![]() |
|
|
Vol. 17, Issue 6, 2707-2721, June 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3
1 and
6
4 Integrindependent Tumor Cell Functions on Laminin-5


*University of Iowa, Department of Biological Sciences, Iowa City, IA 52240; and
School of Biomedical Sciences, Medical Sciences Building, University of Newcastle, Callaghan NSW 2308, Australia
Submitted November 14, 2005;
Revised March 9, 2006;
Accepted March 20, 2006
Monitoring Editor: Mark Ginsberg
| ABSTRACT |
|---|
|
|
|---|
3
1 and
6
4. To determine the role of CD151 in tumor cell responses to laminin-5, we used retroviral RNA interference to efficiently silence CD151 expression in epidermal carcinoma cells. Near total loss of CD151 had no effect on steady state cell surface expression of
3
1,
6
4, or other integrins with which CD151 associates. However, CD151-silenced carcinoma cells displayed markedly impaired motility on laminin-5, accompanied by unusually persistent lateral and trailing edge adhesive contacts. CD151 silencing disrupted
3
1 integrin association with tetraspanin-enriched microdomains, reduced the bulk detergent extractability of
3
1, and impaired
3
1 internalization in cells migrating on laminin-5. Both
3
1- and
6
4-dependent cell adhesion to laminin-5 were also impaired in CD151-silenced cells. Reexpressing CD151 in CD151-silenced cells reversed the adhesion and motility defects. Finally, loss of CD151 also impaired migration but not adhesion on substrates other than laminin-5. These data show that CD151 plays a critical role in tumor cell responses to laminin-5 and reveal promotion of integrin recycling as a novel potential mechanism whereby CD151 regulates tumor cell migration. | INTRODUCTION |
|---|
|
|
|---|
The two major cellular receptors for laminin-5 are integrins
6
4 and
3
1. Integrin
6
4 mediates stable anchorage of epithelial cells to laminin-5 in the basement membrane, whereas
3
1 integrin mediates laminin-5dependent cell spreading and migration (Nguyen et al., 2000b
; Hintermann and Quaranta, 2004
). Consistent with its role in motility on laminin-5, several studies have documented
3
1 function in carcinoma (Morini et al., 2000
), glioma (Tysnes et al., 1996
; Fukushima et al., 1998
), rhabdosarcoma (Kubota et al., 1997
), melanoma (Melchiori et al., 1995
), and fibrosarcoma (Okada et al., 1994
) cell invasion of basement membrane or endothelial cell layers, and increased
3
1 expression has been linked to tumor progression (Ziober et al., 1996
), increased invasiveness, and propensity to metastasize (Giannelli et al., 2002
). However,
6
4 signaling through PI 3-kinase may have a positive (Nguyen et al., 2000a
) or negative (Hintermann et al., 2001
) impact on
3
1 function, depending on the experimental paradigm, and
6
4 itself may be capable of switching from an intermediate filamentassociated state, involved in stable cell adhesion, to an actin filamentassociated, promigratory state (Mercurio et al., 2001
). Furthermore, despite its predominant role in laminin-5dependent migration,
3
1 also contributes to basement membrane integrity (DiPersio et al., 1997
), and keratinocyte survival (Manohar et al., 2004
). Thus,
6
4 and
3
1 may each mediate both migratory and nonmigratory responses to laminin-5, and the interplay between these two receptors may determine the extent to which carcinoma cells can utilize laminin-5 for invasion and dispersal.
One protein with the potential to regulate both
6
4 and
3
1 function in tumor cell motility is tetraspanin CD151. CD151 engages both integrins in lateral cell surface complexes (Yauch et al., 1998
; Sincock et al., 1999
; Sterk et al., 2000
), and the
3
1-CD151 interaction in particular is nearly stoichiometric in many cell types and resistant to harsh detergents (Yauch et al., 1998
). Anti-CD151 antibodies (Stipp and Hemler, 2000
) or expression of CD151 mutants (Kazarov et al., 2002
; Zhang et al., 2002
) can selectively inhibit
3 and
6 integrindependent cell migration in some experimental settings, whereas overexpression of wild-type CD151 enhances experimental metastasis of colon carcinoma and fibrosarcoma cells (Kohno et al., 2002
). CD151 also emerged from a subtractive immunization strategy as the target of an anti-metastatic antibody (Testa et al., 1999
), and elevated CD151 expression in lung, colon, and prostate cancers correlates with poor clinical outcome (Tokuhara et al., 2001
; Hashida et al., 2003
; Ang et al., 2004
).
As a member of the tetraspanin family, CD151 possesses four transmembrane domains, cytoplasmic amino and carboxyl termini, and two extracellular loops, the larger of which contains the distinctive pattern of cysteine residues that help to define the family. Tetraspanins may act as adaptors or organizers by assembling multimolecular complexes of cell surface proteins and linking them to specific cytoplasmic signaling enzymes such as classical protein kinase C (PKC) isoforms and PI 4-kinase (Berditchevski, 2001
; Boucheix and Rubinstein, 2001
; Stipp et al., 2003b
; Hemler, 2005
). Individual tetraspanins may preferentially associate with specific cell surface partners such as integrins, growth factor receptors, and immunoglobulin superfamily proteins, and link these partners, via tetraspanintetraspanin interactions, into extended complexes. The organization of extended tetraspanin complexes has been envisioned as a web (Boucheix and Rubinstein, 2001
), and more recently, as tetraspanin-enriched microdomains (TEMs), a novel type of cell surface microdomain that is biochemically distinct from lipid rafts (Claas et al., 2001
; Hemler, 2005
).
Unlike
3 and
6 integrin-null mice, CD151-null mice are viable and fertile (Wright et al., 2004
), indicating that despite its physical and functional association with
3 and
6 integrins, CD151 is not essential for
3- or
6-dependent morphogenesis during development. However, CD151-null mice do exhibit defects in platelet aggregation and keratinocyte migration (Wright et al., 2004
), as well as wound healing in vivo (Cowin et al., 2006
), and CD151-deficient human patients develop kidney disease and epidermolysis later in life (Karamatic Crew et al., 2004
) that are reminiscent of some of the severe developmental defects observed in mice lacking
3 or
6 integrin (Dowling et al., 1996
; Georges-Labouesse et al., 1996
; Kreidberg et al., 1996
; DiPersio et al., 1997
).
Despite the abundance of evidence linking CD151 to
3 and
6 integrin functions in cell motility and metastasis, the CD151 loss-of-function phenotype of transformed cells has not been described. Here we developed an RNA interference (RNAi) strategy to efficiently silence CD151 expression in A431 epidermoid carcinoma cells. We find that near total loss of CD151 has no effect on steady state cell surface expression of
3 or
6 integrin, but that CD151 plays a critical role in
3 integrindependent cell motility and
6 integrindependent attachment and spreading on laminin-5. Our data definitively identify CD151 as a key regulator of
3 and
6 integrin functions in transformed cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2, A2-IIE10 (Bergelson et al., 1994
3, A3-X8 and A3-IIF5 (Weitzman et al., 1993
5, P1D6 (Covance Research Products, Madison, WI); anti-
6, A6-ELE (Lee et al., 1995
v, 69-6-5 (Biodesign International, Saco, ME), and anti-
1, TS2/16 (Hemler et al., 1984
3 integrin polyclonal antibody, D23 (Kazarov et al., 2002
Rat tail collagen I and human plasma fibronectin were purchased from BD Biosciences (San Diego, CA); human plasma vitronectin was obtained from Takara Bio (Tokyo, Japan.) Human laminin-5 was purified from SCC-25 squamous cell carcinomaconditioned medium as described (Marinkovich et al., 1992
), with some modifications. Freshly confluent SCC-25 cells were rinsed with phosphate-buffered saline (PBS) and then refed with a 1:1 serum-free mixture of DME and F12 medium containing 0.4 µg/ml hydrocortisone (H0888, Sigma-Aldrich, St. Louis, MO) and 1 µg/ml each aprotinin and leupeptin (Roche Diagnostics, Indianapolis, IN). After 2 d, conditioned medium was harvested, clarified by centrifugation at 16,000 x g for 20 min, and supplemented with Tris-HCl, pH 7.4 (50 mM final), Tween-20 (0.1% final; Sigma-Aldrich), and phenylmethylsulfonyl fluoride (PMSF; 2 mM final, Sigma-Aldrich). Conditioned medium was passed over a gelatin-Sepharose column (Sigma-Aldrich) before loading onto an affinity column consisting of the 6F12 anti-laminin-5 antibody coupled to Affigel-10 matrix (Bio-Rad Laboratories, Richmond, CA). After washing with 50 column volumes of 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween-20, laminin-5 was eluted with 1 M acetic acid, 0.1% Tween-20 and neutralized with 1.5 M Tris-HCl, pH 8.8, 0.1% Tween-20. Protein concentration of pooled peak fractions was determined by BCA assay (Pierce Biotechnology, Rockford, IL), and purity was confirmed with silver-stained SDS-polyacrylamide gel electrophoresis (PAGE) gels.
Cell Culture, RNAi, and Retroviral Transduction
A431 epithelial carcinoma cells and retroviral packaging cell lines, GP2-293 and PT67 (BD Biosciences), were cultured in high glucose DME. SCC-25 squamous carcinoma cells were cultured in a 1:1 mixture of DME and F12 media supplemented with 0.4 µg/ml hydrocortisone. All cultures were supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (all from Invitrogen). For RNAi, double-stranded oligonucleotides encoding short hairpin RNAs (shRNAs) targeting the human CD151 mRNA were annealed and then cloned into the pSIREN-RetroQ retroviral vector (BD Biosciences). Three shRNAs targeting different sequences were tested: the sh1 targeting sequence is TGCTGGAGATCATCGCTGGTA; the sh2 targeting sequence is GCGAGACCATGCCTCCAACAT, and the sh3 targeting sequence is AGTACCTGCTGTTTACCTACA. These constructs were cotransfected with the pVSV-G retroviral coat protein expression vector into GP2-293 packaging cells using the calcium phosphate method. At 48 h and again at 96 h after transfection, virus-containing medium was collected, 0.45 µm filtered, supplemented with 4 µg/ml polybrene (Sigma-Aldrich), and then used to transduce A431 cells. Stable A431 transductants were selected with 3 µg/ml puromycin (Sigma-Aldrich) and maintained in 0.1 µg/ml puromycin.
For CD151 reexpression experiments in A431 sh3 cells, recombinant PCR was used to construct a CD151 cDNA bearing two silent mutations within the sh3 targeting sequence. This CD151 cDNA, which we named CD151 Rx, was cloned into the LXIN retroviral vector and cotransfected with the pVSV-G retroviral coat protein vector into GP2-293 packaging cells, as above. The resulting virus-containing medium was used to transduce PT67 retroviral packaging cells, and stably transduced cells were selected with 0.5 mg/ml G418 (Invitrogen). Virus-containing medium from these stably-transduced PT67 cells was then used to transduce A431 sh3 cells, which were selected with 0.5 mg/ml G418 while maintaining selection with 0.1 µg/ml puromycin to retain the sh3 shRNA retroviral vector. Restoration of CD151 expression in these cells, which we named A431 sh3 Rx, was confirmed by flow cytometry.
Immunoprecipitation and Immunoblotting
A431 cells were lysed by scraping into 20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM MgCl2 (HBSM) supplemented with 1% detergent, and protease inhibitors (2 mM PMSF, 10 µg/ml aprotinin, 5 µg/ml leupeptin, and 5 µg/ml E-64; Roche Diagnostics). Detergents were Brij 96V or Triton X-100 (both from Sigma-Aldrich). In some experiments, cells were biotinylated with 0.1 mg/ml Sulfo-NHS-LC biotin (Pierce Biotechnology) in HBSM for 1 h at room temperature and then rinsed three times with HBSM before lysis. After a 1-h extraction at 4°C with rocking, insoluble material was removed by centrifugation at 16,000 x g for 15 min, and lysates were precleared for 1 h at 4°C with protein G-Sepharose (Pierce Biotechnology) and then centrifuged as before. Protein concentrations in lysates of different cell types were normalized according to the results of a BCA assay (Pierce Biotechnology), specific antibodies plus protein G-Sepharose were added, and immune complexes were collected overnight at 4°C. After rinsing four times with lysis buffer, immune complexes were eluted by boiling in sample buffer, resolved by SDS-PAGE, and transferred to nitrocellulose. Blots were blocked with 5% nonfat milk in PBST (PBS with 0.1% Tween-20) and probed with one of the following antibodies, diluted in blocking buffer: 8A12 anti-EWI-2 ascites (1:2000), C9-BB anti-CD9 (10 µg/ml), biotinylated M38 anti-CD81 (10 µg/ml), or D23 polyclonal anti-
3 integrin (5 µg/ml). Blots were developed with HRP-goat anti-mouse or HRP-goat anti-rabbit secondary antibodies (1:6000) followed by chemiluminescence (Western Lightning reagent, Perkin Elmer-Cetus, Norwalk, CT). Biotinylated proteins were detected with Extravidin-HRP (Sigma-Aldrich), diluted 1:2000 in PBST, followed by chemiluminescence.
Flow Cytometry and Cell Sorting
A431 cells were stained on ice for 1 h with negative control or specific primary antibodies at 5 µg/ml in blocking buffer (PBS with 10% heat-inactivated goat serum and 0.02% sodium azide). After three rinses in cold PBS, cells were stained on ice for 45 min with an Cy2-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch) diluted 1:200 in blocking buffer. After three additional rinses, cells were analyzed on a FACScan flow cytometer (Becton Dickinson, Lincoln Park, NJ). For cell sorting, sodium azide was omitted during staining, and cells were sorted on a fluorescence-activated cell sorting (FACS) DiVa instrument (Becton Dickinson).
Time-Lapse Motility Assays
A431 cells were plated at 5 x 105 cells per 25 cm2 flask on day 1 and starved overnight on day 2 in SFM (DME with 5 mg/ml cell culture grade BSA; Sigma-Aldrich) and 25 mM HEPES, pH 7.2). On day 3, cells were harvested by treating with trypsin-EDTA for 3 min at 37°C and collected in SFM supplemented with 0.1 mg/ml soybean trypsin inhibitor and 20 µg/ml DNAse I (Worthington Biochemical, Lakewood, NJ). After centrifugation, cells were resuspended in SFM, and 2.3 x 105 cells were plated to 35-mm dishes that had been coated overnight with 1 µg/ml laminin-5, 40 µg/ml collagen I, or 50 µg/ml fibronectin. In some experiments, function blocking antibodies were added to 10 µg/ml for 10 min before plating cells in the continued presence of the antibodies. Cultures were maintained on a Leica DMIRE2 inverted microscope (Deerfield, IL) in a stage incubator (20/20 Technology, Wilmington, NC) providing a humidified, 5% CO2, 37°C atmosphere. OpenLab software (Improvision, Lexington, MA) running on an Apple iMac computer controlled illumination and image acquisition (Cupertino, CA). After allowing 10 min for cells to settle, images were acquired at a rate of 1 frame/min for 36 h, using a Hamamatsu ORCA-285 CCD camera (Bridgewater, NJ) and a 20x C Plan phase objective. NIH Image 1.63 software was used to record the XY position of cell centroids in frames 10 min apart. Custom Java software (code available upon request) was then used to calculate for each cell 1) the distance traveled in each 10-min interval, 2) cumulative distance traveled versus time, 3) total distance traveled, and 4) mean velocity. In initial quantification of the assays, every cell in each field was followed for as long as it remained in view. All cells that could be tracked for at least 1 h were included in the final calculation of velocity. Subsequently, cells that remained free of cellcell contact for at least 1 h were analyzed separately during contact-free intervals. In addition, selected videos were analyzed hour-by-hour to determine whether average velocities varied during the 3-h assay. To measure directional persistence, cells were allowed to attach and begin migrating for 1 h. The ratio of net migration distance divided by total migration distance for all the individual cells in the field was then calculated during two subsequent 1-h intervals. This ratio could range from 1.0 (for cells that moved unidirectionally for a whole 1-h interval) to 0.0 (for cells that arrived precisely back at their starting location at the end of a 1-h interval). Only cells that remained in view for an entire 1-h interval were used in the calculations.
To quantify lateral and trailing edge morphology, movies were scanned manually frame by frame for the appearance and persistence of lateral and trailing edge adhesive contacts, defined operationally as a region of cellsubstratum contact that became visually distinct from the remainder of the lateral and trailing edges (see Figure 6A). An event was defined as an adhesive contact that persisted for
4 min, and the number of events per cell and the mean duration of the events was determined by analyzing the behavior of every cell in the movie field over the 3-h duration of the movie. Four movies per cell type were analyzed.
Detergent Solubility Experiments
Cells, 1.5 x 106, were seeded into the wells of six-well plates. The next day, cells were biotinylated as above, rinsed with HBSM, and gently overlaid with ice-cold 1% Brij 98 (Sigma-Aldrich) in HBSM with protease inhibitors. Cells were extracted for 20 min on ice, with gentle swirling every 5 min, and then the Brij 98 extracts were removed to separate tubes. Next, Brij 98insoluble material was collected by scraping the cell layers into 1% Triton X-100, 0.1% SDS in HBSM with protease inhibitors and extracting for 1 h at 4°C. All extracts were then clarified and precleared with protein G-Sepharose as described above, before
3
1 integrin immunoprecipitation. Immunoprecipitates were resolved by SDS-PAGE, blotted with ExtrAvidin-HRP, and visualized by chemiluminescence. For each well, the ratio of Brij 98soluble to Brij 98insoluble
3
1 was determined by semiquantitative densitometry of transilluminated films using GeneTools software (Corvallis, OR) on digitized images captured with a CCD camera in a GeneFlash imaging cabinet (SYNGENE, Frederick, MD).
3
1 Integrin Internalization Experiments
Internalization and recycling assays were performed as described (Fabbri et al., 1999
), with minor modifications. Cells were starved overnight in SFM and harvested as in time-lapse motility assays above. Cells, 5 x 105, were plated in 35-mm dishes that had been coated with 1 µg/ml laminin-5 and blocked with 5 mg/ml BSA. Cells were returned to the 37°C 5% CO2 incubator for 45 min to allow cells to attach and begin migrating. Dishes were then placed on ice, and cells were rinsed twice with ice-cold HBSM before labeling for 45 min on ice with 0.5 mg/ml Sulfo-NHS-SS-biotin (Pierce Biotechnology). After rinsing twice with cold HBSM, individual dishes were returned to the 37°C incubator at staggered time points for total periods ranging from 0 to 30 min. All dishes were then returned to ice and rinsed once with ice-cold HBSM to stop any further trafficking. To strip biotin from labeled proteins remaining on the cell surface, cells were treated twice for 20 min with 42 mM glutathione (reduced form), 75 mM NaCl, 75 mM NaOH, and 1% BSA. One dish for each cell type was left untreated for measuring total labeled
3
1 integrin. Cells were rinsed two more times with cold HBSM and then lysed in 1% Triton X-100 in HBSM with protease inhibitors, as described above. Integrin
3 was then immunoprecipitated, visualized with ExtrAvidin-HRP and chemiluminescence, and analyzed with semiquantitative densitometry, as above. In a separate trial, samples were prepared, electrophoresed, and transferred to nitrocellulose as described above. Samples were then visualized by blotting with 1) the D23 polyclonal anti-
3 integrin antibody followed by Alexa 680conjugated goat anti-rabbit secondary, and 2) IRdye 800conjugated avidin (Rockland, Gilbertsville, PA). The blot was imaged and quantified using the 700- and 800-nm channels of a LiCor infrared fluorescence gel imaging system (Li-Cor, Lincoln, NE), and the ratio of biotinylated
3 signal to total
3 signal was calculated.
Immunostaining
A431 cells were starved overnight in SFM, as for time-lapse assays, and then plated in SFM on acid-washed glass coverslips coated with 1 µg/ml laminin-5. Cells were allowed 1 h to attach, spread, and begin migrating and then fixed 15 min with 10% Formalin (Sigma-Aldrich) in PBS with 2 mM MgCl2 and 4% sucrose. Cells were rinsed with Tris-buffered saline, pH 8, and then blocked with 10% heat-inactivated goat serum in PBS. Cells were then stained with 2 µg/ml primary antibody in blocking buffer, rinsed, and stained with Cy2 goat anti-mouse secondary antibody, as for flow cytometry. Alternatively, for colocalization experiments, cells were permeabilized with 0.1% saponin during the blocking step and then stained with D23 polyclonal anti-
3 integrin and 5C11 monoclonal anti-CD151 antibodies, followed by Alexa 594 goat anti-rabbit and Cy2 goat anti-mouse secondary antibodies. Coverslips were mounted in FluorSave reagent (Calbiochem) and photographed with the video system described above. Positive and negative controls were imaged with identical parameters and processed identically with Adobe Photoshop 7.0 (San Jose, CA). Image overlays for colocalization were performed with Adobe Photoshop.
Adhesion Assays
Substrates for adhesion assays were 1 µg/ml laminin-5, 40 or 5 µg/ml collagen I, 50 or 5 µg/ml fibronectin, 20 µg/ml vitronectin, 100 µg/ml poly-L-lysine (PLL; positive control) or 10 mg/ml heat-inactivated (HI) BSA (negative control). After overnight coating, wells were rinsed and blocked with 10 mg/ml HI BSA. Cells were starved overnight, harvested as for time-lapse motility assays, and resuspended at 3 x 105 cells per ml in serum-free medium, with or without 20 µg/ml specific function blocking antibodies. After allowing 10 min for antibody binding, 100 µl of cell suspension was plated to each of four substrate-coated wells per condition in a 96-well plate. After various times at 37°C, 5% CO2, wells were rinsed three times using a multichannel pipette with warm DME, 40 mM HEPES, pH 7.2. Positive control PLL wells were gently rinsed once. Cells remaining after rinses were fixed for 30 min at room temperature with warm 10% Formalin in PBS with 2 mM MgCl2 and then stained for 20 min at room temperature with freshly filtered 0.1% crystal violet in ddH2O. Cells were destained by rinsing three times with tap water, air-dried 10 min, and solubilized overnight with 100 µl/well of 1% Triton X-100 in ddH2O. Absorbance at 595 nm was determined with a plate reader. For each cell type, adhesion was expressed as fraction of input cells using absorbances in positive control PLL wells to determine total input. Values for total cells input always varied by <10% for the different cell types.
| RESULTS |
|---|
|
|
|---|
|
|
Given the unusually stable interaction of CD151 with
3
1 integrin (Yauch et al., 1998
), it also seemed possible that RNAi might not deplete the pool of CD151 associated with
3
1 to the same extent as it depleted total CD151. However, immunoblotting CD151 in
3
1 immunoprecipitates revealed that only a trace of CD151 was present in
3
1 immunoprecipitates from sh3 cells (Figure 1B, lane 8). In contrast, the amount of CD151 associated with
3
1 was comparable in wild-type, sh1, and sh2 cells (lanes 57). Examining
3
1 coprecipitation with CD151 from Triton X-100 extracts of cell surfacebiotinylated cells yielded similar results. Comparable amounts of
3
1 coprecipitated with CD151 in wild-type, sh1, and sh2 cells (Figure 1C, lanes 13), whereas very little
3
1 could be detected in a CD151 immunoprecipitate of sh3 cells (lane 4). This last experiment also revealed little if any difference in cell surface
3
1 expression in any of the cell types (lanes 58; see bottom panel for a lighter exposure), a result that was confirmed by flow cytometry (Table 1). Likewise, no differences were observed in cell surface expression of
6
4 integrin, another major CD151 partner, or
2
1 integrin, whose association with CD151 is detected in milder detergent conditions (Sincock et al., 1999
; Table 1). These data indicated that total, cell surface, and
3
1-associated pools of CD151 were efficiently silenced in sh3 cells without affecting expression of CD151's weakly or strongly interacting integrin partners.
Loss of CD151 Markedly Impairs
3
1-dependent Motility on Laminin-5
Because
3
1 and
6
4 both associate with CD151 and both serve as receptors for laminin-5, we first tested the relative contributions of these two integrins to A431 cell motility on laminin-5. In time-lapse videomicroscopy assays, untreated wild-type A431 cells displayed rapid, spontaneous migration in response to laminin-5 (Figure 2A). An anti-
3 integrin function blocking antibody almost completely abrogated A431 cell motility on laminin-5 (Figure 2B), whereas an anti-
6 function blocking antibody had no obvious effect (Figure 2C), suggesting that
3
1 integrin is primarily responsible for A431 cell motility on laminin-5.
|
50% reduction in the velocity of
3
1-dependent cell motility on laminin-5 (compare Figure 2, A and D; see also Supplementary Video, Figure 2.mov). Because it appeared that A431 sh3 cells may have been slower to adhere fully and spread on laminin-5 (Figure 2.mov), it seemed possible that part of their reduced velocity in our 3-h assay was due to delayed cell spreading at the beginning of the assay. To test this, we compared velocity of wild-type and sh3 cells hour by hour. As shown in Figure 2E, sh3 cells showed the same reduced velocity in hours 2 and 3 as they did in the first hour of the assay. This indicated that delayed attachment and spreading was unlikely to be the major factor in the reduced velocity of A431 sh3 cells. In our initial assays, every cell in each field was measured for as long as it remained in the field, regardless of whether it came into contact with other cells. During the 3-h time course of the assay, cell collisions were almost never observed to result in permanent cellcell adhesion (i.e., cells collided, but then continued moving without becoming permanently attached to each other). However, to rule out that altered behavior on cellcell contact was a major contributing factor in the reduced velocity of A431 sh3 cells, we compared the velocities of isolated wild-type and sh3 cells during intervals that were free of any visible cellcell contact. As shown in Figure 2F, in the absence of cellcell contact, we obtained results indistinguishable from results obtained by our initial measurements. These data indicated that the reduced velocity of A431 sh3 cells was due to an altered cellular response to laminin-5, not altered cellcell interactions.
In several independent trials, wild-type, sh1, and sh2 cells all showed similar, rapid migration on laminin-5, whereas sh3 cells consistently migrated about half as rapidly (Figure 2G). These data provided evidence that the reduced velocity of the sh3 cells was indeed the result of reduced CD151 expression and not the result of nonspecific effects from transduction with retroviral RNAi vectors. To confirm that reduced sh3 cell velocity on laminin-5 reflected altered
3
1 function, we performed several additional assays in the presence of the function-blocking anti-
6 integrin antibody, GoH3. As shown in Figure 2H, these experiments yielded results very similar to the results in Figure 2G, with sh3 cells displaying an
40% reduction in velocity. Although the velocity of wild-type cells treated with GoH3 appeared modestly reduced (
15%) compared with the velocity of untreated wild-type cells in Figure 2G, this difference did not rise to the level of statistical significance (p = 0.14, unpaired t test). Together with the data in Figure 2B, these data indicated that A431 cell motility on laminin-5 is strongly
3
1-dependent and that reduced sh3 velocity on laminin-5 was likely to be largely due to altered
3
1 integrin function.
The ability of sh1 and sh2 cells to migrate as rapidly as wild-type cells helps to rule out nonspecific effects of our retroviral RNAi vector system as the source of impaired migration in sh3 cells, but as a further control, we used cell sorting to isolate a small population of A431 sh3 cells that retained wild-type CD151 expression levels (Figure 3A). These CD151-positive sh3 "escapers" migrated with wild-type velocity, whereas sh3 cells selected for no CD151 staining above background continued to show the same reduced velocity observed in prior experiments (Figure 3B). These data provided further evidence that the loss of CD151 is specifically responsible for the reduced motility of the A431 sh3 cells.
|
3
1 Association with Tetraspanin-enriched Microdomains
3
1 biochemistry that might explain altered
3
1 function in CD151-silenced cells, we examined
3
1 association with TEMs in A431 wild-type, sh1, sh2, and sh3 cell populations. A working hypothesis is that, by associating with CD151,
3
1 is localized to TEMs by virtue of CD151's ability to engage in tetraspanintetraspanin interactions. Support for this hypothesis comes from studies of Daudi B lymphoma cells, which naturally lack CD151 (Charrin et al., 2003b
To assess
3
1 association with TEMs, we used coimmunoprecipitation to examine
3
1 interactions with tetraspanins CD9 and CD81 and the IgSF protein EWI-2, a major CD9 and CD81 partner (Clark et al., 2001
; Charrin et al., 2003a
; Stipp et al., 2003a
). These molecules were selected as representatives of TEMs because we previously showed that they form functionally relevant complexes with
3
1 integrin in the A431 cell environment (Stipp et al., 2003a
). As shown in Figure 4A,
3
1 integrin lost association with EWI-2 (lane 4, middle panel) and CD81 (lane 4, bottom panel) in CD151-silenced sh3 cells, but not in wild-type, sh1, or sh2 control cells (lanes 13). In a separate experiment, we also confirmed that
3
1 association with CD9 is disrupted in sh3 cells (Figure 4B, bottom panel, lane 3; note, samples are out of order), but not in wild-type, sh1, or sh2 cells (lanes 1, 2, and 4). Recovery of
3 integrin itself was similar in all cell types (Figures 4, A and B, top panels). These data indicated that
3
1 association with CD9/CD81-containing TEMs is disrupted in the absence of CD151.
|
3
1 detergent extractability was diminished in CD151-silenced A431 sh3 cells. We first extracted biotinylated A431 wild-type and sh3 cells for 20 min on ice with 1% Brij 98 detergent and then recovered Brij 98insoluble material by extracting a second time with 1% Triton X-100, 0.1% SDS. Next, we immunoprecipitated
3
1 from Brij 98 soluble and insoluble fractions. As shown in Figure 4C, significantly less
3
1 could be extracted by Brij 98 from A431 sh3 cells than from wild-type cells. Semiquantitative analysis of three separate determinations revealed a highly reproducible 33% decrease in the ratio of Brij 98soluble to Brij 98insoluble
3
1 in sh3 cells (Figure 4D). These data provided additional evidence that
3
1 association with TEMs is disrupted upon loss of CD151.
Impaired Adhesion of CD151-silenced Cells at Early Time Points on Laminin-5
In a recent report, partial siRNA knockdown of CD151 was reported to inhibit cell adhesion on the
3 integrin ligand, laminin-10 (Nishiuchi et al., 2005
). Therefore, we tested whether our CD151-silenced cells displayed impaired adhesion on laminin-5. A431 wild-type and sh3 cells were plated on ice in laminin-5coated wells, allowed to settle, and then placed at 37°C for varying amounts of time. As shown in Figure 5A, after 20 min at 37°, both wild-type and sh3 cells displayed adhesion above background, but adhesion of sh3 cells was modestly but significantly impaired (
30% reduction in specific adhesion above background for sh3 cells). After 30 min, adhesion of both cell types had increased, but sh3 cells continued to display a modest, but significant reduction in adhesion (
18% reduction in specific adhesion above background).
|
3 and
6 integrin function-blocking antibodies (Figure 5B). Interestingly, A431 sh3 cell adhesion to this endogenously generated laminin-5 was also diminished compared with wild-type cell adhesion (Figure 5B). Lastly, adhesion after 2 h to wells coated with exogenous laminin-5 was also abolished by anti-
3 and
6 integrin antibodies (Figure 5B), indicating that
3/
6 integrin-independent ligands had not been deposited in appreciable amounts on the laminin-5 substrate. Thus, sh3 cell adhesion to laminin-5 was initially reduced, but after 2 h it became indistinguishable from wild-type adhesion. In addition, A431 cells produce their own laminin-5, and sh3 cell adhesion on this endogenous laminin-5 is also reduced compared with wild-type cells.
Altered Lateral and Trailing Edge Morphology in A431 sh3 Cells Migrating on Laminin-5
Because A431 sh3 cells adhered as well as wild-type cells to laminin-5 after 2 h, yet continued to display impaired laminin-5dependent motility at this time point (Figure 2E), we examined motility of sh3 cells on laminin-5 in greater detail. We noticed that sh3 cells migrating on laminin-5 frequently exhibited persistent protrusions at their lateral and trailing edges, in contrast to the typically smooth trailing edges of wild-type A431 cells (Figure 6A, white arrows, see also Supplementary Video, Figure 6.mov). As sh3 cells continued to move, these protrusions appeared to come under significant tension, snapping back into the cell soma upon release, suggesting that they had been maintained by adhesive contact with the substrate. Quantification revealed that the frequency of apparent lateral and trailing edge adhesive events that persisted 4 min or longer was increased nearly twofold in sh3 cells compared with wild-type cells (Figure 6B). Furthermore, the mean lifetime of such events increased by 67%, from 6.5 min in wild-type cells to 10.7 min in sh3 cells (Figure 6C). As seen in Figure 6.mov (and in Figure 2.mov), in conjunction with persistent lateral and trailing edge adhesions, sh3 cells frequently appeared to change their direction of migration. We therefore tested whether directional persistence (defined as net migration distance divided by total migration distance) was reduced for sh3 cells. As shown in Figure 6D, sh3 cells displayed a 2544% reduction in directional persistence in two independent trials. Collectively, these data suggested that the decreased migration rate observed for sh3 cells might be due in part to altered
3
1 function at the lateral and trailing edges of the cells.
|
3
1 immunolocalization in wild-type and CD151-silenced cells. In unpermeabilized cells,
3 appeared widely distributed over the entire surface of both wild-type and sh3 cells (Figures 7, A and B). CD151 staining was also widely distributed on the surface of wild-type cells (Figure 7C), whereas sh3 cells appeared completely negative (Figure 7D). To study
3 integrin and CD151 distribution simultaneously, we double-labeled permeabilized cells with a CD151 mAb and an anti-
3 cytoplasmic tail polyclonal antibody. In wild-type cells,
3 again appeared widely distributed, with somewhat brighter staining of portions of the trailing edge and leading lamellipodia (Figure 7E). In sh3 cells, the brightest
3 staining was observed in lateral and trailing edge protrusions (Figure 7F). CD151 staining in permeabilized wild-type cells was again widely distributed (Figure 7G). A fraction of CD151 staining codistributed with
3 staining at the trailing edge of wild-type cells (Figure 7I, arrow). In permeabilized sh3 cells, a few cells displayed low levels of residual CD151 expression (Figure 7H), and this codistributed with
3 integrin in lateral/trailing edge protrusions (Figure 7J, arrow). Various cross-reactivity and negative controls revealed a very low level of background staining (Figure 7, KM). Because both CD151 and
3 integrin are widely distributed on the cell surface, precise colocalization will require high-resolution confocal analysis; however, these data were consistent with the possibility that CD151 regulates
3
1 integrin function at the lateral/trailing edge of migrating cells.
|
3
1 Trafficking in A431 sh3 Cells
3
1 trafficking might be altered in these cells. Given the previously described localization of CD151 to endocytic compartments (Sincock et al., 1999
3
1 internalization might be impaired in cells lacking CD151. To test this, we allowed wild-type and sh3 A431 cells to attach and spread on laminin-5, labeled them on ice with reducible biotin, and then returned them to 37°C to allow migration to resume. At specific time points, individual dishes were treated with cell impermeable alkaline glutathione to strip the biotin from proteins residing on the cell surface, cells were lysed, and internalized
3
1 integrin retaining the biotin label was recovered by immunoprecipitation. As shown in Figure 8A,
3
1 accumulated internally significantly faster in wild-type cells than in sh3 cells. Two independent trials yielded very similar results (Figure 8B). Nonlinear regression analysis of the data using pseudo first-order kinetics produced a good fit for both data sets (R2 = 0.99 and 0.98 for wild-type and sh3, respectively). The observed rate constant for
3
1 internalization was twofold lower for A431 sh3 cells than for wild-type cells (0.021 min vs. 0.041 min1, respectively).
|
-tubulin may not be the best control for
3 integrin immunoprecipitations, we repeated the internalization assay a third time and analyzed the results with a Li-Cor imaging system that allows detection and quantification in two separate fluorescent channels. Total
3 integrin was detected with an anti-
3 polyclonal antibody followed by an Alexa-680conjugated secondary antibody, and biotinylated
3 was simultaneously detected on the same blot with IRdye 800conjugated streptavidin (Figure 8C). Quantification revealed that the ratio of biotinylated
3 to total
3 increased more rapidly for wild-type cells than for sh3 cells and that the magnitude of the effect was similar to that which we observed in the first two trials (Figure 8D). These data support the view that the laminin-5 motility defect in CD151-silenced sh3 cells results at least in part from decreased efficiency of
3
1 internalization during migration.
Reexpression of CD151 in A431 sh3 Cells Reverses Defects in
3 and
6 Integrin Functions
A critical issue in RNAi experiments is the potential for off-target effects. To confirm that the phenotypes of our CD151-silenced cells were indeed due to the specific loss of CD151 expression, we performed reconstitution experiments. We first confirmed that our CD151-silenced cells, which had been sorted to be free of CD151-positive "escapers" (Figure 3), had not reexpressed CD151 over the intervening 23 wk (Figure 9A). We then transduced these cells with a CD151 retroviral expression vector (CD151 Rx), containing two silent mutations within the region targeted by the CD151 sh3 shRNA construct. These silent mutations defeated RNAi targeting, allowing CD151 to be reexpressed at wild-type levels (Figure 9A). We called these cells A431 sh3 Rx cells. Cell surface labeling experiments confirmed that the CD151-
3
1 integrin complex, which was virtually absent in A431 sh3 cells, was restored to wild-type levels in the A431 sh3 Rx cells (Figure 9B, lanes 13). All three cell types expressed a similar level of
3 integrin on the cell surface (Figure 9B, lanes 46).
|
3 integrin,
6 integrin is also a major CD151 partner (Kazarov et al., 2002
6 integrin function. Therefore, we tested for
6 integrin contributions to cell adhesion on laminin-5. Although a function-blocking anti-
6 integrin antibody by itself did not measurably reduce adhesion of any of the cell types to laminin-5 (Figure 9C, second set), wild-type parental cells did retain some
6 integrindependent adhesion to laminin-5 in the presence of an anti-
3 function blocking antibody (Figure 9C, third set). This
6-dependent adhesion was completely abolished in A431 sh3 cells but restored in A431 sh3 Rx cells.
The defect in
6-dependent sh3 cell adhesion was also dramatically illustrated by time-lapse assays of cells plated on laminin-5 in the presence of
3 function-blocking antibody (see Supplementary Video, Figure 9.mov). At the beginning of the assays, which started 15 min after plating, most wild-type cells appeared loosely adherent to the laminin-5 substrate, while many sh3 cells remained nonadherent and were swept along by current flow in the plating medium. At intermediate time points, sh3 cells remained loosely adherent and unspread, while many wild-type cells had begun to spread partially, extending short protrusions and/or small lamellipodia. These short protrusions appeared qualitatively different from the persistent lateral/trailing edge protrusions observed in migrating sh3 cells in Figure 6A and Figure 6.mov because 1) they formed circumferentially around the perimeter of the cells, 2) they were not associated with any significant translocation of the cell body, and 3) they were not observed to "snap back" into the soma, as had been observed during sh3 cell migration. Rather, they more closely resembled similar protrusions observed in
3-null keratinocytes plated on laminin-5 (Choma et al., 2004
; see Discussion). Only toward the end of the assay did sh3 cells begin to elaborate protrusions and spread.
Used together, anti-
3 and
6 antibodies blocked adhesion of all cell types on laminin-5 to background levels (Figure 9C, fourth set). Additional time-lapse assays revealed that A431 sh3 Rx cell motility on laminin-5 was restored to a level indistinguishable from that of wild-type cells (Figure 9D). Collectively, these data 1) confirm that adhesion and motility defects in CD151-silenced cells are due specifically to the loss of CD151 and are not the result of off-target effects, 2) reveal CD151 makes a critical contribution to
6 integrin function in cell attachment and spreading on laminin-5, 3) confirm results from Figure 2H that CD151 specifically regulates
3 integrin function when
6 integrin function is blocked, and 4) illustrate how the effect of CD151 silencing is qualitatively different from the loss of
3 function due to antibody blockade (compare wild-type cells in Figure 9.mov to sh3 cells in Figure 2.mov and Figure 6.mov).
Silencing of CD151 Inhibits Migration But Not Adhesion on Non-
3
1 Integrindependent Substrates.
3
1 integrin has been reported to participate in motility on a wide variety of substrates for which it is not the primary receptor and has been proposed to act as a secondary receptor on a number of extracellular matrix proteins (DiPersio et al., 1995
). We therefore tested the effects of silencing CD151 expression on adhesion and migration on other extracellular matrix ligands. As shown in Figure 10A, silencing of CD151 had no effect on
2
1 integrindependent adhesion to collagen I,
v integrindependent adhesion to vitronectin, or
5/
v integrindependent adhesion to fibronectin.
|
45% slower on collagen I. On fibronectin, the average velocity of A431 sh3 cells was
38% slower than that of the wild-type cells. Similar results were obtained in two independent trials.
Because we had observed that A431 cells are capable of depositing and adhering to their own laminin-5 (Figure 5), it appeared quite possible that sh3 cell migration defects on collagen I and fibronectin were in fact due to impaired migration on newly deposited laminin-5. However, analysis revealed that sh3 cell velocity on collagen I was equally impaired during the first hour as it was in the 3-h assay as a whole (Figure 10B). This suggested that sh3 cell migration on collagen I was impaired even before significant amounts of laminin-5 might have been deposited. More importantly, similar results on collagen I were obtained in the presence or absence of an anti-
3 integrin function-blocking antibody (Figure 10B), indicating that collagen I migration did not require
3 integrin ligand binding. It is possible that laminin-5 newly deposited by A431 cells is in a form that supports adhesion, but not rapid cell migration, as has been described for laminin-5 secreted by 804G and MCF10A cells (Goldfinger et al., 1998
).
Finally, because migration on collagen I and fibronectin was relatively slow, we used comparatively high concentrations of these ligands to stimulate motility. Therefore, it seemed possible that the lack of A431 sh3 cell adhesion defects on these ligands was due to higher concentrations used in adhesion assays. However, even when the plating concentration was reduced 10-fold, sh3 cells still adhered to both substrates just as well as wild-type and Rx cells (Figure 10C). Thus, diminished adhesion is unlikely to contribute to diminished migration velocity of sh3 cells on collagen I or fibronectin. Collectively, these results suggest that CD151 may contribute to motility via both
3-dependent and
3-independent mechanisms. Alternatively, they may reflect an
3 contribution to motility that is independent of direct ligand engagement.
| DISCUSSION |
|---|
|
|
|---|
3
1 Integrindependent Carcinoma Cell Motility on Laminin-5
3
1 integrindependent cell motility, consistent with the strong, detergent-resistant CD151-
3
1 interaction (Yauch et al., 1998
The impact of CD151 silencing on carcinoma cell motility, not only on laminin-5 but also on other substrates, raises the question of why the phenotype of CD151-null mice is not more severe. Potentially, within multivalent tetraspaninintegrin complexes, other tetraspanins may be able to compensate for CD151 during development of CD151-null mice. Another possible explanation is that, although we examined single cell motility on purified extracellular ligands, morphogenesis of multicellular tissues during embryonic development is controlled by multiple, collaborating adhesion systems. Indeed, even
3 and
6 integrin-null mice complete embryonic development, dying as early neonates with defects in various epithelial structures (Hynes, 2002
). That CD151-deficient human patients present with lesions in some of these same tissues later in life (Karamatic Crew et al., 2004
) may reflect CD151's role as an enhancer of integrin function, whose phenotype is uncovered by multiple rounds of
3 or
6 integrindependent tissue repair and maintenance. The relatively overt effects of CD151 overexpression or CD151 antibody blockade on metastatic colonization in vivo (Testa et al., 1999
; Kohno et al., 2002
) could reflect the importance of single cell motility on basement membrane ligands in in vivo models of tumor cell dissemination.
In a recent study, Garcia-Lopez et al., (2005)
found that a partial siRNA knockdown of CD151 actually enhanced melanocyte motility toward fibronectin in a transwell assay. However, an inhibitory
1 integrin antibody also enhanced motility in their assay. Thus, although the mechanisms controlling melanocyte motility appear different from those controlling carcinoma cell motility in our study, in both systems loss of CD151 produces a result that correlates with impaired
1 integrin function.
Silencing of CD151 Disrupts
3
1 Integrin Association with Tetraspanin-enriched Microdomains
We found that
3
1 integrin's ability to associate with TEMs was disrupted in the absence of CD151. These data complement recent observations that 1) CD151 transfection of CD151-negative Daudi B lymphoma cells promotes association of cotransfected
3
1 integrin with other tetraspanins (Charrin et al., 2003b
), and 2) palmitoylation-deficient CD151, which has impaired ability to associate with other tetraspanins, has a dominant inhibitory effect on
3
1's association with TEMs (Berditchevski et al., 2002
). Thus, our data contribute to the emerging view that direct primary interactions of individual tetraspanins with their major partners allow these major partners to be linked via secondary tetraspanintetraspanin interactions into extended complexes within TEMs.
Altered
3
1 Integrin Trafficking in CD151-silenced Cells.
Several tetraspanins have been implicated in the trafficking of their cell surface partners (Odintsova et al., 2000
; Duffield et al., 2003
; Stipp et al., 2003a
; Hu et al., 2005
), but direct evidence linking CD151 to integrin trafficking had not been described. We found that, during cell migration on laminin-5, the
3
1 integrin internalization rate was significantly reduced in CD151-silenced cells. Concurrently, these cells displayed persistent adhesive contacts at their lateral and trailing edges, suggesting that impaired
3
1 trafficking resulted in reduced efficiency of de-adhesion at the trailing edge of migrating cells. These results are reminiscent of data showing that interfering with
5 and
v integrin trafficking impairs neutrophil migration on fibronectin and vitronectin (Lawson and Maxfield, 1995
; Pierini et al., 2000
), and that recycling of
6 integrin is important for rapid motility of cranial neural crest cells on high concentrations of laminin-1 (Strachan and Condic, 2004
). Previously,
3
1 integrin had been suggested to participate little if at all in recycling (Bretscher, 1992
), but this study used cells in suspension in the absence of laminin-5, which may explain why
3
1 recycling was not observed. Indeed, recycling of
6 integrin and the L1 cell adhesion molecule are both strongly influenced by ligand engagement (Kamiguchi and Lemmon, 2000
; Strachan and Condic, 2004
).
Interestingly, although CD151-silenced A431 cells appeared completely negative for cell surface CD151 (after CD151-positive escapers had been removed by cell sorting), at least some of these cells expressed low levels of residual CD151 detectable upon cell permeabilization. This small, residual pool of CD151 strongly codistributed with
3
1 integrin at lateral/trailing edge adhesive contacts. We suggest that, when CD151 is severely limited, residual CD151 is preferentially allocated to sites of
3
1 accumulation, but remains insufficient to fulfill its role in
3
1 trafficking.
CD151 contains in its C-terminal cytoplasmic tail a YXX
motif, which has the potential to interact with AP adaptor complexes that mediate cargo selection during clathrin-dependent endocytosis (Robinson, 2004
). The function of the CD151 YXX
motif is unknown, but up to 66% of the total cellular CD151 may be localized to intracellular compartments corresponding to endosomes and/or lysosomes (Sincock et al., 1999
). This observation led to the proposal that CD151 might regulate the trafficking of its integrin partners (Sincock et al., 1999
), an idea for which our new data provide substantial support. CD151's ability to mediate
3
1 association with TEMs may be important for regulating
3
1 trafficking. Within TEMs,
3
1 is linked to both classical PKC isoforms (Zhang et al., 2001a
), which may regulate integrin endocytosis and integrin-dependent cell motility (Ng et al., 1999
; Zhang et al., 2001b
), and type II PI 4-kinases (Yauch et al., 1998
; Yauch and Hemler, 2000
), which have the potential to regulate a variety of vesicular traffic (Guo et al., 2003
; Wang et al., 2003
; Salazar et al., 2005
).
Relationship between Altered Adhesion, Altered
3
1 Integrin Trafficking, and Altered Migration in CD151-silenced Cells.
Our finding that
3
1 integrindependent cell adhesion was decreased in CD151-silenced cells might seem to be contradictory to the increased lateral and trailing edge adhesive contacts of these cells during migration on laminin-5. However, initial attachment and spreading on laminin-5 may also depend on proper
3
1 trafficking. Indeed, interfering with the recycling of
5
1 or
v
3 integrin (by expressing dominant negative rab4 or constitutively active glycogen synthase kinase-3) inhibits cell spreading and adhesion on their respective ligands, fibronectin and vitronectin (Roberts et al., 2001
, 2004
).
Nishiuchi et al., 2005
recently proposed that CD151 may act by stabilizing the activated conformation of
3
1. Although our results are not necessarily incompatible with this kind of function for CD151, we have observed in preliminary experiments that the stimulatory anti-
1 integrin antibody, TS2/16 (Chan and Hemler, 1993
), actually inhibits the migration of wild-type A431 cells on laminin-5 and fails to rescue the migration defect of CD151-silenced cells (A. Varzavand and C. Stipp, unpublished data). Perhaps more importantly, we found that A431 sh3 cells continued to display impaired motility even 2 h after plating, a time point at which their adhesion to laminin-5 was indistinguishable from that of wild-type cells. Thus, promoting
3
1 ligand binding appears unlikely to be a complete explanation of CD151 function in cell migration. In this regard, the phenotype of CD151-silenced cells appeared quite distinct from that of cells in which
3 function had been blocked with an inhibitory antibody. The short, circumferential protrusions that formed upon antibody blockade of
3 in wild-type A431 cells resembled those previously described for nonmigratory,
3-null keratinocytes plated on laminin-5 (Choma et al., 2004
). In contrast, the lateral/trailing edge protrusions we observed in CD151-silenced cells occurred in cells that were actively migrating. Thus, we propose that CD151 plays an important role in regulating
3
1 internalization during cell migration in addition to any function it may have in regulating
3
1 ligand binding. An additional, nonmutually exclusive possibility is that CD151 somehow contributes to the ability of
3
1 to trigger persistent polarization of migrating cells via activation of the small GTPase, Rac1 (Choma et al., 2004
).
Effects of CD151 Silencing on Integrins Other than
3
1.
Although
6
4 integrin did not appear to make a strong contribution to A431 cell motility on laminin-5, an
6 contribution to cell adhesion and spreading was uncovered in the presence of an inhibitory anti-
3 integrin antibody, and CD151 made a critical contribution to these
6 functions. The inability of an
6 function-blocking antibody by itself to interfere with adhesion, even though
6 can clearly contribute to adhesion, may seem contradictory. However, similar results have been described for
v integrin, in a study that showed an anti-
v integrin antibody only inhibited adhesion to fibronectin in cells lacking
5 integrin (Yang and Hynes, 1996
). Indeed, we obtained a similar result for
v and
5 integrins in Figure 10A, in which inhibiting either integrin alone had little or no effect on adhesion to fibronectin. Clearly, the ability to detect the contribution of individual integrins to cell adhesion can depend on the activity of other integrins with similar ligand binding specificities. In that regard, our data predict that in cell types such as MDA-MB-231 breast carcinoma cells, where
6 integrin contributions to motility are more apparent (Yoon et al., 2005
), the loss of CD151 would have profound effects on
6-dependent migration.
Our data also suggest that, in short-term adhesion assays, there is a correlation between the strength of CD151 interaction with its integrin partners and its ability to influence their function. Thus, CD151-silenced cells displayed defects in
3 and
6 integrindependent adhesion, but not in adhesion dependent on
2,
5, or
v integrins, whose interactions with CD151 are only observed in milder detergent conditions. However, we found that loss of CD151 does affect cell motility on the
2 integrin ligand, collagen I, and the
5/
v integrin ligand, fibronectin. These data contribute to the growing appreciation that tetraspaninintegrin interactions observed in milder detergents can be just as functionally relevant as more detergent-resistant interactions. Although the spectrum of integrins associating with CD151 in milder detergents is broader, it is nonetheless specific because other abundant cell surface proteins, such as PECAM-1, CD71, CD34, CD44, and VE-cadherin, fail to associate with CD151 under the same conditions (Sincock et al., 1999
).
Implications for CD151 Function in Metastasis.
Four years after its initial discovery as a platelet antigen (Fitter et al., 1995
), CD151 was "rediscovered" as the target of an anti-metastatic mAb (Testa et al., 1999
). Anti-CD151 antibodies inhibited metastatic colonization in vivo in this study, whereas forced expression of CD151 enhanced chemotactic cell migration. A role for CD151 in human cancer is supported by recent clinical studies, in which increased CD151 expression correlated with poor prognosis in non-small cell lung cancer (Tokuhara et al., 2001
), colon carcinoma (Hashida et al., 2003
), and prostate cancer (Ang et al., 2004
), with the CD151 expression level actually superior to traditional histologic grading in predicting patient outcomes in some cases (Ang et al., 2004
). Our data suggest that CD151 could function at multiple steps in the metastatic cascade, contributing to motility during early invasive steps, to adhesion of hematogenously circulating tumor cells, and again to motility during extravasation. Comparing the in vivo metastatic colonization potential of wild-type and CD151-silenced tumor cells is an important next step.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
These authors contributed equally to this work. ![]()
Address correspondence to: Christopher S. Stipp ( christopher-stipp{at}uiowa.edu)
Abbreviations used: TEMs, tetraspanin-enriched microdomains.
| REFERENCES |
|---|
|
|
|---|
Berditchevski, F. (2001). Complexes of tetraspanins with integrins: more than meets the eye. J. Cell Sci 114, 41434151.
Berditchevski, F., E. Odintsova, S. Sawada, Gilbert, E. (2002). Expression of the palmitoylation-deficient CD151 weakens the association of alpha 3beta 1 integrin with the tetraspanin-enriched microdomains and affects integrin-dependent signalling. J. Biol. Chem 277, 3699137000.
Berditchevski, F., Zutter, M. M., Hemler, M. E. (1996). Characterization of novel complexes on the cell surface between integrins and proteins with 4 transmembrane domains (TM4 proteins). Mol. Biol. Cell 7, 193207.[Abstract]
Bergelson, J. M., St. John, N. F., Kawaguchi, S., Pasqualini, R., Berdichevsky, F., Hemler, M. E., Finberg, R. W. (1994). The I domain is essential for echovirus 1 interaction with VLA-2. Cell Adhes. Commun 2, 455464.[Medline]
Boucheix, C. and Rubinstein, E. (2001). Tetraspanins. Cell Mol. Life Sci 58, 11891205.[CrossRef][Medline]
Bretscher, M. S. (1992). Circulating integrins: alpha 5 beta 1, alpha 6 beta 4 and Mac-1, but not alpha 3 beta 1, alpha 4 beta 1 or LFA-1. EMBO J 11, 405410.[Medline]
Chan, B. M. and Hemler, M. E. (1993). Multiple functional forms of the integrin VLA-2 can be derived from a single alpha 2 cDNA clone: interconversion of forms induced by an anti-beta 1 antibody. J. Cell Biol 120, 537543.
Charrin, S., Le Naour, F., Labas, V., Billard, M., Le Caer, J. P., Emile, J. F., Petit, M. A., Boucheix, C., Rubinstein, E. (2003a). EWI-2 is a new component of the tetraspanin web in hepatocytes and lymphoid cells. Biochem J 373, 409421.[CrossRef][Medline]
Charrin, S., Manie, S., Billard, M., Ashman, L., Gerlier, D., Boucheix, C., Rubinstein, E. (2003b). Multiple levels of interactions within the tetraspanin web. Biochem. Biophys. Res. Commun 304, 107112.[CrossRef][Medline]
Choma, D. P., Pumiglia, K., DiPersio, C. M. (2004). Integrin alpha3beta1 directs the stabilization of a polarized lamellipodium in epithelial cells through activation of Rac1. J. Cell Sci 117, 39473959.
Claas, C., Stipp, C. S., Hemler, M. E. (2001). Evaluation of prototype transmembrane 4 superfamily protein complexes and their relation to lipid rafts. J. Biol. Chem 276, 79747984.
Clark, K. L., Zeng, Z., Langford, A. L., Bowen, S. M., Todd, S. C. (2001). PGRL is a major CD81-associated protein on lymphocytes and distinguishes a new family of cell surface proteins. J. Immunol 167, 51155121.
Colognato, H. and Yurchenco, P. D. (2000). Form and function: the laminin family of heterotrimers. Dev. Dyn 218, 213234.[CrossRef][Medline]
Cowin, A. J., Adams, D., Geary, S. M., Wright, M. D., Jones, J. C., Ashman, L. K. (2006). Wound healing is defective in mice lacking tetraspanin CD151. J. Invest. Dermatol 126, 680689.[CrossRef][Medline]
DiPersio, C., Shah, S., Hynes, R. (1995). alpha3Abeta1 integrin localizes to focal contacts in response to diverse extracellular matrix proteins. J. Cell Sci 108, 23212336.[Abstract]
DiPersio, C. M., Hodivala-Dilke, K. M., Jaenisch, R., Kreidberg, J. A., Hynes, R. O. (1997). alpha3beta1 integrin is required for normal development of the epidermal basement membrane. J. Cell Biol 137, 729742.
Dowling, J., Yu, Q. C., Fuchs, E. (1996). Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. J. Cell Biol 134, 559572.
Duffield, A., Kamsteeg, E. J., Brown, A. N., Pagel, P., Caplan, M. J. (2003). The tetraspanin CD63 enhances the internalization of the H,K-ATPase beta-subunit. Proc. Natl. Acad. Sci. USA 100, 1556015565.
Fabbri, M., Fumagalli, L., Bossi, G., Bianchi, E., Bender, J. R., Pardi., R. (1999). A tyrosine-based sorting signal in the beta2 integrin cytoplasmic domain mediates its recycling to the plasma membrane and is required for ligand-supported migration. EMBO J 18, 49154925.[CrossRef][Medline]
Fitter, S., Tetaz, T. J., Berndt, M. C., Ashman, L. K. (1995). Molecular cloning of cDNA encoding a novel platelet-endothelial cell tetra-span antigen, PETA-3. Blood 86, 13481355.
Fukudome, K., Furuse, M., Imai, T., Nishimura, M., Takagi, S., Hinuma, Y., Yoshie, O. (1992). Identification of membrane antigen C33 recognized by monoclonal antibodies inhibitory to human T-cell leukemia virus type 1 (HTLV-1)-induced syncytium formation: altered glycosylation of C33 antigen in HTLV-1-positive T cells. J. Virol 66, 13941401.
Fukushima, Y., Ohnishi, T., Arita, N., Hayakawa, T., Sekiguchi, K. (1998). Integrin alpha3beta1-mediated interaction with laminin-5 stimulates adhesion, migration and invasion of malignant glioma cells. Int. J. Cancer 76, 6372.[CrossRef][Medline]
Garcia-Lopez, M. A., Barreiro, O., Garcia-Diez, A., Sanchez-Madrid, F., Penas, P. F. (2005). Role of tetraspanins CD9 and CD151 in primary melanocyte motility. J. Invest. Dermatol 125, 10011009.[Medline]
Georges-Labouesse, E., Messaddeq, N., Yehia, G., Cadalbert, L., Dierich, A., Le Meur, M. (1996). Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice. Nat. Genet 13, 370373.[CrossRef][Medline]
Giannelli, G., Astigiano, S., Antonaci, S., Morini, M., Barbieri, O., Noonan, D. M., Albini, A. (2002). Role of the alpha3beta1 and alpha6beta4 integrins in tumor invasion. Clin. Exp. Metastasis 19, 217223.[CrossRef][Medline]
Goldfinger, L. E., Stack, M. S., Jones, J. C. (1998). Processing of laminin-5 and its functional consequences: role of plasmin and tissue-type plasminogen activator. J. Cell Biol 141, 255265.
Guo, J., Wenk, M. R., Pellegrini, L., Onofri, F., Benfenati, F., De Camilli, P. (2003). Phosphatidylinositol 4-kinase type IIalpha is responsible for the phosphatidylinositol 4-kinase activity associated with synaptic vesicles. Proc. Natl. Acad. Sci. USA 100, 39954000.
Hashida, H., Takabayashi, A., Tokuhara, T., Hattori, N., Taki, T., Hasegawa, H., Satoh, S., Kobayashi, N., Yamaoka, Y., Miyake, M. (2003). Clinical significance of transmembrane 4 superfamily in colon cancer. Br. J. Cancer 89, 158167.[CrossRef][Medline]
Hemler, M. E. (2005). Tetraspanin functions and associated microdomains. Nat. Rev. Mol. Cell Biol 6, 801811.[CrossRef][Medline]
Hemler, M. E., Sanchez-Madrid, F., Flotte, T. J., Krensky, A. M., Burakoff, S. J., Bhan, A. K., Springer, T. A., Strominger, J. L. (1984). Glycoproteins of 210,000 and 130,000 m.w. on activated T cells: cell distribution and antigenic relation to components on resting cells and T cell lines. J. Immunol 132, 30113018.[Abstract]
Hintermann, E., Bilban, M., Sharabi, A., Quaranta, V. (2001). Inhibitory role of alpha 6 beta 4-associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on alpha 3 beta 1 integrin. J. Cell Biol 153, 465478.
Hintermann, E. and Quaranta, V. (2004). Epithelial cell motility on laminin-5, regulation by matrix assembly, proteolysis, integrins and erbB receptors. Matrix Biol 23, 7585.[CrossRef][Medline]
Hu, C. C., Liang, F. X., Zhou, G., Tu, L., Tang, C. H., Zhou, J., Kreibich, G., Sun, T. T. (2005). Assembly of urothelial plaques: tetraspanin function in membrane protein trafficking. Mol. Biol. Cell 16, 39373950.
Hynes, R. O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell 110, 673687.[CrossRef][Medline]
Ivaska, J., Vuoriluoto, K., Huovinen, T., Izawa, I., Inagaki, M., Parker, P. J. (2005). PKCepsilon-mediated phosphorylation of vimentin controls integrin recycling and motility. EMBO J 24, 38343845.[CrossRef][Medline]
Kamiguchi, H. and Lemmon, V. (2000). Recycling of the cell adhesion molecule L1 in axonal growth cones. J. Neurosci 20, 36763686.
Karamatic Crew, V., Burton, N., Kagan, A., Green, C. A., Levene, C., Flinter, F., Brady, R. L., Daniels, G., Anstee, D. J. (2004). CD151, the first member of the tetraspanin (TM4) superfamily detected on erythrocytes, is essential for the correct assembly of human basement membranes in kidney and skin. Blood 104, 22172223.
Kawano, K., Kantak, S. S., Murai, M., Yao, C. C., Kramer, R. H. (2001). Integrin alpha3beta1 engagement disrupts intercellular adhesion. Exp. Cell Res 262, 180196.[CrossRef][Medline]
Kazarov, A. R., Yang, X., Stipp, C. S., Sehgal, B., Hemler, M. E. (2002). An extracellular site on tetraspanin CD151 determines alpha 3 and alpha 6 integrin-dependent cellular morphology. J. Cell Biol 158, 12991309.
Kikkawa, Y., Umeda, M., Miyazaki, K. (1994). Marked stimulation of cell adhesion and motility by ladsin, a laminin-like scatter factor. J. Biochem. (Tokyo) 116, 862869.
Kohno, M., Hasegawa, H., Miyake, M., Yamamoto, T., Fujita, S. (2002). CD151 enhances cell motility and metastasis of cancer cells in the presence of focal adhesion kinase. Int. J. Cancer 97, 336343.[CrossRef][Medline]
Kreidberg, J. A., Donovan, M. J., Goldstein, S. L., Rennke, H., Shepherd, K., Jones, R. C., Jaenisch, R. (1996). Alpha 3 beta 1 integrin has a crucial role in kidney and lung organogenesis. Development 122, 35373547.[Abstract]
Kubota, S., Ito, H., Ishibashi, Y., Seyama, Y. (1997). Anti-alpha3 integrin antibody induces the activated form of matrix metalloprotease-2 (MMP-2) with concomitant stimulation of invasion through matrigel by human rhabdomyosarcoma cells. Int. J. Cancer 70, 106111.[CrossRef][Medline]
Lawson, M. A. and Maxfield, F. R. (1995). Ca(2+)- and calcineurin-dependent recycling of an integrin to the front of migrating neutrophils. Nature 377, 7579.[CrossRef][Medline]
Lee, R. T., Berditchevski, F., Cheng, G. C., Hemler, M. E. (1995). Integrin-mediated collagen matrix reorganization by cultured human vascular smooth muscle cells. Circ. Res 76, 209214.
Manohar, A., Shome, S. G., Lamar, J., Stirling, L., Iyer, V., Pumiglia, K., DiPersio, C. M. (2004). Alpha 3 beta 1 integrin promotes keratinocyte cell survival through activation of a MEK/ERK signaling pathway. J. Cell Sci 117, 40434054.
Marinkovich, M. P., Lunstrum, G. P., Burgeson, R. E. (1992). The anchoring filament protein kalinin is synthesized and secreted as a high molecular weight precursor. J. Biol. Chem 267, 1790017906.
Melchiori, A., Mortarini, R., Carlone, S., Marchisio, P. C., Anichini, A., Noonan, D. M., Albini, A. (1995). The alpha 3 beta 1 integrin is involved in melanoma cell migration and invasion. Exp. Cell Res 219, 233242.[CrossRef][Medline]
Mercurio, A. M., Rabinovitz, I., Shaw, L. M. (2001). The alpha 6 beta 4 integrin and epithelial cell migration. Curr. Opin. Cell Biol 13, 541545.[CrossRef][Medline]
Miyazaki, K., Kikkawa, Y., Nakamura, A., Yasumitsu, H., Umeda, M. (1993). A large cell-adhesive scatter factor secreted by human gastric carcinoma cells. Proc. Natl. Acad. Sci. USA 90, 1176711771.
Morini, M., Mottolese, M., Ferrari, N., Ghiorzo, F., Buglioni, S., Mortarini, R., Noonan, D. M., Natali, P. G., Albini, A. (2000). The alpha 3 beta 1 integrin is associated with mammary carcinoma cell metastasis, invasion, and gelatinase B (MMP-9) activity. Int. J. Cancer 87, 336342.[CrossRef][Medline]
Ng, T., Shima, D., Squire, A., Bastiaens, P. I., Gschmeissner, S., Humphries, M. J., Parker, P. J. (1999). PKCalpha regulates beta1 integrin-dependent cell motility through association and control of integrin traffic. EMBO J 18, 39093923.[CrossRef][Medline]
Nguyen, B. P., Gil, S. G., Carter, W. G. (2000a). Deposition of laminin 5 by keratinocytes regulates integrin adhesion and signaling. J. Biol. Chem 275, 3189631907.
Nguyen, B. P., Ryan, M. C., Gil, S. G., Carter, W. G. (2000b). Deposition of laminin 5 in epidermal wounds regulates integrin signaling and adhesion. Curr. Opin. Cell Biol 12, 554562.[CrossRef][Medline]
Nishiuchi, R., Sanzen, N., Nada, S., Sumida, Y., Wada, Y., Okada, M., Takagi, J., Hasegawa, H., Sekiguchi, K. (2005). Potentiation of the ligand-binding activity of integrin alpha3beta1 via association with tetraspanin CD151. Proc. Natl. Acad. Sci. USA 102, 19391944.
Odintsova, E., Sugiura, T., Berditchevski, F. (2000). Attenuation of EGF receptor signaling by a metastasis suppressor, the tetraspanin CD82/KAI-1. Curr. Biol 10, 10091012.[CrossRef][Medline]
Okada, T., Okuno, H., Mitsui, Y. (1994). A novel in vitro assay system for transendothelial tumor cell invasion: significance of E-selectin and alpha 3 integrin in the transendothelial invasion by HT1080 fibrosarcoma cells. Clin. Exp. Metastasis 12, 305314.[CrossRef][Medline]
Ortiz-Urda, S., Garcia, J., Green, C. L., Chen, L., Lin, Q., Veitch, D. P., Sakai, L. Y., Lee, H., Marinkovich, M. P., Khavari, P. A. (2005). Type VII collagen is required for Ras-driven human epidermal tumorigenesis. Science 307, 17731776.
Pierini, L. M., Lawson, M. A., Eddy, R. J., Hendey, B., Maxfield, F. R. (2000). Oriented endocytic recycling of alpha5beta1 in motile neutrophils. Blood 95, 24712480.
Powelka, A. M., Sun, J., Li, J., Gao, M., Shaw, L. M., Sonnenberg, A., Hsu, V. W. (2004). Stimulation-dependent recycling of integrin beta1 regulated by ARF6 and Rab11. Traffic 5, 2036.[CrossRef][Medline]
Roberts, M., Barry, S., Woods, A., van der Sluijs, P., Norman, J. (2001). Platelet-derived growth factor-regulated rab4-dependent recycling of alphavbeta3 integrin from early endosomes is necessary for cell adhesion and spreading. Curr. Biol 11, 13921402.[CrossRef][Medline]
Roberts, M. S., Woods, A. J., Dale, T. C., Van Der Sluijs, P., Norman, J. C. (2004). Protein kinase B/Akt acts via glycogen synthase kinase 3 to regulate recycling of alpha v beta 3 and alpha 5 beta 1 integrins. Mol. Cell. Biol 24, 15051515.
Robinson, M. S. (2004). Adaptable adaptors for coated vesicles. Trends Cell Biol 14, 167174.[CrossRef][Medline]
Salazar, G., Craige, B., Wainer, B. H., Guo, J., De Camilli, P., Faundez, V. (2005). Phosphatidylinositol-4-kinase type II alpha is a component of adaptor protein-3-derived vesicles. Mol. Biol. Cell 16, 36923704.
Sincock, P. M., Fitter, S., Parton, R. G., Berndt, M. C., Gamble, J. R., Ashman, L. K. (1999). PETA-3/CD151, a member of the transmembrane 4 superfamily, is localised to the plasma membrane and endocytic system of endothelial cells, associates with multiple integrins and modulates cell function. J. Cell Sci 112, 833844.[Abstract]
Sincock, P. M., Mayrhofer, G., Ashman, L. K. (1997). Localization of the transmembrane 4 superfamily (TM4SF) member PETA-3 (CD151) in normal human tissues: comparison with CD9, CD63, and alpha5beta1 integrin. J. Histochem. Cytochem 45, 515525.
Sterk, L. M., Geuijen, C. A., Oomen, L. C., Calafat, J., Janssen, H., Sonnenberg, A. (2000). The tetraspan molecule CD151, a novel constituent of hemidesmosomes, associates with the integrin alpha6beta4 and may regulate the spatial organization of hemidesmosomes. J. Cell Biol 149, 969982.
Stipp, C. S. and Hemler, M. E. (2000). Transmembrane-4-superfamily proteins CD151 and CD81 associate with
3
1 integrin, and selectively contribute to
3
1-dependent neurite outgrowth. J. Cell Sci 113, 18711882.[Abstract]
Stipp, C. S., Kolesnikova, T. V., Hemler, M. E. (2003a). EWI-2 regulates alpha3beta1 integrin-dependent cell functions on laminin-5. J. Cell Biol 163, 11671177.
Stipp, C. S., Kolesnikova, T. V., Hemler, M. E. (2003b). Functional domains in tetraspanin proteins. Trends Biochem. Sci 28, 106112.[CrossRef][Medline]
Strachan, L. R. and Condic, M. L. (2004). Cranial neural crest recycle surface integrins in a substratum-dependent manner to promote rapid motility. J. Cell Biol 167, 545554.
Testa, J. E., Brooks, P. C., Lin, J. M., Quigley, J. P. (1999). Eukaryotic expression cloning with an antimetastatic mAb identifies a tetraspanin (PETA-3/CD151) as an effector of human tumor cell migration and metastasis. Cancer Res 59, 38123820.
Tokuhara, T., Hasegawa, H., Hattori, N., Ishida, H., Taki, T., Tachibana, S., Sasaki, S., Miyake, M. (2001). Clinical significance of CD151 gene expression in non-small cell lung cancer. Clin. Cancer Res 7, 41094114.
Tysnes, B. B., Larsen, L. F., Ness, G. O., Mahesparan, R., Edvardsen, K., Garcia-Cabrera, I., Bjerkvig, R. (1996). Stimulation of glioma-cell migration by laminin and inhibition by anti-alpha3 and anti-beta1 integrin antibodies. Int. J. Cancer 67, 777784.[CrossRef][Medline]
Wang, H., Fu, W., Im, J. H., Zhou, Z., Santoro, S. A., Iyer, V., DiPersio, C. M., Yu, Q. C., Quaranta, V., Al-Mehdi, A., Muschel, R. J. (2004). Tumor cell alpha3beta1 integrin and vascular laminin-5 mediate pulmonary arrest and metastasis. J. Cell Biol 164, 935941.
Wang, Y. J., Wang, J., Sun, H. Q., Martinez, M., Sun, Y. X., Macia, E., Kirchhausen, T., Albanesi, J. P., Roth, M. G., Yin, H. L. (2003). Phosphatidylinositol 4 phosphate regulates targeting of clathrin adaptor AP-1 complexes to the Golgi. Cell 114, 299310.[CrossRef][Medline]
Weitzman, J. B., Pasqualini, R., Takada, Y., Hemler, M. E. (1993). The function and distinctive regulation of the integrin VLA-3 in cell adhesion, spreading, and homotypic cell aggregation. J. Biol. Chem 268, 86518657.
Wright, M. D., Geary, S. M., Fitter, S., Moseley, G. W., Lau, L. M., Sheng, K. C., Apostolopoulos, V., Stanley, E. G., Jackson, D. E., Ashman, L. K. (2004). Characterization of mice lacking the tetraspanin superfamily member CD151. Mol. Cell. Biol 24, 59785988.
Yang, J. T. and Hynes, R. O. (1996). Fibronectin receptor functions in embryonic cells deficient in alpha 5 beta 1 integrin can be replaced by alpha V integrins. Mol. Biol. Cell 7, 17371748.[Abstract]
Yang, X., Claas, C., Kraeft, S. K., Chen, L. B., Wang, Z., Kreidberg, J. A., Hemler, M. E. (2002). Palmitoylation of tetraspanin proteins: modulation of CD151 lateral interactions, subcellular distribution, and integrin-dependent cell morphology. Mol. Biol. Cell 13, 767781.
Yauch, R. L., Berditchevski, F., Harler, M. B., Reichner, J., Hemler, M. E. (1998). Highly stoichiometric, stable, and specific association of integrin alpha3beta1 with CD151 provides a major link to phosphatidylinositol 4- kinase, and may regulate cell migration. Mol. Biol. Cell 9, 27512765.
Yauch, R. L. and Hemler, M. E. (2000). Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem. J 351(Pt 3), 629637.
Yoon, S. O., Shin, S., Mercurio, A. M. (2005). Hypoxia stimulates carcinoma invasion by stabilizing microtubules and promoting the Rab11 trafficking of the alpha6beta4 integrin. Cancer Res 65, 27612769.
Zhang, X. A., Bontrager, A. L., Hemler, M. E. (2001a). Transmembrane-4 superfamily proteins associate with activated protein kinase C (PKC) and link PKC to specific beta 1 integrins. J. Biol. Chem 276, 2500525013.
Zhang, X. A., Bontrager, A. L., Stipp, C. S., Kraeft, S. K., Bazzoni, G., Chen, L. B., Hemler, M. E. (2001b). Phosphorylation of a conserved integrin alpha 3 QPSXXE motif regulates signaling, motility, and cytoskeletal engagement. Mol. Biol. Cell 12, 351365.
Zhang, X. A., Kazarov, A. R., Yang, X., Bontrager, A. L., Stipp, C. S., Hemler, M. E. (2002). Function of the tetraspanin CD151-alpha6beta1 integrin complex during cellular morphogenesis. Mol. Biol. Cell 13, 111.
Ziober, B. L., Lin, C. S., Kramer, R. H. (1996). Laminin-binding integrins in tumor progression and metastasis. Semin. Cancer Biol 7, 119128.[CrossRef]
This article has been cited by other articles:
![]() |
J. L. Johnson, N. Winterwood, K. A. DeMali, and C. S. Stipp Tetraspanin CD151 regulates RhoA activation and the dynamic stability of carcinoma cell-cell contacts J. Cell Sci., July 1, 2009; 122(13): 2263 - 2273. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhang, J. Kotha, L. K. Jennings, and X. A. Zhang Tetraspanins and vascular functions Cardiovasc Res, July 1, 2009; 83(1): 7 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sadej, H. Romanska, G. Baldwin, K. Gkirtzimanaki, V. Novitskaya, A. D. Filer, Z. Krcova, R. Kusinska, J. Ehrmann, C. D. Buckley, et al. CD151 Regulates Tumorigenesis by Modulating the Communication between Tumor Cells and Endothelium Mol. Cancer Res., June 1, 2009; 7(6): 787 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Baldwin, V. Novitskaya, R. Sadej, E. Pochec, A. Litynska, C. Hartmann, J. Williams, L. Ashman, J. A. Eble, and F. Berditchevski Tetraspanin CD151 Regulates Glycosylation of {alpha}3{beta}1 Integrin J. Biol. Chem., December 19, 2008; 283(51): 35445 - 35454. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. H. Yang, A. L. Richardson, M. I. Torres-Arzayus, P. Zhou, C. Sharma, A. R. Kazarov, M. M. Andzelm, J. L. Strominger, M. Brown, and M. E. Hemler CD151 Accelerates Breast Cancer by Regulating {alpha}6 Integrin Function, Signaling, and Molecular Organization Cancer Res., May 1, 2008; 68(9): 3204 - 3213. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Lekishvili, E. Fromm, M. Mujoomdar, and F. Berditchevski The tumour-associated antigen L6 (L6-Ag) is recruited to the tetraspanin-enriched microdomains: implication for tumour cell motility J. Cell Sci., March 1, 2008; 121(5): 685 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Liu, B. He, W. M. Liu, D. Zhou, J. V. Cox, and X. A. Zhang Tetraspanin CD151 Promotes Cell Migration by Regulating Integrin Trafficking J. Biol. Chem., October 26, 2007; 282(43): 31631 - 31642. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chang and S. C. Finnemann Tetraspanin CD81 is required for the {alpha}vbeta5-integrin-dependent particle-binding step of RPE phagocytosis J. Cell Sci., September 1, 2007; 120(17): 3053 - 3063. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeda, A. R. Kazarov, C. E. Butterfield, B. D. Hopkins, L. E. Benjamin, A. Kaipainen, and M. E. Hemler Deletion of tetraspanin Cd151 results in decreased pathologic angiogenesis in vivo and in vitro Blood, February 15, 2007; 109(4): 1524 - 1532. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||