hu proteins, HuB, HuC, and HuD, are present in adult mice (Okano and Darnell, 1997
). A recent study using HuD-deficient mice demonstrated that HuD is involved at multiple stages during neuronal development. However, no difference of expression of several Hu protein targets was detected, suggesting at least a partial functional redundancy of Hu family proteins (Akamatsu et al., 2005
).
The precise role of TIA-1/TIAR in promoting the nonneuronal inclusion of calcitonin/CGRP exon 4 is not clear. We propose that TIA-1/TIAR may play one of the two roles: inhibit recognition of the 3' splice site of exon 5, or enhance recognition of the 3' splice site of exon 4 (Zhu et al., 2003
). In addition to the function mediated by intronic element, TIA-1/TIAR have been shown to promote authentic 5' splice site recognition by U1 snRNP (Del Gatto-Konczak et al., 2000
; Forch et al., 2000
; Le Guiner et al., 2001
). In those examples, the TIA-1/TIAR binding sites are located immediately downstream of suboptimal 5' splice sites. Recent studies demonstrate an emerging theme of regulated alternative splicing by competing activities of TIA-1 and PTB. In one example, the two proteins bind to two different RNA sequences on the Fas pre-mRNA and have opposing activities in regulating the fate of Fas exon 6 (Izquierdo et al., 2005
). In the other two examples, TIA-1 and PTB compete for binding at the same intronic sequences following the 5' splice sites (Zuccato et al., 2004
; Shukla et al., 2005
). The competing nature of binding of Hu and TIA-1/TIAR proteins at similar target sequence may be a wide spread phenomenon of neuron-specific alternatively spliced exons. Conceptually, it is likely that a subset of alternatively spliced exons is controlled by the competing activity of these two groups of proteins. However, at this point, it remains possible that other AU-rich sequence-binding proteins that we did not examine may also be involved in regulated RNA processing.
Experiments reported in this communication reveal a functional role of Hu proteins in regulating the neuron-specific alternative RNA processing of the calcitonin/CGRP pre-mRNA. However, although Hu proteins are necessary for the regulation, they are not sufficient. In HeLa cells, overexpression of Hu proteins, alone or in combination, did not switch the RNA processing phenotype (our unpublished data). This result suggests that other proteins may also be required for regulation in neurons. There is precedent that more than one neuron-specific protein is needed to include an alternative exon. At least two neuron-enriched proteins, nPTB and Fox-1, are required for inclusion of the c-src N1 exon in neurons (Markovtsov et al., 2000
; Underwood et al., 2005
).
Experiments using cell lines, embryos, and knockout mice demonstrated that Hu proteins are involved in early neuronal differentiation (Wakamatsu and Weston, 1997
; Akamatsu et al., 1999
, 2005
; Anderson et al., 2000
). Because some of the neuron-specific members of the Hu protein family have been shown to regulate mRNA stability and translation, it was postulated that the function of Hu proteins during neuron differentiation is to stabilize or promote translation of those mRNAs involved in neuronal function, such as the growth-associated protein-43 and neurofilament M, through binding at the AU-rich element located in 3' UTR (Antic et al., 1999
; Anderson et al., 2000
). Our results define the first nuclear function of Hu proteins and therefore suggest a novel mechanism by which Hu proteins regulate neuronal differentiation. It is entirely possible that Hu proteins regulate expression of genes associated with neuronal differentiation or maintenance by affecting alternative splicing of their pre-mRNAs. It is therefore of great importance to identify additional targets of Hu proteins and study the role of Hu proteins in regulating alternative splicing of these Hu target-containing pre-mRNAs. Our initial search of the alternative splicing database identified several neuron-specific alternatively spliced exons that are surrounded by U-rich sequences. Experiments are under way to investigate the role of Hu proteins in regulating these alternative splicing events.
Our studies reported here add Hu proteins to the currently very short list of tissue-specific RNA processing regulators. Additional studies of these proteins will provide significant insight into the regulatory mechanisms of neuron-specific alternative RNA processing.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Hua Lou (hxl47{at}case.edu)
Abbreviations used: CGRP, calcitonin gene-related peptide.
| REFERENCES |
|---|
|
|
|---|
Akamatsu, W., et al. (2005). The RNA-binding protein HuD regulates neuronal cell identity and maturation. Proc. Natl. Acad. Sci. USA 102, 46254630.
Akamatsu, W., Okano, H. J., Osumi, N., Inoue, T., Nakamura, S., Sakakibara, S., Miura, M., Matsuo, N., Darnell, R. B., Okano, H. (1999). Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc. Natl. Acad. Sci. USA 96, 98859890.
Anderson, K. D., Morin, M. A., Beckel-Mitchener, A., Mobarak, C. D., Neve, R. L., Furneaux, H. M., Burry, R., Perrone-Bizzozero, N. I. (2000). Overexpression of HuD, but not of its truncated form HuD I+II, promotes GAP-43 gene expression and neurite outgrowth in PC12 cells in the absence of nerve growth factor. J. Neurochem 75, 11031114.[CrossRef][Medline]
Antic, D., Lu, N., Keene, J. D. (1999). ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells. Genes Dev 13, 449461.
Ashiya, M. and Grabowski, P. J. (1997). A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart. RNA 3, 9961015.[Abstract]
Bennett, M. M. and Amara, S. G. (1992). Molecular mechanisms of cell-specific and regulated expression of the calcitonin/alpha-CGRP and beta-CGRP genes. Ann. NY Acad. Sci 657, 3649.[Medline]
Black, D. L. and Grabowski, P. J. (2003). Alternative pre-mRNA splicing and neuronal function. Prog. Mol. Subcell. Biol 31, 187216.[Medline]
Bovenberg, R. A., van de Meerendonk, W. P., Baas, P. D., Steenbergh, P. H., Lips, C. J., Jansz, H. S. (1986). Model for alternative RNA processing in human calcitonin gene expression. Nucleic Acids Res 14, 87858803.
Brennan, C. M. and Steitz, J. A. (2001). HuR and mRNA stability. Cell Mol. Life Sci 58, 266277.[CrossRef][Medline]
Buckanovich, R. J., Yang, Y. Y., Darnell, R. B. (1996). The onconeural antigen Nova-1 is a neuron-specific RNA-binding protein, the activity of which is inhibited by paraneoplastic antibodies. J. Neurosci 16, 11141122.
Burry, R. W. and Smith, C. L. (2006). HuD distribution changes in response to heat-shock, but not neurotrophic stimulation. J. Histochem. Cytochem 54, 11291138.
Chung, S., Jiang, L., Cheng, S., Furneaux, H. (1996). Purification and properties of HuD, a neuronal RNA-binding protein. J. Biol. Chem 271, 1151811524.
Del Gatto-Konczak, F., Bourgeois, C. F., Le Guiner, C., Kister, L., Gesnel, M. C., Stevenin, J., Breathnach, R. (2000). The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5' splice site. Mol. Cell. Biol 20, 62876299.
Dredge, B. K. and Darnell, R. B. (2003). Nova regulates GABA(A) receptor gamma2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol. Cell. Biol 23, 46874700.
Fan, X. C. and Steitz, J. A. (1998). HNS, a nuclear-cytoplasmic shuttling sequence in HuR. Proc. Natl. Acad. Sci. USA 95, 1529315298.
Forch, P., Puig, O., Kedersha, N., Martinez, C., Granneman, S., Seraphin, B., Anderson, P., Valcarcel, J. (2000). The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol. Cell 6, 10891098.[CrossRef][Medline]
Forch, P., Puig, O., Martinez, C., Seraphin, B., Valcarcel, J. (2002). The splicing regulator TIA-1 interacts with U1-C to promote U1 snRNP recruitment to 5' splice sites. EMBO J 21, 68826892.[CrossRef][Medline]
Gallouzi, I. E., Brennan, C. M., Steitz, J. A. (2001). Protein ligands mediate the CRM1-dependent export of HuR in response to heat shock. RNA 7, 13481361.[Abstract]
Gao, F. B. and Keene, J. D. (1996). Hel-N1/Hel-N2 proteins are bound to poly(A)+ mRNA in granular RNP structures and are implicated in neuronal differentiation. J. Cell Sci 109, 579589.
Grabowski, P. J. and Black, D. L. (2001). Alternative RNA splicing in the nervous system. Prog. Neurobiol 65, 289308.[CrossRef][Medline]
Izquierdo, J. M., Majos, N., Bonnal, S., Martinez, C., Castelo, R., Guigo, R., Bilbao, D., Valcarcel, J. (2005). Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol. Cell 19, 475484.[CrossRef][Medline]
Jain, R. G., Andrews, L. G., McGowan, K. M., Pekala, P. H., Keene, J. D. (1997). Ectopic expression of Hel-N1, an RNA-binding protein, increases glucose transporter (GLUT1) expression in 3T3-L1 adipocytes. Mol. Cell. Biol 17, 954962.
Jensen, K. B., Dredge, B. K., Stefani, G., Zhong, R., Buckanovich, R. J., Okano, H. J., Yang, Y. Y., Darnell, R. B. (2000). Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25, 359371.[CrossRef][Medline]
Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M., Armour, C. D., Santos, R., Schadt, E. E., Stoughton, R., Shoemaker, D. D. (2003). Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302, 21412144.
Kasashima, K., Sakashita, E., Saito, K., Sakamoto, H. (2002). Complex formation of the neuron-specific ELAV-like Hu RNA-binding proteins. Nucleic Acids Res 30, 45194526.
Kasashima, K., Terashima, K., Yamamoto, K., Sakashita, E., Sakamoto, H. (1999). Cytoplasmic localization is required for the mammalian ELAV-like protein HuD to induce neuronal differentiation. Genes Cells 4, 667683.[Abstract]
Keene, J. D. (2001). Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc. Natl. Acad. Sci. USA 98, 70187024.
Kullmann, M., Gopfert, U., Siewe, B., Hengst, L. (2002). ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR. Genes Dev 16, 30873099.
Le Guiner, C., Lejeune, F., Galiana, D., Kister, L., Breathnach, R., Stevenin, J., Del Gatto-Konczak, F. (2001). TIA-1 and TIAR activate splicing of alternative exons with weak 5' splice sites followed by a U-rich stretch on their own pre-mRNAs. J. Biol. Chem 276, 4063840646.
Leff, S. E., Evans, R. M., Rosenfeld, M. G. (1987). Splice commitment dictates neuron-specific alternative RNA processing in calcitonin/CGRP gene expression. Cell 48, 517524.[CrossRef][Medline]
Levine, T. D., Gao, F., King, P. H., Andrews, L. G., Keene, J. D. (1993). Hel-N 1, an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs. Mol. Cell. Biol 13, 34943504.
Lipscombe, D. (2005). Neuronal proteins custom designed by alternative splicing. Curr. Opin. Neurobiol 15, 358363.[CrossRef][Medline]
Lisbin, M. J., Qiu, J., White, K. (2001). The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA. Genes Dev 15, 25462561.
Lou, H. and Gagel, R. F. (1999). Mechanism of tissue-specific alternative RNA processing of the calcitonin CGRP gene. Front. Horm. Res 25, 1833.[Medline]
Lou, H., Gagel, R. F., Berget, S. M. (1996). An intron enhancer recognized by splicing factors activates polyadenylation. Genes Dev 10, 208219.
Lou, H., Neugebauer, K. M., Gagel, R. F., Berget, S. M. (1998). Regulation of alternative polyadenylation by U1 snRNPs and SRp20. Mol. Cell. Biol 18, 49774985.
Lou, H., Yang, Y., Cote, G. J., Berget, S. M., Gagel, R. F. (1995). An intron enhancer containing a 5' splice site sequence in the human calcitonin/calcitonin gene-related peptide gene. Mol. Cell. Biol 15, 71357142.
Markovtsov, V., Nikolic, J. M., Goldman, J. A., Turck, C. W., Chou, M. Y., Black, D. L. (2000). Cooperative assembly of an hnRNP complex induced by a tissue-specific homolog of polypyrimidine tract binding protein. Mol. Cell. Biol 20, 74637479.
Modrek, B. and Lee, C. (2002). A genomic view of alternative splicing. Nat. Genet 30, 1319.[CrossRef][Medline]
Myer, V. E., Fan, X. C., Steitz, J. A. (1997). Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J 16, 21302139.[CrossRef][Medline]
Okano, H. J. and Darnell, R. B. (1997). A hierarchy of Hu RNA binding proteins in developing and adult neurons. J. Neurosci 17, 30243037.
Perrone-Bizzozero, N. and Bolognani, F. (2002). Role of HuD and other RNA-binding proteins in neural development and plasticity. J. Neurosci. Res 68, 121126.[CrossRef][Medline]
Polydorides, A. D., Okano, H. J., Yang, Y. Y., Stefani, G., Darnell, R. B. (2000). A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc. Natl. Acad. Sci. USA 97, 63506355.
Posner, J. B. and Dalmau, J. (1997). Paraneoplastic syndromes. Curr. Opin. Immunol 9, 723729.[CrossRef][Medline]
Roesser, J. R. (2004). Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene. RNA 10, 12431250.
Roesser, J. R., Liittschwager, K., Leff, S. E. (1993). Regulation of tissue-specific splicing of the calcitonin/calcitonin gene-related peptide gene by RNA-binding proteins. J. Biol. Chem 268, 83668375.
Rosenfeld, M. G., Emeson, R. B., Yeakley, J. M., Merillat, N., Hedjran, F., Lenz, J., Delsert, C. (1992). Calcitonin gene-related peptide: a neuropeptide generated as a consequence of tissue-specific, developmentally regulated alternative RNA processing events. Ann. NY Acad. Sci 657, 117.[Medline]
Rosenfeld, M. G., Lin, C. R., Amara, S. G., Stolarsky, L., Roos, B. A., Ong, E. S., Evans, R. M. (1982). Calcitonin mRNA polymorphism: peptide switching associated with alternative RNA splicing events. Proc Natl. Acad. Sci. USA 79, 17171721.
Russo, A. F., Lanigan, T. M., Sullivan, B. E. (1992). Neuronal properties of a thyroid C-cell line: partial repression by dexamethasone and retinoic acid. Mol. Endocrinol 6, 207218.
Sharma, S., Falick, A. M., Black, D. L. (2005). Polypyrimidine tract binding protein blocks the 5' splice site-dependent assembly of U2AF and the prespliceosomal E complex. Mol. Cell 19, 485496.[CrossRef][Medline]
Shukla, S., Del Gatto-Konczak, F., Breathnach, R., Fisher, S. A. (2005). Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1. RNA 11, 17251736.
Soller, M. and White, K. (2003). ELAV inhibits 3'-end processing to promote neural splicing of ewg pre-mRNA. Genes Dev 17, 25262538.
Soller, M. and White, K. (2005). ELAV multimerizes on conserved AU4-6 motifs important for ewg splicing regulation. Mol. Cell. Biol 25, 75807591.
Strickland, S. and Mahdavi, V. (1978). The induction of differentiation in teratocarcinoma stem cells by retinoic acid. Cell 15, 393403.[CrossRef][Medline]
Szabo, A., Dalmau, J., Manley, G., Rosenfeld, M., Wong, E., Henson, J., Posner, J. B., Furneaux, H. M. (1991). HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is homologous to Elav and Sex-lethal. Cell 67, 325333.[CrossRef][Medline]
Tiley, L. S., Madore, S. J., Malim, M. H., Cullen, B. R. (1992). The VP16 transcription activation domain is functional when targeted to a promoter-proximal RNA sequence. Genes Dev 6, 20772087.
Tran, Q., Coleman, T. P., Roesser, J. R. (2003). Human transformer 2beta and SRp55 interact with a calcitonin-specific splice enhancer. Biochim. Biophys. Acta 1625, 141152.[Medline]
Tran, Q. and Roesser, J. R. (2003). SRp55 is a regulator of calcitonin/CGRP alternative RNA splicing. Biochemistry 42, 951957.[CrossRef][Medline]
Ule, J., Jensen, K. B., Ruggiu, M., Mele, A., Ule, A., Darnell, R. B. (2003). CLIP identifies Nova-regulated RNA networks in the brain. Science 302, 12121215.
Ule, J., et al. (2005). Nova regulates brain-specific splicing to shape the synapse. Nat. Genet 37, 844852.[CrossRef][Medline]
Underwood, J. G., Boutz, P. L., Dougherty, J. D., Stoilov, P., Black, D. L. (2005). Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals. Mol. Cell. Biol 25, 1000510016.
Wakamatsu, Y. and Weston, J. A. (1997). Sequential expression and role of Hu RNA-binding proteins during neurogenesis. Development 124, 34493460.[Abstract]
Wu, J. I., Reed, R. B., Grabowski, P. J., Artzt, K. (2002). Function of quaking in myelination: regulation of alternative splicing. Proc. Natl. Acad. Sci. USA 99, 42334238.
Xu, Q., Modrek, B., Lee, C. (2002). Genome-wide detection of tissue-specific alternative splicing in the human transcriptome. Nucleic Acids Res 30, 37543766.
Zhang, L., Liu, W., Grabowski, P. J. (1999). Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB. RNA 5, 117130.[Abstract]
Zhang, W., Liu, H., Han, K., Grabowski, P. J. (2002). Region-specific alternative splicing in the nervous system: implications for regulation by the RNA-binding protein NAPOR. RNA 8, 671685.[Abstract]
Zhu, H., Hasman, R. A., Young, K. M., Kedersha, N. L., Lou, H. (2003). U1 snRNP-dependent function of TIAR in the regulation of alternative RNA processing of the human calcitonin/CGRP pre-mRNA. Mol. Cell. Biol 23, 59595971.
Zuccato, E., Buratti, E., Stuani, C., Baralle, F. E., Pagani, F. (2004). An intronic polypyrimidine-rich element downstream of the donor site modulates cystic fibrosis transmembrane conductance regulator exon 9 alternative splicing. J. Biol. Chem 279, 1698016988.
This article has been cited by other articles:
![]() |
H. Wang, J. Molfenter, H. Zhu, and H. Lou Promotion of exon 6 inclusion in HuD pre-mRNA by Hu protein family members Nucleic Acids Res., February 16, 2010; (2010) gkq028v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Barron, H. Zhu, M. N. Hinman, A. N. Ladd, and H. Lou The neurofibromatosis type I pre-mRNA is a novel target of CELF protein-mediated splicing regulation Nucleic Acids Res., January 1, 2010; 38(1): 253 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cherry, H. Jones, V. A. Karschner, and P. H. Pekala Post-transcriptional Control of CCAAT/Enhancer-binding Protein {beta} (C/EBP{beta}) Expression: FORMATION OF A NUCLEAR HuR-C/EBP{beta} mRNA COMPLEX DETERMINES THE AMOUNT OF MESSAGE REACHING THE CYTOSOL J. Biol. Chem., November 7, 2008; 283(45): 30812 - 30820. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Zhou and H. Lou Repression of Prespliceosome Complex Formation at Two Distinct Steps by Fox-1/Fox-2 Proteins Mol. Cell. Biol., September 1, 2008; 28(17): 5507 - 5516. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Izquierdo Hu Antigen R (HuR) Functions as an Alternative Pre-mRNA Splicing Regulator of Fas Apoptosis-promoting Receptor on Exon Definition J. Biol. Chem., July 4, 2008; 283(27): 19077 - 19084. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ratti, C. Fallini, C. Colombrita, A. Pascale, U. Laforenza, A. Quattrone, and V. Silani Post-transcriptional Regulation of Neuro-oncological Ventral Antigen 1 by the Neuronal RNA-binding Proteins ELAV J. Biol. Chem., March 21, 2008; 283(12): 7531 - 7541. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhu, M. N. Hinman, R. A. Hasman, P. Mehta, and H. Lou Regulation of Neuron-Specific Alternative Splicing of Neurofibromatosis Type 1 Pre-mRNA Mol. Cell. Biol., February 15, 2008; 28(4): 1240 - 1251. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. David and J. L. Manley The search for alternative splicing regulators: new approaches offer a path to a splicing code Genes & Dev., February 1, 2008; 22(3): 279 - 285. [Full Text] [PDF] |
||||
![]() |
P. Sathyan, H. B. Golden, and R. C. Miranda Competing Interactions between Micro-RNAs Determine Neural Progenitor Survival and Proliferation after Ethanol Exposure: Evidence from an Ex Vivo Model of the Fetal Cerebral Cortical Neuroepithelium J. Neurosci., August 8, 2007; 27(32): 8546 - 8557. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Izquierdo and J. Valcarcel Two Isoforms of the T-cell Intracellular Antigen 1 (TIA-1) Splicing Factor Display Distinct Splicing Regulation Activities: CONTROL OF TIA-1 ISOFORM RATIO BY TIA-1-RELATED PROTEIN J. Biol. Chem., July 6, 2007; 282(27): 19410 - 19417. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Coutinho-Mansfield, Y. Xue, Y. Zhang, and X.-D. Fu PTB/nPTB switch: a post-transcriptional mechanism for programming neuronal differentiation Genes & Dev., July 1, 2007; 21(13): 1573 - 1577. [Full Text] [PDF] |
||||
![]() |
R. B. Voelker and J. A. Berglund A comprehensive computational characterization of conserved mammalian intronic sequences reveals conserved motifs associated with constitutive and alternative splicing Genome Res., July 1, 2007; 17(7): 1023 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-I G. Chen, R. E. Moore, H. Y. Ge, M. K. Young, T. D. Lee, and S. W. Stevens Proteomic analysis of in vivo-assembled pre-mRNA splicing complexes expands the catalog of participating factors Nucleic Acids Res., June 9, 2007; 35(12): 3928 - 3944. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||