![]() |
|
|
Vol. 17, Issue 6, 2661-2673, June 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



*Departments of Physiology and Medicine, Gastroenterology Division and
Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, MD 21205;
Unite Mixte de Recherche 144, Centre National de la Recherche Scientifique/Institut Curie, 75248 Paris, France;
Division of Digestive Diseases, Department of Medicine, Emory University School of Medicine, Atlanta, GA 30322
Submitted September 16, 2005;
Revised February 28, 2006;
Accepted March 6, 2006
Monitoring Editor: Anthony Bretscher
| ABSTRACT |
|---|
|
|
|---|
-helical, with a positive aa cluster on one side (K516, R520, and R527). Point mutations of these positively charged aa reduced (NHE3 double mutant [R520F, R527F]) or abolished (NHE3 triple mutant [K516Q, R520F, R 527F]) ezrin binding. Functional consequences of these NHE3 point mutants included the following. 1) A marked decrease in surface amount with a greater decrease in NHE3 activity. 2) Decreased surface expression due to decreased rates of exocytosis and plasma membrane delivery of newly synthesized NHE3, with normal total expression levels and slightly reduced endocytosis rates. 3) A longer plasma membrane half-life of mutant NHE3 with normal total half-life. 4) Decreased BB mobile fraction of NHE3 double mutant. These results show that NHE3 binds ezrin directly as well as indirectly and suggest that the former is related to 1) the exocytic trafficking of and plasma membrane delivery of newly synthesized NHE3, which determines the amount of plasma membrane NHE3 and partially determines NHE3 activity, and 2) BB mobility of NHE3, which may increase its delivery from microvilli to the intervillus clefts, perhaps for NHE3-regulated endocytosis. | INTRODUCTION |
|---|
|
|
|---|
The epithelial brush-border (BB) NHE isoform NHE3 also associates with the actin cytoskeleton. We previously showed that the association of NHE3 with the actin cytoskeleton occurs via two areas in its C-terminal regulatory domain. One area, between aa 585-689 (Yun et al., 1997
, 1998
), bound the PSD95/dlg/zonular occludens-1 (PDZ) domain-containing proteins, NHERF1 or NHERF2. The NHERFs simultaneously bind NHE3 and link it to the actin cytoskeleton via binding to ezrin. NHERF1 and NHERF2 are scaffolding proteins that assemble multiprotein signaling complexes, largely through their multiple PDZ domains and C-terminal ERM binding domain (Shenolikar et al., 2004
; Donowitz et al., 2005
). For example, NHE3 protein complexes, which include NHERF1/NHERF2, ezrin, and PKAII, facilitate the phosphorylation of NHE3 by protein kinase A, which is necessary for cAMP inhibition of NHE3 activity (Yun et al., 1998
; Zizak et al., 1999
; Weinman et al., 2000
). Also, cGMP inhibition of BB NHE3 involves a complex of NHE3, NHERF2, and cGMP kinase II (Cha et al., 2005
). The identified functional consequences of this NHERF binding include formation of multiple, large, multiprotein complexes and also limitation of mobility of NHE3 in epithelial cell BB (Cha et al., 2004
; Li et al., 2004
).
There is a second NHE3actin cytoskeleton association that is separate and upstream from the NHERF binding domain. The evidence includes that NHE3 truncated to aa 585 (NHE3 585), which lacks all NHERF binding, colocalized with actin in the apical cytoskeleton and was affected by disrupting the actin cytoskeleton similarly to wild-type NHE3 in terms of exhibiting reduced mobility at the apical membrane of opossum kidney (OK) cells (Cha et al., 2004
).
One of the ways NHE3 associates with the cytoskeleton involves ezrin. Ezrin has two complementary self-association domains known as N- and C-ERM association domains (ERMADs), which encompass residues 1-296 and 479-585, respectively (Bretscher et al., 2002
). These N- and C-ERMADs interact strongly with each other, masking the membrane protein and F-actin binding sites and maintaining ezrin as an inactive monomer in the cytoplasm. The major F-actin binding site of ezrin is within its carboxy-terminal 30 amino acids. The N-terminal domain of ERM proteins have protein 4.1, ezrin, radixin, moesin (FERM) domains, which act as multifunctional protein and lipid binding sites. Recently the three-dimensional structure of the ezrin N-terminal FERM domain was solved (Pearson et al., 2000
; Smith and Cerione, 2002
; Hamada et al., 2003
; Smith et al., 2003
; Finnerty et al., 2004
) and shown to be composed of three subdomains: FERM-I (aa 4-82), FERM-II (aa 96-195), and FERM-III (aa 204-297). These subdomains together form a compact cloverleaf-shaped structure. In addition to associating directly with the cytoplasmic tails of some membrane proteins, the FERM domain of ezrin interacts strongly with NHERF1 and NHERF2 (Finnerty et al., 2004
).
In the current study, we identify the upstream cytoskeleton association domain of NHE3 as an ezrin binding domain and demonstrate its functional role in NHE3 trafficking and BB mobility. This report provides the first evidence that proteins the bind ezrin at two sites can use those interactions to regulate separate functions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-5199) and anti-NHERF2 (
-2570) antibodies were described previously (Yun et al., 1997
Construction of Expression Vectors for NHE3 C-Terminus Ezrin Binding Mutants
The NHE3 C-terminus ezrin binding mutations were made using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocol. The template for mutagenesis was the pcDNA3.1/Hygro+ vector (Invitrogen) containing rabbit NHE3, which had an epitope tag derived from the VSV-G at the COOH-terminal end, as described previously (Cha et al., 2005
). The sense oligonucleotides (5'-3') used for introducing the mutations in pcDNA3.1/Hygro+ NHE3V were (designation used for mutations is domain mutated of NHE3 C terminus [F1 or F2] single [S], double [D], or triple [T] mutant): NHE3VF1 single (R527F), CGGCCCAGAAGTCTTTCGACCGGATT CTG; NHE3VF1 double (R520F, R527F), GCAAACTGCTCATGTTCCAGTCGGCC CAG AAGTCTTTCGACCGG ATTCTG; and NHE3VF1 triple (K516Q, R520F, R527F), GGTTCCTCAGCCAACTGCTCATGTTC CAGTCGGCCCAGAAGTCTTTCGACCG GATTCTG, and NHE3VF2 triple RRR (R604L, R605F, R606F), TCGCTGGAGCAGCTGT TCTTCAGCGTGCGCGAC, respectively (16 cycles, 95°C, 30 s; 55°C, 1 min; and 68°C, 16 min). The changed bases are underlined. These cDNAs were sequenced in full. NHE3-EGFP, NHE3F1 D-EGFP (R520F, R527F), and NHE3 F1T (K516Q, R520F, R527F) were assembled into pEGFPN3 vector (Clontech, Mountain View, CA) in frame with the C-terminal enhanced green fluorescent protein (EGFP) coding sequence.
Fusion Proteins and In Vitro Translation Products
The recombinant proteins glutathione S-transferase (GST), GST-WT-ezrin (aa 1-585), GST-N-ezrin (NE) (aa 1-309), GST-C-ezrin (aa 310-585), GST-NE1 (aa 1-97), GST-NE2 (aa 1-198), and GST-NE3 (aa 1-310) were made in the pGEX2T-1 vector (the plasmids were from M. Arpin). 6xHis-tagged fusion proteins made in the pET30a vector included the NHE3 C terminus, F1 (aa 475-589), F2 (aa 590-667), F3 (aa 668-747), F4 (aa 748-832), FFull CT (aa 475-832), and NHERF1 and NHERF2 (Cha et al., 2004
).
In vitro-translated, [35S]methionine-labeled NHE3 C-terminal fragments were generated using the TnT Quick-coupled transcription/translation system (Promega, Madison, WI). The amount of each labeled protein used in binding assays was determined by the intensity of the autoradiography signal per amount of GST-labeled fusion protein. GST-fusion proteins were expressed in BL21 cells and induced with 1 mM isopropyl
-D-thiogalactoside at 37°C for 4 h. Fusion proteins were purified on GST-Sepharose according to the manufacture's recommendations (GST Gene Fusion system; GE Healthcare). The concentration of each GST fusion protein was estimated by Ponceau S (Sigma-Aldrich) staining after sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) transfer to nitrocellulose, using known amounts of bovine serum albumin (BSA) as an internal standard or by Bradford protein assay.
In Vitro Binding Assays
GST fusion proteins immobilized on reduced glutathione (GSH)-Sepharose beads were incubated with protein lysates or in vitro translation products in lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 10% glycerol, 1% NP-40, 200 µM Na3VO4, and protease inhibitors) overnight at 4°C. Complexes were pelleted at 10,000 x g for 2 min and washed three times in 1 ml of lysis buffer. Bound proteins were eluted from the beads by heating in Laemmli's buffer for 5 min at 80°C. Proteins were separated in 10% or 14% SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted.
Immunoprecipitation and Immunoblot Analysis
Coimmunoprecipitation experiments were performed using lysates from PS120/NHE3 and PS120/NHE3_585 cells. Cell lysates were in lysis buffer (60 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM KCl, 5 mM EDTA trisodium, 3 mM lysis buffer EGTA, 1 mM Na3VO4, and 1% Triton X-100 with protease inhibitor cocktail [Sigma-Aldrich]). Aliquots (2 mg of protein) of lysate were incubated with either monoclonal anti-VSV-G antibody immobilized to agarose or monoclonal anti-HA affinity matrix overnight at 4°C. The aliquots were washed five times (60 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM KC1, 5 mM EDTA trisodium, 3 mM EGTA, 1 mM Na3VO4, and 1% Triton X-100), and then bound proteins were eluted in Laemmli's buffer, separated by SDS-PAGE, and transferred to nitrocellulose. The blots were probed with monoclonal anti-VSV-G or monoclonal anti-ezrin primary antibodies and fluorescently labeled secondary antibody (IRDye 800 or Alexa Fluor 680) according to the manufacturer's protocol, and bands were visualized by the Odyssey system (LI-COR, Lincoln, NE).
Cell Culture and cDNA Transfection of NHE3 Ezrin Binding Mutants
The cDNAs of wild-type NHE3V and its ezrin binding mutants NHE3VF1 single mutant (R527F), NHE3VF1 double mutant (R520F, R527F), NHE3VF1 triple mutant (K516Q, R570F, R527F), NHE3VF2 triple mutant (R604L, R605F, R606F), and NHE3_585V (aa 1-585) in pcDNA3.1/Hygro+ vector (Invitrogen) were transfected into Na+/H+ exchanger-deficient PS120 fibroblasts using
10 µl of Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol, and resistant clones were selected with 600 U/ml hygromycin. Stably transfected PS120 fibroblasts were maintained at 37°C in a humidified atmosphere with 5% CO2 in DMEM supplemented with 10% (vol/vol) fetal bovine serum (FBS), 100 U/ml penicillin, and 100 µg/ml streptomycin (PS120 media). In addition, some NHE3-transfected cells (NHE3 wild-type and NHE3F2 triple mutant) were selected by an H+-killing procedure consisting of 50 mM NH4Cl/saline solution for 1 h, followed by an isotonic 2 mM Na+ solution for 1 h (Levine et al., 1995
). Surviving cells were then placed in normal culture medium and allowed to reach 3050% confluence. The H+-killing process was initially repeated every 23 d until more than 50% of the cells survived and was then repeated every week. Acid selection was not used in the NHE3F1 mutants (single, double, and triple).
Immunofluorescence
PS120 cells were grown on tissue culture coverslips to
70% confluence, fixed with 3% paraformaldehyde/phosphate-buffered saline for 20 min at 4°C, and the residual formaldehyde was neutralized with 20 mM glycine in phosphate-buffered saline (PBS) for 10 min. Cells were then permeabilized for 30 min in 0.1% saponin/PBS before being blocked for 30 min in 1% BSA/PBS supplemented with 10% FBS. Cells were incubated with primary antibody in 1% BSA/PBS for 60 min at room temperature. After three 10-min washes in 0.1% saponin/PBS, goat secondary antibodies (Alexa conjugates; Invitrogen) were added at 1:100 dilution in 1% BSA/PBS, incubated for 30 min, and again washed three times for 10 min in 0.1% saponin/PBS. Cells were then mounted on slides with Prolong (Invitrogen) antifade reagent and viewed on a Zeiss LSM 410 confocal fluorescence microscope.
Measurement of Na+/H+ Exchange Activity
The transfected PS120 cells grown to 7080% confluence on glass coverslips were placed in serum-free medium for
4 h to arrest division. The Na+/H+ exchanger activities of transfected PS120 cells were measured using the intracellular pH-sensitive dye BCECF-acetoxymethyl ester, as described previously (Levine et al., 1995
; Cha et al., 2005
).
Cell Surface Biotinylation and Immunoblotting
Transfected PS120 cells were grown to 7080% confluence in 10-cm Petri dishes. The cells were then serum starved for
4 h. All subsequent manipulations were performed at 4°C. For surface labeling of NHE3, cells were incubated with 0.5 mg/ml NHS-SS-biotin (biotinylation solution; Pierce Chemical) for 20 min and repeated once, solubilized with the lysis buffer, and then incubated for 1 h with streptavidin-agarose beads. Western analysis and the quantification of the surface fraction were performed as described previously (Akhter et al., 2002
; Kim et al., 2002
).
Endocytosis
Endocytosis was measured by a protocol slightly modified from the reduced GSH-resistant endocytosis assay we described previously (Lee-Kwon et al., 2003
). Cells at 4°C were labeled with 1.5 mg/ml sulfo-NHS-SS-biotin for 40 min and quenched at 4°C. Cells were then incubated at 37°C for 30 min to allow endocytosis and rinsed twice with ice-cold PBS at 4°C. All subsequent steps were at 4°C. Surface biotin was cleaved by washing with 50 mM Tris-HCl and 150 mM GSH, pH 8.8. In this way, the freshly endocytosed proteins bearing biotin were protected from cleavage with GSH. Cells were then solubilized in N+ buffer (60 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM KCl, 5 mM EDTA trisodium, 3 mM EGTA, 1 mM Na3VO4, and 1% Triton X-100), and biotinylated proteins were retrieved with streptavidin-agarose beads and quantified as described above (Lee-Kwon et al., 2003
).
Exocytic Insertion of NHE3 into the Plasma Membrane
To measure exocytic insertion of NHE3 (also called endocytic recycling), NHS-reactive sites on the cell surface were first blocked by pretreatment with sulfo-NHS-acetate as described above, with some slight modifications (Lee-Kwon et al., 2003
). Cells were rinsed twice with PBS-Ca-Mg (PBS with 0.1 mM Ca2+ and 1 mM Mg2+) at 4°C. The apical surface was then exposed to 1.5 mg/ml sulfo-NHS-acetate in PBS-Ca-Mg for 2 h at 4°C. After quenching for 20 min at 4°C, the cells were rinsed with PBS and then incubated in normal PS120 media at 4°C for 30 min as a control and at 37°C for 10 min to allow intracellular NHE3 to reach the plasma membrane (exocytosis). Cells were then treated with 0.5 mg/ml sulfo-NHS-SS-biotin as described above and lysed with N+ buffer. The biotinylated fraction, which represents newly inserted surface proteins, was precipitated by streptavidin-agarose, and the precipitate was subjected to SDS-PAGE and Western blotting with anti-VSV-G antibody, as described previously (Cavet et al., 2001
). Given the long half-life of total cellular NHE3 (Cavet et al., 2001
), there was only a small contribution by the synthetic pathway to this pool of NHE3.
Newly Synthesized NHE3 Delivered to the Plasma Membrane
To measure the newly synthesized NHE3 that was delivered to the plasma membrane, PS120/NHE3 and NHE3 F1 double mutant cells were incubated in Met/Cys-free media for 1.5 h and then pulse labeled with Tran35S-Label reagent (Met/Cys: 0.3 mCi/ml; ICN Pharmaceuticals, Costa Mesa, CA). The excel pulse-media was quickly removed by washing with DMEM media without Met and Cys for 30 min at 37°C. Cells were then chased for 0, 30, 60, 120, and 180 min in PS120 media at 37°C. Cells were then cooled to 4°C, and cell surface biotinylation was performed as described above (Akhter et al., 2002
; Kim et al., 2002
). Subsequently, the cells were lysed and proteins were isolated by streptavidin beads. Proteins were separated by 10% SDS-PAGE and transferred to nitrocellulose. Detection of 35S-labeled NHE3V and NHE3V F1 double mutant was after 24-48 h using the Storm 860 PhosphorImager system (GE Healthcare). Intensity measurements of 35S-labeled NHE3V and NHE3V F1 double mutant were quantified with MetaMorph software (Molecular Devices, Sunnyvale, CA) (top lanes). Western analysis was then performed on the same samples using anti-VSV-G antibody by the Odyssey system (bottom lanes) and quantified with MetaMorph software.
Measurement of Half-Life of Plasma Membrane NHE3 Using Cell Surface Biotinylation
To determine the half-life of plasma membrane NHE3V and NHE3V F1 double mutant, a cell surface biotinylation method was used, as described previously (Cavet et al., 2001
).
Total NHE3 Half-Life Determined by Pulse-Chase Labeling of Cultured Cells.
PS120 cells stably transfected with wild-type NHE3V and NHE3V F1 double mutant were grown to 70% confluence and then starved in depletion medium (DMEM without Met and Cys) for 1 h at 37°C. The cells were then incubated with Met/Cys-free DMEM containing 0.2 mCi/ml [35S]Met/Cys cell labeling mix (GE Healthcare) for 4 h. To chase, the labeling solution was aspirated and the cells rinsed four times with PBS. Cells were then incubated with DMEM containing 10% serum, 2 mM Met, and 2 mM Cys for between 0 and 41 h. The details are as described previously (Cavet et al., 2001
).
Fluorescence Recovery after Photobleaching (FRAP).
To determine the lateral mobility of NHE3-EGFP and NHE3 F1 double mutant-EGFP at the apical surface of polarized OK cells (the endogenous NHE3 expression was previously minimized by the "acid suicide" technique; Pouyssegur et al., 1984
), we used FRAP, as reported previously (Cha et al., 2004
). To perform FRAP, OK cells were cultured on glass-bottomed 35-mm plastic culture dishes in DMEM media (without phenol red) supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in a 5% CO2, 95% air atmosphere until 100% confluent. The cells were then transiently transfected using Lipofectamine, as described previously (Cha et al., 2004
), with NHE3-EGFP and NHE3 F1 double mutant-EGFP and studied
48 h later.
FRAP was performed on a stage heated to 37°C of a Zeiss LSM 410 confocal microscopy using the 488-nm line of a 400-mW Kr/Ar laser in conjunction with a 100x Zeiss1.4 NA Planapochromat oil immersion objective. The details were described previously (Cha et al., 2004
), with signal collected in the OK cell apical membrane in the area of microvilli not over the juxtanuclear pool of NHE3, which we previously reported did not represent newly trafficked NHE3 (Cha et al., 2004
).
| RESULTS |
|---|
|
|
|---|
|
|
FERM Subdomain III of N-Terminal Ezrin Binds to NHE3 C Terminus
The ezrin FERM domain is composed of three structural modules FERM-I (residues 4-82), FERM-II (residues 96-195), and FERM-III (residues 204-297) that together form a compact clover-shaped structure (Hamada et al., 2000
, 2003
). We tested which region of the N-terminal ezrin was needed to bind NHE3. GST fusion proteins of N-terminal ezrin made up of three domains, called NE1 (aa 1-97), NE2 (aa 1-198), and NE3 (aa 1-310), were used for in vitro pull-down binding assays with in vitro translation products of [35S]NHE3 full-length C terminus (475-832). Figure 3A shows that the NHE3 C terminus bound only to NE3 and not to NE1 or NE2. This result shows that the aa 199-310 of N-terminal ezrin is necessary for NHE3 C-terminus binding, which is approximately equivalent to the entire ezrin FERM subdomain III (aa 204-297).
|
30 amino acids of NHERF1 and NHERF2 (Yun et al., 1998
-5199 antibody) (Figure 3B, B3) and NHERF2 (using
-2570 antibody) (Figure 3B, B4) by Western analysis. These results showed aa 199-310 of ezrin (FERM III subdomain) are necessary for NHERF1 and NHERF2 binding.
NHE3 Juxtamembrane C-Terminal F1 Domain Has a Positive Amino Acid Cluster (K516, R520, and R527) on One Side of a Putative
-Helical Area
We next determined where ezrin bound in the F1 fragment of the C-terminal domain of NHE3. Positively charged amino acid clusters in the juxtamembrane cytoplasmic domain of CD43, CD44, intercellular adhesion molecule (ICAM)-1/2, and NHE1 are involved in ERM binding (Heiska et al., 1998
; Yonemura et al., 1998
; Denker and Barber, 2002
). By secondary structure predictions, we found that the NHE3 F1 juxtamembrane region contains an
-helical region (aa 502-543) (Gene Runner, Hastings Software, Hastings, NY; Chou-Fasman analysis) (Figure 4A). We examined aa constituents of serial putative
-helical regions starting at each aa between 502 and 527. Shown in Figure 4B, a positive amino acid cluster was present on one side of a putative
-helix which started at aa 511 (K516, R520, and R527). This putative
-helix (aa 511-528) had an estimated isoelectric point of 12.1. In Figure 4C, a comparison of the sequences of this juxtamembrane region in NHE1-5 is shown, including comparison among species. This positively charged aa cluster (indicated by boxed aa) is preserved among human, rat, and rabbit NHE3, but all three aa are not present in other NHE isoforms (NHE1, -2, -4, and -5). Another positively charged aa residue cluster in the NHE3 C terminus is located in the F2 fragment (aa 590-667). This domain is not predicted to be
-helical. This positive aa cluster includes R604, R605, and R606 (indicated by double underlines in Figure 4C). This cluster also is conserved among human, rabbit, and rat NHE3 but not in other plasma membrane NHE isoforms.
|
|
|
20% that of wild-type NHE3 (Figure 7B).
|
|
Decreased Surface NHE3 in Ezrin Binding Mutants Is Due to Decreased Endocytic Recycling Plus Decreased Plasma Membrane Delivery of Newly Synthesized NHE3
To understand the mechanisms that account for the smaller percentage of direct ezrin binding NHE3 mutants on the plasma membrane, rates of NHE3 endocytosis, endocytic recycling (exocytosis) and delivery to the plasma membrane of newly synthesized NHE3 were determined. In these studies, wild-type NHE3 was compared with the NHE3 F1 double mutant, which was used rather than the triple mutant because it has a much greater plasma membrane expression, which made measurements of trafficking more reliable. Shown in Figure 9A, the amount of biotinylated NHE3 internalized in 30 min was similar or slightly reduced in NHE3 and NHE3 F1D, indicating that endocytosis over this time was not significantly altered.
|
|
Half-Life of Plasma Membrane NHE3VF1 Double Mutant Is Prolonged
Half-life of total NHE3 and that of the NHE3 population initially on the plasma membrane were determined, using pulse-chase and surface biotinylation, respectively, as described previously (Cavet et al., 2001
). Comparison was made of NHE3 with the F1 double mutant to examine a construct with significantly decreased transport activity and ezrin binding. The amount of total surface biotinylated NHE3 and NHE3 F1 double mutant proteins remaining with the cells 0-30 h after initial biotinylation of surface proteins was determined, with results normalized to surface NHE3 at time 0 (cells always at 4°C). These results (Figure 10A) demonstrated that plasma membrane NHE3 and NHE3 F1 double mutant have different degradation rates. The wild-type NHE3 in PS120/NHERF2 cells had a plasma membrane half-life of 10.4 h, which is similar to our previous data in PS120 cells (Cavet et al., 2001
). In contrast, the plasma membrane half-life of NHE3 F1 double mutant was much longer (Figure 10A). Of interest, NHE3 F1 double mutant had an initial rapid decrease in amount at 2.5 h, similar to wild-type NHE3, but then had a minimal decrease over the remaining 30 h. This result indicates that the mutation of the direct ezrin binding site of NHE3 increases its plasma membrane half-life. The similar initial decrease in plasma membrane NHE3 in the F1 double mutant is consistent with the normal endocytosis rate measured over 30 min as shown in Figure 9A.
The half-lives of the total NHE3 and NHE3 F1 double mutant were measured using 35S-pulse-chase labeling. Even though the surface half-life was much longer in NHE3VF1 double mutant than wild type, the half-lives of total NHE3 and NHE3 F1 double mutant were not significantly different (Figure 10B). This means that ezrin binding to NHE3 affects half-life by an effect at the plasma membrane and not intracellularly.
Lateral Mobility of NHE3 F1D at the Apical Membrane of OK Cells Is Decreased as Assessed by FRAP
Further studies were designed to examine the apical membrane mobility of the NHE3 F1D mutant in polarized epithelial cells. This was done to address the long half-life of plasma membrane FID mutant NHE3 with normal endocytosis. Moreover, we felt study of an epithelial cell BB would allow greater examination of plasma membrane effects. We have shown that the lateral mobility of NHE3 at the apical surface of OK cells is dependent on the actin cytoskeleton. For example, the lateral mobility of NHE3-EGFP was significantly decreased by 0.05 µM latrunculin B 30-min treatment (Cha et al., 2004
). In this study, we compared the lateral mobility of BB NHE3 F1D-EGFP with wild-type NHE3 under conditions we had shown that trafficking did not contribute to fluorescence recovery in the BB (Cha et al., 2004
). As shown in Figure 11, BB mobility of NHE3 F1D mutant was decreased compared with wild-type NHE3. This is consistent with our previous results in which NHE3 truncated not to bind NHERF proteins exhibited actin cytoskeleton-dependent BB mobility (Cha et al., 2004
).
|
| DISCUSSION |
|---|
|
|
|---|
-helical area in the juxtamembrane domain of NHE3, involving at least K516 and R520. It is not known, however, whether a single NHE3 molecule associates simultaneously with ezrin by both types of interaction. The domain of NHE3 involved in direct ezrin binding (aa 475-589) has been known to be important functionally, because previous mutations made in this domain markedly reduced NHE3 activity. For example, mutating His475 and His499 in this domain decreased NHE3 activity and shifted the set point to more acidic (Cha et al., 2003
-helical. However, the first direct evidence that it exists in the intact protein as a
-helix is this study in which positively charged aa, which are usually involved in ezrin binding, are only clustered in the
-helical conformation.
The same ezrin domain (FERM) is used in both types of binding to NHE3, which indicates the involvement of two separate ezrin molecules with a single NHE3 molecule. This concept seems to apply to ezrin interaction with multiple ligands. How ezrin interacts with its partners has recently been partially clarified. There are two patterns, direct binding and indirect binding via NHERF interactions. Substrates that only directly bind ezrin include ICAM-1, ICAM-2, ICAM-3, CD44, syndecan2, and NHE1 (Tsukita et al., 1994
; Helander et al., 1996
; Yonemura et al., 1998
; Denker and Barber, 2002
; Lozupone et al., 2004
). Indirect associations have been described with the
2-adrenergic receptor, CFTR and NHE3 (Tsukita et al., 1994
; Hall et al., 1998
; Wang et al., 1998
; Sun et al., 2000
). The renal podocyte plasma membrane protein podocalyxin binds ezrin both directly and indirectly via NHERF1 or -2 (Schmieder et al., 2004
). Of note, the function of the direct ezrin binding to podocalyxin has not been identified. Although podocalyxin is the protein that seems to interact with ezrin in a manner most similar to NHE3, there are other multiple ezrin-interacting proteins. Ezrin binds the phosphoinositide-3 kinase (PI-3 kinase) p85 subunit using two sites in ezrin, the N-terminal domain and pY353, which binds to the c-Src homology 2 domain of p85 (Sun et al., 2000
). Also, the Drosophila ERM-related protein coracle, which is present in and helps organize the epithelial cell septate junction, requires binding to its ligands with both its N-terminal (FERM domain) and its nonactin binding C terminus for normal septate junction formation (Ward et al., 2001
). The increasing recognition of more than one ezrin molecule or multiple sites on one ezrin molecule binding to a single partner is consistent with ezrin existing as a dimer (Bretscher et al., 2002
; Chambers and Bretscher, 2005
) and suggests this pattern should be sought to determine how frequently it is involved in ERM function.
The involvement of the ezrin N-terminal FERM domain in both NHERF binding and NHE3 direct binding is not surprising given the recognized importance of this N-terminal domain in ezrin binding to its partners, including ICAM-1-3, CD43, CD44, PIP2, calmodulin, CD95, and NHE1, among others. Multiple parts of the FERM domain are involved in binding; for example, ICAM-2 binds the third part, whereas CD95 (Fas) binds the second part of the FERM domain (Lozupone et al., 2004
). Whether NHE3 binding to FERM domain 3 is specifically to these aa, however, is not known.
These studies extend understanding of some aspects of the ezrin binding sites in its ligands, which is known to involve multiple positively charged aa (Ward et al., 2001
; Bretscher et al., 2002
). As with NHE3 shown here, secondary structure analysis of ezrin ligand binding sites indicates that the clustered positive charges for ezrin binding can be in an
-helical as well as in a linear configuration. The direct ezrin binding domain of podocalyxin involves its last 15 aa between aa 405 and 422, which by our analysis is predicted to be
-helical (Schmieder et al., 2004
). Thus, both secondary structures must be considered when searching for ezrin binding sites. Moreover, clustered positively charged aa are not sufficient for ezrin binding (the NHE3 F2 domain-positive aa cluster does not bind ezrin), whereas a high isoelectric point, as is present in the direct NHE3 binding area, is often necessary. Importantly, whether positively charged aa are involved in direct ezrin contact is not established. Indeed, in crystal structure to 2.4 Å of the radixin FERM domain with the cytoplasmic domain of ICAM-2, binding involves a
-sheet peptide of ICAM-2. Whereas positively charged aa are involved in this binding, they flank but are not in the binding domain, and their suggested role is in interacting with membrane phosphatidylinositol bisphosphate (Hamada et al., 2003
).
The dependence on direct ezrin binding (and thus implications of binding to actin) of trafficking of NHE3 to the plasma membrane (both newly synthesized and from the recycling compartment) is consistent with the previous demonstration of the actin dependence of these processes in general. The involvement of actin in exocytosis involves multiple steps, including depolymerization of actin to remove the terminal web barrier, which prevents vesicles from approaching the membrane, and a more active role of actin in which a myosin motor is involved with moving the vesicle to the membrane for docking (Valentijn et al., 1999
; Bader et al., 2002
, 2004
; Wenk and Camilli, 2004
). Moreover, two pools of vesicles, at least for the transporter GLUT4, are involved, a pool for immediate release and a reserve pool, which accounts for the majority of the transporter, with actin apparently involved in regulation of trafficking between these two pools (Rudich and Klip, 2003
). Recently, multiple distinct intracellular and plasma membrane pools of NHE3 have been described (Alexander et al., 2005
). Which of these roles of actin and which pool of NHE3 are involved in NHE3 exocytosis is not known. That direct ezrin binding to NHE3 seems necessary for endocytic recycling to the plasma membrane is also consistent with previous results indicating a role of ezrin in movement of PI3-kinase to the apical membrane of the renal proximal tubule cell line, LLC-PK1, because basal as well as stimulated NHE3 activity in multiple cell models (PS120 and OK cells) are PI 3-kinase dependent (Gautreau et al., 1999
). These studies, however, do not negate that the indirect NHE3/ezrin/actin association via NHERF1/NHERF2 binding may also be necessary for some aspect(s) of trafficking, particularly those related to NHE3/NHERF family complex formation and regulation of NHE3 activity (Donowitz et al., 2005
). The lack of involvement of the direct ezrin binding domain of NHE3 in endocytosis (Figure 9A) is consistent with the previous demonstration that the domain of the NHE3 C terminus necessary for cAMP inhibition, part of which occurs via increased rates of endocytosis, was C-terminal of the direct ezrin binding domain (Cabado et al., 1996
). Relevant to the aggregate studies in Figures 9 and 10, the long plasma membrane half-life of the NHE3 F1 double mutant may represent unmasking of the recently recognized nontrafficking apical membrane pool of NHE3 (Alexander et al., 2005
).
Relating to other functional consequences of NHE3 direct ezrin binding, we suggest that the reduced mobility of the BB pool of the NHE3 F1 double ezrin binding mutant and its prolonged plasma membrane half-life may be related. Both these changes are due to changes in the plasma membrane pool of NHE3. There are at least two parts of the half-life curve of surface NHE3 F1 double mutant (Figure 10A), with an initial normal rate of decrease (consistent with a normal endocytosis rate) and a much reduced later phase. We hypothesize these results are best explained by a normal basal endocytic pool of NHE3, representing that initially in the intervillus cleft area. In addition, however, there may be a defect in the ability to deliver NHE3 from the plasma membrane to that pool (Figure 12) This would predict that there is likely to be a defect in stimulated endocytosis in the NHE3 direct ezrin binding mutant.
|
We have shown that direct binding of NHE3 to ezrin is necessary for NHE3 trafficking and mobility in the BB (Figure 12). However, direct binding of NHE3/ezrin did not seem to affect organization of the membrane cytoskeleton, either in PS120 cells or OK cells as judged by the presence of microvilli. Although NHE1/direct ezrin binding has been shown to be important for organizing the cytoskeleton (Denker et al., 2000
; Denker and Barber, 2002
; Baumgartner et al., 2004
), there is no evidence yet for a role of NHE3/direct ezrin binding in similar organization either of the lamellipodia of fibroblasts (Figure 8D) or of the epithelial cell apical cytoskeleton, although this has not been systematically examined.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Mark Donowitz ( mdonowit{at}jhmi.edu)
| REFERENCES |
|---|
|
|
|---|
Akhter, S., Cavet, M. E., Tse, C. M., Donowitz, M. (2002). C-Terminal domains of Na(+)/H(+) exchanger isoform 3 are involved in the basal and serum-stimulated membrane trafficking of the exchanger. Biochemistry 39, 19902000.
Alexander, R. T., Furuya, W., Szaszi, K., Orlowski, J., Grinstein, S. (2005). Rho GTPases dictate the mobility of the Na/H exchanger NHE3 in epithelia: role in apical retention and targeting. Proc. Natl. Acad. Sci. USA 102, 1225312258.
Bader, M.-F., Doussau, F., Chasserot-Golaz, S., Vitale, N., Gasman, S. (2004). Coupling actin and membrane dynamics during calcium-regulated exocytosis: a role for Rho and ARF GTPases. Biochim. Biophys. Acta 1742, 3749.[Medline]
Bader, M.-F., Holz, R. W., Kumakura, K., Vitale, N. (2002). Exocytosis: the chromaffin cell as a model system. Ann. NY Acad. Sci 971, 178183.[Medline]
Baumgartner, M., Patel, H., Barber, D. L. (2004). Na(+)/H(+) exchanger NHE1 as plasma membrane scaffold in the assembly of signaling complexes. Am. J. Physiol. Cell 287, C844C850.
Biemesderfer, M., Mentone, S. A., Mooseker, M., Hasson, T. (2002). Expression of myosin VI within the early endocytic pathway in adult and developing proximal tubules. Am. J. Physiol 282, F785F794.
Bretscher, A., Edwards, K., Fehon, R. G. (2002). ERM proteins and merlin: integrators at the cell cortex. Nat. Rev. Mol. Cell. Biol 3, 586599.[CrossRef][Medline]
Cabado, A. G., Yu, F. H., Kapus, A., Lukacs, G., Grinstein, S., Orlowski., J. (1996). Distinct structural domains confer cAMP sensitivity and ATP dependence to the Na+/H+ exchanger NHE3 isoform. J. Biol. Chem 271, 35903599.
Cavet, M. E., Akhter, S., Murtazina, R., Sanchez de Medina, F., Tse, C. M., Donowitz, M. (2001). Half-lives of plasma membrane Na(+)/H(+) exchangers NHE1-3, plasma membrane NHE2 has a rapid rate of degradation. Am. J. Physiol 281, C2039C2048.
Cha, B., Kenworthy, A., Murtazina, R., Donowitz, M. (2004). The lateral mobility of NHE3 on the apical membrane of renal epithelial OK cells is limited by the PDZ domain proteins NHERF1/2, but is dependent on an intact actin cytoskeleton as determined by FRAP. J. Cell Sci 117, 33533365.
Cha, B., et al. (2005). cGMP inhibition of Na+/H+ antiporter 3 (NHE3) requires PDZ domain adapter NHERF2, a broad specificity protein kinase G-anchoring protein. J. Biol. Chem 280, 1664216650.
Cha, B., Oh, S., Shanmugaratnam, J., Donowitz, M., Yun, C. C. (2003). Two histidine residues in the juxta-membrane cytoplasmic domain of Na+/H+ exchanger isoform 3 (NHE3) determine the set point. J. Membr. Biol 191, 4958.[CrossRef][Medline]
Chambers, D. N. and Bretscher, A. (2005). Ezrin mutants affecting dimerization and activation. Biochemistry 44, 39263932.[CrossRef][Medline]
Denker, S. P. and Barber, D. L. (2002). Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1. J. Cell Biol 159, 10871096.
Denker, S. P., Huang, D. C., Orlowski, J., Furthmayr, H., Barber, D. L. (2000). Direct binding of the Na-H exchanger NHE1 to ERM proteins regulates the cortical cytoskeleton and cell shape independently of H(+) translocation. Mol. Cell 6, 14251436.[CrossRef][Medline]
Donowitz, M., Cha, B., Zachos, N. C., Brett, C. L., Sharma, A., Tse, C. M., Li, X. (2005). NHERF family and NHE3 regulation. J. Physiol 567, 311.
D'Souza, S., Garcia-Cabado, A., Yu, F., Teter, K., Lukacs, G., Skorecki, K., Moore, H. P., Orlowski, J., Grinstein, S. (1998). The epithelial sodium-hydrogen antiporter Na+/H+ exchanger 3 accumulates and is functional in recycling endosomes. J. Biol. Chem 273, 20352043.
Finnerty, C. M., Chambers, D., Ingraffea, J., Faber, H. R., Karplus, P. A., Bretscher, A. (2004). The EBP50-moesin interaction involves a binding site regulated by direct masking on the FERM domain. J. Cell Sci 117, 15471552.
Gautreau, A., Poullet, P., Louvard, D., Arpin, M. (1999). Ezrin, a plasma membrane-microfilament linker, signals cell survival through the phosphati dylinositol 3-kinase/Akt pathway. Proc. Natl. Acad. Sci. USA 96, 73007305.
Hall, R. A., et al. (1998). The beta2-adrenergic receptor interacts with the Na+/H+-exchanger regulatory factor to control Na+/H+ exchange. Nature 392, 626630.[CrossRef][Medline]
Hamada, K., Shimizu, T. L., Matsui, T., Tsukita, M., Tsukita, S., Hakoshima, T. (2000). Structural basis of the membrane-targeting and unmasking mechanisms of the radixin FERM domain. EMBO J 22, 502514.[CrossRef]
Hamada, K., Shimizu, T., Yonemura, S., Tsukita, S., Tsukita, S., Hakoshima, T. (2003). Structural basis of adhesion-molecule recognition by ERM proteins revealed by the crystal structure of the radixin-ICAM-2 complex. EMBO J 22, 502514.[CrossRef][Medline]
Hasson, T. (2003). Myosin VI: two distinct roles in endocytosis. J. Cell Sci 116, 34533461.
Heiska, L., Alfthan, K., Gronholm, M., Vilja, P., Vaheri, A., Carpen, O. (1998). Association of ezrin with intercellular adhesion molecule-1 and -2 (ICAM-1 and ICAM2). Regulation by phosphatidylinositol 4, 5-bisphosphate. J. Biol. Chem 273, 2189321900.
Helander, T. S., Carpen, O., Turunen, O., Kovanen, P. E., Vaheri, A., Timonon, T. (1996). ICAM-2 redistributed by ezrin as a target for killer cells. Nature 382, 265268.[CrossRef][Medline]
Ikeda, T., Schmitt, B., Pouyssegur, J., Wakabayashi, S., Shigekawa, M. (1997). Identification of cytoplasmic subdomains that control pH-sensing of the Na+/H+ exchanger (NHE1): pH-maintenance, ATP-sensitive, and flexible loop domains. J. Biochem 121, 295303.
Kim, J. H., Lee-Kwon, W., Park, J. B., Sung, H. R., Yun, C.H.C., Donowitz, M. (2002). Ca(2+)-dependent inhibition of Na+/H+ exchanger 3 (NHE3) requires an NHE3E3KARP-alpha-actinin-4 complex for oligomerization and endocytosis. J. Biol. Chem 277, 2371423724.
Lee-Kwon, W., Kawano, K., Choi, J. W., Kim, J. H., Donowitz, M. (2003). Lysophosphatidic acid stimulates brush border Na+/H+ exchanger 3 (NHE3) activity by increasing its exocytosis by an NHE3 kinase A regulatory protein-dependent mechanism. J. Biol. Chem 278, 1649416501.
Levine, S. A., Nath, S. K., Yun, C. H., Yip, J. W., Montrose, M., Donowitz, M., Tse, C. M. (1995). Separate C-terminal domains of the epithelial specific brush border Na+/H+ exchanger isoform NHE3 are involved in stimulation and inhibition by protein kinases/growth factors. J. Biol. Chem 270, 1371613725.
Li, X., Zhang, H., Cheong, A., Leu, S., Chen, Y., Elowsky, C. G., Donowitz, M. (2004). Carbachol regulation of rabbit ileal brush border Na+-H+ exchanger 3 (NHE3) occurs through changes in NHE3 trafficking and complex formation and is Src dependent. J. Physiol 556, 791804.
Lozupone, F., Lugini, L., Matarrese, P., Luciani, F., Federici, C., Iessi, E., Margutti, P., Stassi, G., Malorni, W., Fais, S. (2004). Identification and relevance of the CD95-binding domain in the N-terminal region of ezrin. J. Biol. Chem 279, 91999207.
Pearson, M. A., Reczek, D., Bretscher, A., Karplus, P. A. (2000). Structure of the ERM protein moesin reveals the FERM domain fold masked by an extended actin binding tail domain. Cell 101, 259270.[CrossRef][Medline]
Pouyssegur, J., Sardet, C., Franchi, A., L'Allemain, G., Paris, S. (1984). A specific mutation abolishing Na+/H+ antiport activity in hamster fibroblasts precludes growth at neural and acidic pH. Proc. Natl. Acad. Sci. USA 81, 48334837.
Reczek, D. and Bretscher, A. (1998). The carboxyl-terminal region of EBP50 binds to a site in the amino-terminal domain of ezrin that is masked in the dormant molecule. J. Biol. Chem 273, 1845218458.
Rudich, A. and Klip, A. (2003). Push/pull mechanisms of GLUT4 traffic in muscle cells. Acta Physiol. Scand 178, 297308.[CrossRef][Medline]
Schmieder, S., Nagai, M., Orlando, R. A., Takeda, T., Farquhar, M. G. (2004). Podocalyxin activates RhoA and induces actin reorganization through NHERF1 and Ezrin in MDCK cells. J. Am. Soc. Nephrol 15, 22892298.
Shenolikar, S., Voltz, J. W., Cunningham, R., Weinman, E. J. (2004). Regulation of ion transport by the NHERF family of PDZ proteins. Physiology 19, 362369.
Smith, W. J. and Cerione, R. A. (2002). Crystallization and preliminary crystallographic analysis of the ezrin FERM domain. Acta Crystallogr. D. Biol. Crystallogr 58, 13591361.[CrossRef][Medline]
Smith, W. J., Nassar, N., Bretscher, A., Cerione, R. A., Karplus, P. A. (2003). Structure of the active N-terminal domain of Ezrin. Conformational and mobility changes identify keystone interactions. J. Biol. Chem 278, 49494956.
Sun, F., Hug, M. J., Lewarchik, C. M., Yun, C. H., Bradbury, N. A., Frizzell, R. A. (2000). E3KARP mediates the association of ezrin and protein kinase A with the cystic fibrosis transmembrane conductance regulator in airway cells. J. Biol. Chem 275, 539546.
Tsukita, S., Oishi, K., Sato, N., Sagara, J., Kawai, A., Tsukita, S. (1994). ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J. Cell Biol 126, 391401.
Valentijn, K., Valentijn, J. A., Jamieson, J. D. (1999). Role of actin in regulated exocytosis and compensatory membrane retrieval: insights from an old acquaintance. Biochem. Biophys. Res. Commun 266, 652661.[CrossRef][Medline]
Wakabayashi, S., Fafournoux, P., Sardet, C., Pouyssegur, J. (1992). The Na+/H+ antiporter cytoplasmic domain mediates growth factor signals and controls "H(+)-sensing". Proc. Natl. Acad. Sci. USA 89, 24242428.
Wakabayashi, S., Hisamitsu, T., Pang, T., Shigekawa, M. (2003). Kinetic dissection of two distinct proton binding sites in Na+/H+ exchangers by measurement of reverse mode reaction. J. Biol. Chem 278, 4358043585.
Wang, S., Raab, R. W., Schatz, P. J., Guggino, W. B., Li, M. (1998). Peptide binding consensus of the NHE-RF-PDZ1 domain matches the C-terminal sequence of cystic fibrosis transmembrane conductance regulator (CFTR). FEBS Lett 427, 103108.[CrossRef][Medline]
Ward, R. E. IV, Schweizer, L., Lamb, R. S., Fehon, R. G. (2001). The protein 4.1, ezrin, radixin, moesin (FERM) domain of Drosophila Coracle, a cytoplasmic component of the septate junction, provides functions essential for embryonic development and imaginal cell proliferation. Genetics 159, 219228.
Weinman, E. J., Steplock, D., Donowitz, M., Shenolikar, S. (2000). NHERF associations with sodium-hydrogen exchanger isoform 3 (NHE3) and ezrin are essential for cAMP-mediated phosphorylation and inhibition of NHE3. Biochemistry 23, 61236129.
Wenk, M. R. and Camilli, P. (2004). Protein-lipid interactions and phosphoinositide metabolism in membrane traffic: insights from vesicle recycling in nerve terminals. Proc. Natl. Acad. Sci. USA 101, 82628269.
Yonemura, S., Hirao, M., Doi, Y., Takahashi, N., Kondo, T., Tsukita, S., Tsukita, S. (1998). Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J. Cell Biol 140, 885895.
Yun, C. H., Lamprecht, G., Forster, D. V., Sidor, A. (1998). NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ezrin. J. Biol. Chem 273, 2585625863.
Yun, C.H.C., Oh, S., Zizak, M., Steplock, D., Tsao, S., Tse, C. M., Weinman, E., Donowitz, M. (1997). cAMP-mediated inhibition of the epithelial brush border Na+/H+ exchanger, NHE3, requires an associated regulatory protein. Proc. Natl. Acad. Sci. USA 94, 30103015.
Zachos, N., Tse, M., Donowitz, M. (2005). Molecular physiology of intestinal Na+/H+ exchange. Annu. Rev. Physiol 67, 411443.[CrossRef][Medline]
Zizak, M., Lamprecht, G., Steplock, D., Tariq, N., Shenolikar, S., Donowitz, M., Yun, C.H.C., Weinman, E. J. (1999). cAMP-induced phosphorylation and inhibition of Na(+)/H(+) exchanger 3 (NHE3) are dependent on the presence but not the phosphorylation of NHE regulatory factor. J. Biol. Chem 274, 2475324758.
This article has been cited by other articles:
![]() |
R. T. Alexander and S. Grinstein Tethering, recycling and activation of the epithelial sodium-proton exchanger, NHE3 J. Exp. Biol., June 1, 2009; 212(11): 1630 - 1637. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Donowitz, S. Mohan, C. X. Zhu, T.-E Chen, R. Lin, B. Cha, N. C. Zachos, R. Murtazina, R. Sarker, and X. Li NHE3 regulatory complexes J. Exp. Biol., June 1, 2009; 212(11): 1638 - 1646. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. M. Riquier, D. H. Lee, and A. A. McDonough Renal NHE3 and NaPi2 partition into distinct membrane domains Am J Physiol Cell Physiol, April 1, 2009; 296(4): C900 - C910. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sarker, M. Gronborg, B. Cha, S. Mohan, Y. Chen, A. Pandey, D. Litchfield, M. Donowitz, and X. Li Casein Kinase 2 Binds to the C Terminus of Na+/H+ exchanger 3 (NHE3) and Stimulates NHE3 Basal Activity by Phosphorylating a Separate Site in NHE3 Mol. Biol. Cell, September 1, 2008; 19(9): 3859 - 3870. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yang, H.-C. Huang, H. Yin, R. J. Alpern, and P. A. Preisig RhoA required for acid-induced stress fiber formation and trafficking and activation of NHE3 Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1054 - F1064. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Donowitz and X. Li Regulatory Binding Partners and Complexes of NHE3 Physiol Rev, July 1, 2007; 87(3): 825 - 872. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kocinsky, D. W. Dynia, T. Wang, and P. S. Aronson NHE3 phosphorylation at serines 552 and 605 does not directly affect NHE3 activity Am J Physiol Renal Physiol, July 1, 2007; 293(1): F212 - F218. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||