QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 17, Issue 6, 2707-2721, June 2006

This Article Abstract Full Text (PDF) Supplemental Material All Versions of this Article: E05-11-1042v1 17/6/2707    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Winterwood, N. E. Articles by Stipp, C. S. Search for Related Content PubMed PubMed Citation Articles by Winterwood, N. E. Articles by Stipp, C. S.

A Critical Role for Tetraspanin CD151 in 31 and 64 Integrin–dependent Tumor Cell Functions on Laminin-5

Nicole E. Winterwood^*,, Afshin Varzavand^*,, Marit N. Meland^*, Leonie K. Ashman, and Christopher S. Stipp^*

*University of Iowa, Department of Biological Sciences, Iowa City, IA 52240; and School of Biomedical Sciences, Medical Sciences Building, University of Newcastle, Callaghan NSW 2308, Australia

Submitted November 14, 2005; Revised March 9, 2006; Accepted March 20, 2006
Monitoring Editor: Mark Ginsberg

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The basement membrane protein laminin-5 supports tumor cell adhesion and motility and is implicated at multiple steps of the metastatic cascade. Tetraspanin CD151 engages in lateral, cell surface complexes with both of the major laminin-5 receptors, integrins 31 and 64. To determine the role of CD151 in tumor cell responses to laminin-5, we used retroviral RNA interference to efficiently silence CD151 expression in epidermal carcinoma cells. Near total loss of CD151 had no effect on steady state cell surface expression of 31, 64, or other integrins with which CD151 associates. However, CD151-silenced carcinoma cells displayed markedly impaired motility on laminin-5, accompanied by unusually persistent lateral and trailing edge adhesive contacts. CD151 silencing disrupted 31 integrin association with tetraspanin-enriched microdomains, reduced the bulk detergent extractability of 31, and impaired 31 internalization in cells migrating on laminin-5. Both 31- and 64-dependent cell adhesion to laminin-5 were also impaired in CD151-silenced cells. Reexpressing CD151 in CD151-silenced cells reversed the adhesion and motility defects. Finally, loss of CD151 also impaired migration but not adhesion on substrates other than laminin-5. These data show that CD151 plays a critical role in tumor cell responses to laminin-5 and reveal promotion of integrin recycling as a novel potential mechanism whereby CD151 regulates tumor cell migration.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Laminin-5 is a major basement membrane component that can facilitate either stable epithelial cell attachment or rapid cell motility, depending on its state of proteolytic processing (Hintermann and Quaranta, 2004). Although this functional flexibility is well suited to laminin-5's dual physiological roles of maintaining epithelial integrity and restoring integrity during wound healing (Colognato and Yurchenco, 2000; Nguyen et al., 2000b), metastatic carcinoma cells appear to coopt laminin-5 promigratory functions for invasion, adhesion, and motility. For example, laminin-5 disrupts intercellular adhesion and triggers scattering of some types of squamous carcinoma cells (Miyazaki et al., 1993; Kikkawa et al., 1994; Kawano et al., 2001), and laminin-5 interaction with collagen VII may provide a necessary mechanical link for tumor cell invasion into the interstitial matrix (Ortiz-Urda et al., 2005). At a later stage of metastasis, pre-existing patches of exposed, laminin-5–rich basement membrane in the pulmonary vasculature may provide adhesive sites for circulating tumor cells during extravasation (Wang et al., 2004).

The two major cellular receptors for laminin-5 are integrins 64 and 31. Integrin 64 mediates stable anchorage of epithelial cells to laminin-5 in the basement membrane, whereas 31 integrin mediates laminin-5–dependent cell spreading and migration (Nguyen et al., 2000b; Hintermann and Quaranta, 2004). Consistent with its role in motility on laminin-5, several studies have documented 31 function in carcinoma (Morini et al., 2000), glioma (Tysnes et al., 1996; Fukushima et al., 1998), rhabdosarcoma (Kubota et al., 1997), melanoma (Melchiori et al., 1995), and fibrosarcoma (Okada et al., 1994) cell invasion of basement membrane or endothelial cell layers, and increased 31 expression has been linked to tumor progression (Ziober et al., 1996), increased invasiveness, and propensity to metastasize (Giannelli et al., 2002). However, 64 signaling through PI 3-kinase may have a positive (Nguyen et al., 2000a) or negative (Hintermann et al., 2001) impact on 31 function, depending on the experimental paradigm, and 64 itself may be capable of switching from an intermediate filament–associated state, involved in stable cell adhesion, to an actin filament–associated, promigratory state (Mercurio et al., 2001). Furthermore, despite its predominant role in laminin-5–dependent migration, 31 also contributes to basement membrane integrity (DiPersio et al., 1997), and keratinocyte survival (Manohar et al., 2004). Thus, 64 and 31 may each mediate both migratory and nonmigratory responses to laminin-5, and the interplay between these two receptors may determine the extent to which carcinoma cells can utilize laminin-5 for invasion and dispersal.

One protein with the potential to regulate both 64 and 31 function in tumor cell motility is tetraspanin CD151. CD151 engages both integrins in lateral cell surface complexes (Yauch et al., 1998; Sincock et al., 1999; Sterk et al., 2000), and the 31-CD151 interaction in particular is nearly stoichiometric in many cell types and resistant to harsh detergents (Yauch et al., 1998). Anti-CD151 antibodies (Stipp and Hemler, 2000) or expression of CD151 mutants (Kazarov et al., 2002; Zhang et al., 2002) can selectively inhibit 3 and 6 integrin–dependent cell migration in some experimental settings, whereas overexpression of wild-type CD151 enhances experimental metastasis of colon carcinoma and fibrosarcoma cells (Kohno et al., 2002). CD151 also emerged from a subtractive immunization strategy as the target of an anti-metastatic antibody (Testa et al., 1999), and elevated CD151 expression in lung, colon, and prostate cancers correlates with poor clinical outcome (Tokuhara et al., 2001; Hashida et al., 2003; Ang et al., 2004).

As a member of the tetraspanin family, CD151 possesses four transmembrane domains, cytoplasmic amino and carboxyl termini, and two extracellular loops, the larger of which contains the distinctive pattern of cysteine residues that help to define the family. Tetraspanins may act as adaptors or organizers by assembling multimolecular complexes of cell surface proteins and linking them to specific cytoplasmic signaling enzymes such as classical protein kinase C (PKC) isoforms and PI 4-kinase (Berditchevski, 2001; Boucheix and Rubinstein, 2001; Stipp et al., 2003b; Hemler, 2005). Individual tetraspanins may preferentially associate with specific cell surface partners such as integrins, growth factor receptors, and immunoglobulin superfamily proteins, and link these partners, via tetraspanin–tetraspanin interactions, into extended complexes. The organization of extended tetraspanin complexes has been envisioned as a web (Boucheix and Rubinstein, 2001), and more recently, as tetraspanin-enriched microdomains (TEMs), a novel type of cell surface microdomain that is biochemically distinct from lipid rafts (Claas et al., 2001; Hemler, 2005).

Unlike 3 and 6 integrin-null mice, CD151-null mice are viable and fertile (Wright et al., 2004), indicating that despite its physical and functional association with 3 and 6 integrins, CD151 is not essential for 3- or 6-dependent morphogenesis during development. However, CD151-null mice do exhibit defects in platelet aggregation and keratinocyte migration (Wright et al., 2004), as well as wound healing in vivo (Cowin et al., 2006), and CD151-deficient human patients develop kidney disease and epidermolysis later in life (Karamatic Crew et al., 2004) that are reminiscent of some of the severe developmental defects observed in mice lacking 3 or 6 integrin (Dowling et al., 1996; Georges-Labouesse et al., 1996; Kreidberg et al., 1996; DiPersio et al., 1997).

Despite the abundance of evidence linking CD151 to 3 and 6 integrin functions in cell motility and metastasis, the CD151 loss-of-function phenotype of transformed cells has not been described. Here we developed an RNA interference (RNAi) strategy to efficiently silence CD151 expression in A431 epidermoid carcinoma cells. We find that near total loss of CD151 has no effect on steady state cell surface expression of 3 or 6 integrin, but that CD151 plays a critical role in 3 integrin–dependent cell motility and 6 integrin–dependent attachment and spreading on laminin-5. Our data definitively identify CD151 as a key regulator of 3 and 6 integrin functions in transformed cells.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Antibodies and Extracellular Matrix Proteins
Anti-integrin monoclonal antibodies (mAbs) used in this study were anti-2, A2-IIE10 (Bergelson et al., 1994); anti-3, A3-X8 and A3-IIF5 (Weitzman et al., 1993); anti-5, P1D6 (Covance Research Products, Madison, WI); anti-6, A6-ELE (Lee et al., 1995) and GoH3 (GeneTex, San E Antonio, TX); anti-v, 69-6-5 (Biodesign International, Saco, ME), and anti-1, TS2/16 (Hemler et al., 1984). Also used was an anti-3 integrin polyclonal antibody, D23 (Kazarov et al., 2002). Anti-tetraspanin mAbs used were anti-CD9, ALB6 (Chemicon International, Temecula, CA) and C9-BB (Berditchevski et al., 1996); anti-CD81, M38 (Fukudome et al., 1992); and anti-CD151, 5C11 (Yauch et al., 1998) and 11B1.G4 (Sincock et al., 1997). Anti-EWI-2 mAb was 8A12 (Charrin et al., 2003a). Anti-laminin-5 mAb, 6F12 (also called K140; Marinkovich et al., 1992), was used for laminin-5 affinity purification. Anti-tubulin mAb was DM1B (Calbiochem, La Jolla, CA). Secondary reagents were HRP-conjugated goat-anti-mouse IgG and goat anti-rabbit IgG antibodies (Jackson ImmunoResearch, West Grove, PA), Alexa 680– and Alexa 594–conjugated goat anti-rabbit antibodies (Invitrogen, Carlsbad, CA), and Cy2 goat anti-mouse antibody (Jackson ImmunoResearch).

Rat tail collagen I and human plasma fibronectin were purchased from BD Biosciences (San Diego, CA); human plasma vitronectin was obtained from Takara Bio (Tokyo, Japan.) Human laminin-5 was purified from SCC-25 squamous cell carcinoma–conditioned medium as described (Marinkovich et al., 1992), with some modifications. Freshly confluent SCC-25 cells were rinsed with phosphate-buffered saline (PBS) and then refed with a 1:1 serum-free mixture of DME and F12 medium containing 0.4 µg/ml hydrocortisone (H0888, Sigma-Aldrich, St. Louis, MO) and 1 µg/ml each aprotinin and leupeptin (Roche Diagnostics, Indianapolis, IN). After 2 d, conditioned medium was harvested, clarified by centrifugation at 16,000 x g for 20 min, and supplemented with Tris-HCl, pH 7.4 (50 mM final), Tween-20 (0.1% final; Sigma-Aldrich), and phenylmethylsulfonyl fluoride (PMSF; 2 mM final, Sigma-Aldrich). Conditioned medium was passed over a gelatin-Sepharose column (Sigma-Aldrich) before loading onto an affinity column consisting of the 6F12 anti-laminin-5 antibody coupled to Affigel-10 matrix (Bio-Rad Laboratories, Richmond, CA). After washing with 50 column volumes of 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween-20, laminin-5 was eluted with 1 M acetic acid, 0.1% Tween-20 and neutralized with 1.5 M Tris-HCl, pH 8.8, 0.1% Tween-20. Protein concentration of pooled peak fractions was determined by BCA assay (Pierce Biotechnology, Rockford, IL), and purity was confirmed with silver-stained SDS-polyacrylamide gel electrophoresis (PAGE) gels.

Cell Culture, RNAi, and Retroviral Transduction
A431 epithelial carcinoma cells and retroviral packaging cell lines, GP2-293 and PT67 (BD Biosciences), were cultured in high glucose DME. SCC-25 squamous carcinoma cells were cultured in a 1:1 mixture of DME and F12 media supplemented with 0.4 µg/ml hydrocortisone. All cultures were supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (all from Invitrogen). For RNAi, double-stranded oligonucleotides encoding short hairpin RNAs (shRNAs) targeting the human CD151 mRNA were annealed and then cloned into the pSIREN-RetroQ retroviral vector (BD Biosciences). Three shRNAs targeting different sequences were tested: the sh1 targeting sequence is TGCTGGAGATCATCGCTGGTA; the sh2 targeting sequence is GCGAGACCATGCCTCCAACAT, and the sh3 targeting sequence is AGTACCTGCTGTTTACCTACA. These constructs were cotransfected with the pVSV-G retroviral coat protein expression vector into GP2-293 packaging cells using the calcium phosphate method. At 48 h and again at 96 h after transfection, virus-containing medium was collected, 0.45 µm filtered, supplemented with 4 µg/ml polybrene (Sigma-Aldrich), and then used to transduce A431 cells. Stable A431 transductants were selected with 3 µg/ml puromycin (Sigma-Aldrich) and maintained in 0.1 µg/ml puromycin.

For CD151 reexpression experiments in A431 sh3 cells, recombinant PCR was used to construct a CD151 cDNA bearing two silent mutations within the sh3 targeting sequence. This CD151 cDNA, which we named CD151 Rx, was cloned into the LXIN retroviral vector and cotransfected with the pVSV-G retroviral coat protein vector into GP2-293 packaging cells, as above. The resulting virus-containing medium was used to transduce PT67 retroviral packaging cells, and stably transduced cells were selected with 0.5 mg/ml G418 (Invitrogen). Virus-containing medium from these stably-transduced PT67 cells was then used to transduce A431 sh3 cells, which were selected with 0.5 mg/ml G418 while maintaining selection with 0.1 µg/ml puromycin to retain the sh3 shRNA retroviral vector. Restoration of CD151 expression in these cells, which we named A431 sh3 Rx, was confirmed by flow cytometry.

Immunoprecipitation and Immunoblotting
A431 cells were lysed by scraping into 20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM MgCl₂ (HBSM) supplemented with 1% detergent, and protease inhibitors (2 mM PMSF, 10 µg/ml aprotinin, 5 µg/ml leupeptin, and 5 µg/ml E-64; Roche Diagnostics). Detergents were Brij 96V or Triton X-100 (both from Sigma-Aldrich). In some experiments, cells were biotinylated with 0.1 mg/ml Sulfo-NHS-LC biotin (Pierce Biotechnology) in HBSM for 1 h at room temperature and then rinsed three times with HBSM before lysis. After a 1-h extraction at 4°C with rocking, insoluble material was removed by centrifugation at 16,000 x g for 15 min, and lysates were precleared for 1 h at 4°C with protein G-Sepharose (Pierce Biotechnology) and then centrifuged as before. Protein concentrations in lysates of different cell types were normalized according to the results of a BCA assay (Pierce Biotechnology), specific antibodies plus protein G-Sepharose were added, and immune complexes were collected overnight at 4°C. After rinsing four times with lysis buffer, immune complexes were eluted by boiling in sample buffer, resolved by SDS-PAGE, and transferred to nitrocellulose. Blots were blocked with 5% nonfat milk in PBST (PBS with 0.1% Tween-20) and probed with one of the following antibodies, diluted in blocking buffer: 8A12 anti-EWI-2 ascites (1:2000), C9-BB anti-CD9 (10 µg/ml), biotinylated M38 anti-CD81 (10 µg/ml), or D23 polyclonal anti-3 integrin (5 µg/ml). Blots were developed with HRP-goat anti-mouse or HRP-goat anti-rabbit secondary antibodies (1:6000) followed by chemiluminescence (Western Lightning reagent, Perkin Elmer-Cetus, Norwalk, CT). Biotinylated proteins were detected with Extravidin-HRP (Sigma-Aldrich), diluted 1:2000 in PBST, followed by chemiluminescence.

Flow Cytometry and Cell Sorting
A431 cells were stained on ice for 1 h with negative control or specific primary antibodies at 5 µg/ml in blocking buffer (PBS with 10% heat-inactivated goat serum and 0.02% sodium azide). After three rinses in cold PBS, cells were stained on ice for 45 min with an Cy2-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch) diluted 1:200 in blocking buffer. After three additional rinses, cells were analyzed on a FACScan flow cytometer (Becton Dickinson, Lincoln Park, NJ). For cell sorting, sodium azide was omitted during staining, and cells were sorted on a fluorescence-activated cell sorting (FACS) DiVa instrument (Becton Dickinson).

Time-Lapse Motility Assays
A431 cells were plated at 5 x 10⁵ cells per 25 cm² flask on day 1 and starved overnight on day 2 in SFM (DME with 5 mg/ml cell culture grade BSA; Sigma-Aldrich) and 25 mM HEPES, pH 7.2). On day 3, cells were harvested by treating with trypsin-EDTA for 3 min at 37°C and collected in SFM supplemented with 0.1 mg/ml soybean trypsin inhibitor and 20 µg/ml DNAse I (Worthington Biochemical, Lakewood, NJ). After centrifugation, cells were resuspended in SFM, and 2.3 x 10⁵ cells were plated to 35-mm dishes that had been coated overnight with 1 µg/ml laminin-5, 40 µg/ml collagen I, or 50 µg/ml fibronectin. In some experiments, function blocking antibodies were added to 10 µg/ml for 10 min before plating cells in the continued presence of the antibodies. Cultures were maintained on a Leica DMIRE2 inverted microscope (Deerfield, IL) in a stage incubator (20/20 Technology, Wilmington, NC) providing a humidified, 5% CO₂, 37°C atmosphere. OpenLab software (Improvision, Lexington, MA) running on an Apple iMac computer controlled illumination and image acquisition (Cupertino, CA). After allowing 10 min for cells to settle, images were acquired at a rate of 1 frame/min for 3–6 h, using a Hamamatsu ORCA-285 CCD camera (Bridgewater, NJ) and a 20x C Plan phase objective. NIH Image 1.63 software was used to record the XY position of cell centroids in frames 10 min apart. Custom Java software (code available upon request) was then used to calculate for each cell 1) the distance traveled in each 10-min interval, 2) cumulative distance traveled versus time, 3) total distance traveled, and 4) mean velocity. In initial quantification of the assays, every cell in each field was followed for as long as it remained in view. All cells that could be tracked for at least 1 h were included in the final calculation of velocity. Subsequently, cells that remained free of cell–cell contact for at least 1 h were analyzed separately during contact-free intervals. In addition, selected videos were analyzed hour-by-hour to determine whether average velocities varied during the 3-h assay. To measure directional persistence, cells were allowed to attach and begin migrating for 1 h. The ratio of net migration distance divided by total migration distance for all the individual cells in the field was then calculated during two subsequent 1-h intervals. This ratio could range from 1.0 (for cells that moved unidirectionally for a whole 1-h interval) to 0.0 (for cells that arrived precisely back at their starting location at the end of a 1-h interval). Only cells that remained in view for an entire 1-h interval were used in the calculations.

To quantify lateral and trailing edge morphology, movies were scanned manually frame by frame for the appearance and persistence of lateral and trailing edge adhesive contacts, defined operationally as a region of cell–substratum contact that became visually distinct from the remainder of the lateral and trailing edges (see Figure 6A). An event was defined as an adhesive contact that persisted for 4 min, and the number of events per cell and the mean duration of the events was determined by analyzing the behavior of every cell in the movie field over the 3-h duration of the movie. Four movies per cell type were analyzed.

Detergent Solubility Experiments
Cells, 1.5 x 10⁶, were seeded into the wells of six-well plates. The next day, cells were biotinylated as above, rinsed with HBSM, and gently overlaid with ice-cold 1% Brij 98 (Sigma-Aldrich) in HBSM with protease inhibitors. Cells were extracted for 20 min on ice, with gentle swirling every 5 min, and then the Brij 98 extracts were removed to separate tubes. Next, Brij 98–insoluble material was collected by scraping the cell layers into 1% Triton X-100, 0.1% SDS in HBSM with protease inhibitors and extracting for 1 h at 4°C. All extracts were then clarified and precleared with protein G-Sepharose as described above, before 31 integrin immunoprecipitation. Immunoprecipitates were resolved by SDS-PAGE, blotted with ExtrAvidin-HRP, and visualized by chemiluminescence. For each well, the ratio of Brij 98–soluble to Brij 98–insoluble 31 was determined by semiquantitative densitometry of transilluminated films using GeneTools software (Corvallis, OR) on digitized images captured with a CCD camera in a GeneFlash imaging cabinet (SYNGENE, Frederick, MD).

31 Integrin Internalization Experiments
Internalization and recycling assays were performed as described (Fabbri et al., 1999), with minor modifications. Cells were starved overnight in SFM and harvested as in time-lapse motility assays above. Cells, 5 x 10⁵, were plated in 35-mm dishes that had been coated with 1 µg/ml laminin-5 and blocked with 5 mg/ml BSA. Cells were returned to the 37°C 5% CO₂ incubator for 45 min to allow cells to attach and begin migrating. Dishes were then placed on ice, and cells were rinsed twice with ice-cold HBSM before labeling for 45 min on ice with 0.5 mg/ml Sulfo-NHS-SS-biotin (Pierce Biotechnology). After rinsing twice with cold HBSM, individual dishes were returned to the 37°C incubator at staggered time points for total periods ranging from 0 to 30 min. All dishes were then returned to ice and rinsed once with ice-cold HBSM to stop any further trafficking. To strip biotin from labeled proteins remaining on the cell surface, cells were treated twice for 20 min with 42 mM glutathione (reduced form), 75 mM NaCl, 75 mM NaOH, and 1% BSA. One dish for each cell type was left untreated for measuring total labeled 31 integrin. Cells were rinsed two more times with cold HBSM and then lysed in 1% Triton X-100 in HBSM with protease inhibitors, as described above. Integrin 3 was then immunoprecipitated, visualized with ExtrAvidin-HRP and chemiluminescence, and analyzed with semiquantitative densitometry, as above. In a separate trial, samples were prepared, electrophoresed, and transferred to nitrocellulose as described above. Samples were then visualized by blotting with 1) the D23 polyclonal anti-3 integrin antibody followed by Alexa 680–conjugated goat anti-rabbit secondary, and 2) IRdye 800–conjugated avidin (Rockland, Gilbertsville, PA). The blot was imaged and quantified using the 700- and 800-nm channels of a LiCor infrared fluorescence gel imaging system (Li-Cor, Lincoln, NE), and the ratio of biotinylated 3 signal to total 3 signal was calculated.

Immunostaining
A431 cells were starved overnight in SFM, as for time-lapse assays, and then plated in SFM on acid-washed glass coverslips coated with 1 µg/ml laminin-5. Cells were allowed 1 h to attach, spread, and begin migrating and then fixed 15 min with 10% Formalin (Sigma-Aldrich) in PBS with 2 mM MgCl₂ and 4% sucrose. Cells were rinsed with Tris-buffered saline, pH 8, and then blocked with 10% heat-inactivated goat serum in PBS. Cells were then stained with 2 µg/ml primary antibody in blocking buffer, rinsed, and stained with Cy2 goat anti-mouse secondary antibody, as for flow cytometry. Alternatively, for colocalization experiments, cells were permeabilized with 0.1% saponin during the blocking step and then stained with D23 polyclonal anti-3 integrin and 5C11 monoclonal anti-CD151 antibodies, followed by Alexa 594 goat anti-rabbit and Cy2 goat anti-mouse secondary antibodies. Coverslips were mounted in FluorSave reagent (Calbiochem) and photographed with the video system described above. Positive and negative controls were imaged with identical parameters and processed identically with Adobe Photoshop 7.0 (San Jose, CA). Image overlays for colocalization were performed with Adobe Photoshop.

Adhesion Assays
Substrates for adhesion assays were 1 µg/ml laminin-5, 40 or 5 µg/ml collagen I, 50 or 5 µg/ml fibronectin, 20 µg/ml vitronectin, 100 µg/ml poly-L-lysine (PLL; positive control) or 10 mg/ml heat-inactivated (HI) BSA (negative control). After overnight coating, wells were rinsed and blocked with 10 mg/ml HI BSA. Cells were starved overnight, harvested as for time-lapse motility assays, and resuspended at 3 x 10⁵ cells per ml in serum-free medium, with or without 20 µg/ml specific function blocking antibodies. After allowing 10 min for antibody binding, 100 µl of cell suspension was plated to each of four substrate-coated wells per condition in a 96-well plate. After various times at 37°C, 5% CO₂, wells were rinsed three times using a multichannel pipette with warm DME, 40 mM HEPES, pH 7.2. Positive control PLL wells were gently rinsed once. Cells remaining after rinses were fixed for 30 min at room temperature with warm 10% Formalin in PBS with 2 mM MgCl₂ and then stained for 20 min at room temperature with freshly filtered 0.1% crystal violet in ddH₂O. Cells were destained by rinsing three times with tap water, air-dried 10 min, and solubilized overnight with 100 µl/well of 1% Triton X-100 in ddH₂O. Absorbance at 595 nm was determined with a plate reader. For each cell type, adhesion was expressed as fraction of input cells using absorbances in positive control PLL wells to determine total input. Values for total cells input always varied by <10% for the different cell types.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Efficient Silencing of CD151 Expression by RNAi
To establish a transformed cell line silenced for CD151, we transduced A431 epidermoid carcinoma cells with retroviral vectors encoding shRNAs targeting three different sites on the CD151 mRNA. After selecting stably transduced cells, we evaluated CD151 expression in the uncloned cell populations by flow cytometry (Figure 1A and Table 1). Compared with wild-type control cells, cell lines bearing two of the CD151 shRNAs (sh1 and sh2) displayed no decrease in CD151 expression; however, cells bearing the third shRNA (sh3) displayed a near total loss of cell surface CD151.

View larger version (67K): [in this window] [in a new window]   Figure 1. Efficient silencing of CD151 expression in A431 epidermal carcinoma cells. A431 cells were transduced with retroviral vectors encoding three different CD151 shRNA constructs. Stably transduced cells were selected for 2 wk in puromycin and maintained as uncloned populations. (A) CD151 expression in wild-type parental A431 cells and A431 cells bearing CD151 shRNA constructs was evaluated by flow cytometry. Isotype neg., background staining of wild-type cells with nonimmune mouse IgG1; A431 WT, staining of wild-type cells with 5C11 anti-CD151 antibody; A431 sh1-sh3, staining of cells bearing different CD151 shRNA constructs with the 5C11 antibody. The sh3 construct efficiently silenced CD151 expression in >95% of the cells in the A431 sh3 population. (B) A431 wild-type, sh1, sh2, and sh3 cells were lysed in 1% Triton X-100 and lysate protein concentrations were normalized by BCA assay. CD151 (lanes 1–4) or 3 integrin (lanes 5–8) were immunoprecipitated with the 5C11 antibody or the A3-X8 anti-3 integrin antibody, followed by blotting with the 11B1.G4 anti-CD151 mAb. (C) The same cell populations as in B were cell surface–labeled with biotin and extracted in 1% Triton X-100 followed by CD151 or 31 immunoprecipitation. Biotin-labeled 31 integrin was detected by blotting with Extravidin-HRP. Bottom panel in lanes 5–8 shows a shorter exposure time.

Given the unusually stable interaction of CD151 with 31 integrin (Yauch et al., 1998), it also seemed possible that RNAi might not deplete the pool of CD151 associated with 31 to the same extent as it depleted total CD151. However, immunoblotting CD151 in 31 immunoprecipitates revealed that only a trace of CD151 was present in 31 immunoprecipitates from sh3 cells (Figure 1B, lane 8). In contrast, the amount of CD151 associated with 31 was comparable in wild-type, sh1, and sh2 cells (lanes 5–7). Examining 31 coprecipitation with CD151 from Triton X-100 extracts of cell surface–biotinylated cells yielded similar results. Comparable amounts of 31 coprecipitated with CD151 in wild-type, sh1, and sh2 cells (Figure 1C, lanes 1–3), whereas very little 31 could be detected in a CD151 immunoprecipitate of sh3 cells (lane 4). This last experiment also revealed little if any difference in cell surface 31 expression in any of the cell types (lanes 5–8; see bottom panel for a lighter exposure), a result that was confirmed by flow cytometry (Table 1). Likewise, no differences were observed in cell surface expression of 64 integrin, another major CD151 partner, or 21 integrin, whose association with CD151 is detected in milder detergent conditions (Sincock et al., 1999; Table 1). These data indicated that total, cell surface, and 31-associated pools of CD151 were efficiently silenced in sh3 cells without affecting expression of CD151's weakly or strongly interacting integrin partners.

Loss of CD151 Markedly Impairs 31-dependent Motility on Laminin-5
Because 31 and 64 both associate with CD151 and both serve as receptors for laminin-5, we first tested the relative contributions of these two integrins to A431 cell motility on laminin-5. In time-lapse videomicroscopy assays, untreated wild-type A431 cells displayed rapid, spontaneous migration in response to laminin-5 (Figure 2A). An anti-3 integrin function blocking antibody almost completely abrogated A431 cell motility on laminin-5 (Figure 2B), whereas an anti-6 function blocking antibody had no obvious effect (Figure 2C), suggesting that 31 integrin is primarily responsible for A431 cell motility on laminin-5.

View larger version (58K): [in this window] [in a new window]   Figure 2. CD151 silencing impairs 31 integrin–dependent motility on laminin-5. (A–C) Wild-type A431 cells were plated in serum-free medium on laminin-5 in the absence of antibody (A), the presence of A3-IIF5 anti-3 integrin function blocking antibody (B), or the presence of GoH3 anti-6 function blocking integrin antibody (C). Motility was monitored by time-lapse microscopy. Each gray line represents the cumulative distance traveled by an individual cell versus time. In each field, all cells that could be tracked for at least 1 h were quantified and used to calculate the average velocity (indicated by black arrows). (D) A431 sh3 cell motility on laminin-5 was measured by time-lapse microscopy as in A–C above. For a side by side comparison of wild-type and sh3 cell motility, see Supplementary Video, Figure 2.mov. (E) For two independent trials, average velocities were determined separately for each hour of the assay. A431 sh3 cells were slower than wild-type cells during all 3 h in both trials; *p < 0.0001, unpaired t test. (F) For two independent trials, average velocities of all cells that remained free of cell–cell contact for at least 1 h were determined during the contact-free interval and compared with the average velocity of the entire cell population. sh3 cells were slower than wild-type cells for both contact-free and total cell populations; *p < 0.0001, unpaired t test. (G) Results of several independent motility experiments performed as in A–D. Velocities ± SEM are depicted; n = the number of independent experiments. Velocity of A431 sh3 cells was consistently reduced by 50% compared with wild-type, sh1, and sh2 cells; *p < 0.01 (for sh3 vs. wild-type or sh1 cells), and *p < 0.05 (for sh3 vs. sh2 cells), ANOVA with Bonferroni post-tests. (H) Results of several experiments performed in the presence of the GoH3 function-blocking anti-6 integrin antibody (n = number of independent trials). sh3 cell velocity was significantly reduced compared with wild-type cells; *p < 0.03, unpaired t test.

In several independent trials, wild-type, sh1, and sh2 cells all showed similar, rapid migration on laminin-5, whereas sh3 cells consistently migrated about half as rapidly (Figure 2G). These data provided evidence that the reduced velocity of the sh3 cells was indeed the result of reduced CD151 expression and not the result of nonspecific effects from transduction with retroviral RNAi vectors. To confirm that reduced sh3 cell velocity on laminin-5 reflected altered 31 function, we performed several additional assays in the presence of the function-blocking anti-6 integrin antibody, GoH3. As shown in Figure 2H, these experiments yielded results very similar to the results in Figure 2G, with sh3 cells displaying an 40% reduction in velocity. Although the velocity of wild-type cells treated with GoH3 appeared modestly reduced (15%) compared with the velocity of untreated wild-type cells in Figure 2G, this difference did not rise to the level of statistical significance (p = 0.14, unpaired t test). Together with the data in Figure 2B, these data indicated that A431 cell motility on laminin-5 is strongly 31-dependent and that reduced sh3 velocity on laminin-5 was likely to be largely due to altered 31 integrin function.

The ability of sh1 and sh2 cells to migrate as rapidly as wild-type cells helps to rule out nonspecific effects of our retroviral RNAi vector system as the source of impaired migration in sh3 cells, but as a further control, we used cell sorting to isolate a small population of A431 sh3 cells that retained wild-type CD151 expression levels (Figure 3A). These CD151-positive sh3 "escapers" migrated with wild-type velocity, whereas sh3 cells selected for no CD151 staining above background continued to show the same reduced velocity observed in prior experiments (Figure 3B). These data provided further evidence that the loss of CD151 is specifically responsible for the reduced motility of the A431 sh3 cells.

View larger version (29K): [in this window] [in a new window]   Figure 3. CD151-positive A431 sh3 escapers show wild-type motility on laminin-5. (A) A431 sh3 cells were stained with anti-CD151 antibody, 5C11, and subjected to fluorescence-activated cell sorting. The gates used to isolate CD151-silenced cells (NEG SORT) and CD151-positive cells (ESCAPERS) are indicated. (B) Velocities of CD151-silenced A431 sh3 cells and CD151-positive A431 sh3 escapers were measured by time-lapse microscopy, as for Figure 2. Significantly faster than CD151-silenced cells; *p < 0.0001, unpaired t test. Results are representative of two separate trials that produced similar results.

Loss of CD151 Disrupts 31 Association with Tetraspanin-enriched Microdomains

To assess 31 association with TEMs, we used coimmunoprecipitation to examine 31 interactions with tetraspanins CD9 and CD81 and the IgSF protein EWI-2, a major CD9 and CD81 partner (Clark et al., 2001; Charrin et al., 2003a; Stipp et al., 2003a). These molecules were selected as representatives of TEMs because we previously showed that they form functionally relevant complexes with 31 integrin in the A431 cell environment (Stipp et al., 2003a). As shown in Figure 4A, 31 integrin lost association with EWI-2 (lane 4, middle panel) and CD81 (lane 4, bottom panel) in CD151-silenced sh3 cells, but not in wild-type, sh1, or sh2 control cells (lanes 1–3). In a separate experiment, we also confirmed that 31 association with CD9 is disrupted in sh3 cells (Figure 4B, bottom panel, lane 3; note, samples are out of order), but not in wild-type, sh1, or sh2 cells (lanes 1, 2, and 4). Recovery of 3 integrin itself was similar in all cell types (Figures 4, A and B, top panels). These data indicated that 31 association with CD9/CD81-containing TEMs is disrupted in the absence of CD151.

View larger version (60K): [in this window] [in a new window]   Figure 4. Silencing CD151 disrupts 31 integrin association with tetraspanin-enriched microdomains. (A) A431 wild-type, sh1, sh2, or sh3 cells were lysed in Brij 96, and 3 integrin was immunoprecipitated with the A3-X8 antibody. The amount of 3 in each immunoprecipitate was assayed by blotting with the D23 anti-3 polyclonal antibody, and the amounts of coprecipitating EWI-2 or CD81 were assayed by blotting with 8A12 or biotinylated M38 monoclonal antibodies, respectively. (B) Cells were extracted with Brij 96, and 3 integrin was immunoprecipitated as in A. 3 integrin was blotted with the D23 polyclonal antibody, and coprecipitating CD9 was assayed by blotting the C9BB mAb. (C) Equal numbers of A431 wild-type and sh3 cells were cell surface–labeled with biotin and then extracted on ice with Brij 98 for 20 min. The Brij 98–soluble fraction was gently removed, and Brij 98–insoluble material was recovered by extracting a second time with 1% Triton X-100, 0.1% SDS. 31 integrin was immunoprecipitated from each fraction with the A3-X8 mAb, followed by blotting with Extravidin HRP. (D) Results of three separate experiments performed as in C. Data are presented as the mean ratio of Brij 98 soluble to Brij 98 insoluble material ± SEM Significantly different from wild type; *p < 0.0001, unpaired t test.

Impaired Adhesion of CD151-silenced Cells at Early Time Points on Laminin-5
In a recent report, partial siRNA knockdown of CD151 was reported to inhibit cell adhesion on the 3 integrin ligand, laminin-10 (Nishiuchi et al., 2005). Therefore, we tested whether our CD151-silenced cells displayed impaired adhesion on laminin-5. A431 wild-type and sh3 cells were plated on ice in laminin-5–coated wells, allowed to settle, and then placed at 37°C for varying amounts of time. As shown in Figure 5A, after 20 min at 37°, both wild-type and sh3 cells displayed adhesion above background, but adhesion of sh3 cells was modestly but significantly impaired (30% reduction in specific adhesion above background for sh3 cells). After 30 min, adhesion of both cell types had increased, but sh3 cells continued to display a modest, but significant reduction in adhesion (18% reduction in specific adhesion above background).

View larger version (49K): [in this window] [in a new window]   Figure 5. Adhesion to laminin-5 is impaired at early time points but not later time points for CD151-silenced cells. (A) A431 wild-type or sh3 cells, 2 x 105, were plated on ice in laminin-5 or BSA-coated wells, allowed to settle, and placed at 37°C for various periods of time. Nonadherent cells were removed by rinsing, and adherent cells were stained with crystal violet, solubilized, and quantified using a plate reader. Values are reported as the fraction of cells input as measured by cells attached to PLL control wells. Experimentally determined values for total cells input varied by <10% for the two cell types. Points represent the mean ± SEM for four wells per condition. Significantly different from wild type; *p < 0.01; Significantly different from wild type; **p < 0.005, unpaired t test. The experiment was repeated twice with essentially identical results. (B) A431 wild-type or sh3 cells, 2 x 105, were plated in laminin-5 or BSA-coated wells and allowed to attach for 30 or 120 min. Wells were rinsed, stained, and quantified as in A. For some wells function-blocking anti-3 and 6 integrin antibodies A3-IIF5 and GoH3 were added in combination, 10 µg/ml each. Two independent trials are shown. A431 sh3 cell adhesion was significantly reduced compared with wild-type cells after 30 min on laminin-5 and after 120 min on BSA; *p < 0.02; **p < 0.005; p < 0.0005, unpaired t tests. (C) A431 wild-type and sh3 cells were plated on BSA-coated coverslips for 2 h and then fixed and stained with the 6F12 anti-laminin-5 mAb, followed by Cy2-conjugated goat anti-mouse secondary antibody. Left panels, DIC images; right panels, laminin-5 staining. Negative control staining for this experiment was shared with the experiment in Figure 7 (see Figure 7M).

Altered Lateral and Trailing Edge Morphology in A431 sh3 Cells Migrating on Laminin-5
Because A431 sh3 cells adhered as well as wild-type cells to laminin-5 after 2 h, yet continued to display impaired laminin-5–dependent motility at this time point (Figure 2E), we examined motility of sh3 cells on laminin-5 in greater detail. We noticed that sh3 cells migrating on laminin-5 frequently exhibited persistent protrusions at their lateral and trailing edges, in contrast to the typically smooth trailing edges of wild-type A431 cells (Figure 6A, white arrows, see also Supplementary Video, Figure 6.mov). As sh3 cells continued to move, these protrusions appeared to come under significant tension, snapping back into the cell soma upon release, suggesting that they had been maintained by adhesive contact with the substrate. Quantification revealed that the frequency of apparent lateral and trailing edge adhesive events that persisted 4 min or longer was increased nearly twofold in sh3 cells compared with wild-type cells (Figure 6B). Furthermore, the mean lifetime of such events increased by 67%, from 6.5 min in wild-type cells to 10.7 min in sh3 cells (Figure 6C). As seen in Figure 6.mov (and in Figure 2.mov), in conjunction with persistent lateral and trailing edge adhesions, sh3 cells frequently appeared to change their direction of migration. We therefore tested whether directional persistence (defined as net migration distance divided by total migration distance) was reduced for sh3 cells. As shown in Figure 6D, sh3 cells displayed a 25–44% reduction in directional persistence in two independent trials. Collectively, these data suggested that the decreased migration rate observed for sh3 cells might be due in part to altered 31 function at the lateral and trailing edges of the cells.

View larger version (60K): [in this window] [in a new window]   Figure 6. Lateral and trailing edge defects in CD151-silenced A431 sh3 cells migrating on laminin-5. (A) Individual frames from time-lapse videos comparing morphology of A431 wild-type and sh3 cells migrating on laminin-5. Rapidly migrating wild-type cells typically display smooth trailing edges and a compact but highly active leading lamellipodium. A431 sh3 cells frequently display persistent adhesive contacts that arise at their lateral and trailing edges (white arrows). Elapsed time is indicated to left of each pair of panels. Time 0' in this series corresponds to the 20-min time point in Supplementary Video, Figure 6.mov, which shows a side be side comparison of wild-type and sh3 morphology. Lateral/trailing edge adhesive contacts of sh3 cells persist for several minutes and appear to come under tension before snapping back into the cell soma within 1–2 min. (B) The frequency of lateral and trailing edge adhesive events, such as those depicted in A, that lasted 4 min or longer was measured for A431 wild-type and sh3 cells in four separate 3-h videos. Significantly different from wild-type cells; *p < 0.05%, unpaired t test. (C) The mean duration of lateral and trailing edge adhesive events for A431 wild-type and sh3 cells was measured in four separate 3-h videos. Significantly different from wild-type cells; *p < 0.01%, unpaired t test. (D) In two independent trials, A431 wild-type and sh3 cells migrating on laminin-5 were tracked for 2 h, and directional persistence for each cell was calculated during each hour. Persistence was defined as the ratio of net distance traveled divided by total distance traveled. The average persistence of sh3 cells was significantly reduced compared with wild-type cells; *p < 0.03; **p < 0.0001, unpaired t test.

View larger version (37K): [in this window] [in a new window]   Figure 7. Localization of 31 integrin and CD151. Unpermeabilized A431 wild-type or sh3 cells were stained for 3 integrin with the A3-X8 mAb (A and B) or the 5C11 anti-CD151 mAb (C and D) followed by Cy2 goat anti-mouse secondary antibody. For codistribution studies, cells were permeabilized with 0.1% saponin and stained with the D23 polyclonal anti-3 integrin antibody, which binds to the 3 cytoplasmic tail, followed by Alexa 594 goat anti-rabbit secondary (E and F) and the 5C11 anti-CD151 mAb followed by Cy2 goat anti-mouse secondary (G and H). Overlays are shown in I and J. Arrows indicate regions of 3 and CD151 codistribution. In negative control experiments, cells were stained with the D23 antibody followed by Cy2 goat anti-mouse (K), 5C11 followed by Alexa 594 goat anti-rabbit (L), or nonimmune mouse IgG followed by Cy2 goat anti-mouse (M).

Impaired 31 Trafficking in A431 sh3 Cells

View larger version (26K): [in this window] [in a new window]   Figure 8. Impaired trafficking of 31 integrin in CD151-silenced cells migrating on laminin-5. (A) A431 wild-type and sh3 cells migrating on laminin-5 were chilled to 4°C and labeled on ice with reducible biotin. Cells were then returned to 37°C for various periods to allow internalization of labeled integrin, after which they were stripped with alkaline glutathione (GSH) to remove any label remaining on the cell surface. Cells were then lysed in 1% Triton X-100, and 31 integrin was immunoprecipitated using the A3-X8 antibody and visualized by blotting with Extravidin-HRP. T, total 31 as measured from immunoprecipitates of cells that had been labeled and held on ice in the absence of glutathione stripping. To control for efficiency of immunoprecipitation in each sample, -tubulin (-tub) was simultaneously immunoprecipitated and then detected by immunoblotting using the anti-tubulin mAb, DM1B. (B) Results of two independent trials performed as in A are plotted as fraction of 31 internalized versus time. Values were obtained by semiquantitative densitometry of transilluminated films. Data were fit to pseudo first-order kinetics using Prism software (GraphPad, San Diego, CA). (C) In a third trial, samples were prepared as in A and B, but biotinylated and total 3 were detected simultaneously on the same blot. Biotinylated 3 was visualized with IRdye 800 avidin and total 3 was visualized with the D23 anti-3 antibody followed by blotting with Alexa 680 goat anti-rabbit. The blot was analyzed with a Li-Cor infrared gel imager in the 700- and 800-nm fluorescent channels. Lower panel, overlay of two top panels. (D) The blot shown in C was quantified with Li-Cor software, and the ratio of 3 biotin counts to total 3 counts was determined for the 10- and 30-min time points.

Reexpression of CD151 in A431 sh3 Cells Reverses Defects in 3 and 6 Integrin Functions
A critical issue in RNAi experiments is the potential for off-target effects. To confirm that the phenotypes of our CD151-silenced cells were indeed due to the specific loss of CD151 expression, we performed reconstitution experiments. We first confirmed that our CD151-silenced cells, which had been sorted to be free of CD151-positive "escapers" (Figure 3), had not reexpressed CD151 over the intervening 23 wk (Figure 9A). We then transduced these cells with a CD151 retroviral expression vector (CD151 Rx), containing two silent mutations within the region targeted by the CD151 sh3 shRNA construct. These silent mutations defeated RNAi targeting, allowing CD151 to be reexpressed at wild-type levels (Figure 9A). We called these cells A431 sh3 Rx cells. Cell surface labeling experiments confirmed that the CD151-31 integrin complex, which was virtually absent in A431 sh3 cells, was restored to wild-type levels in the A431 sh3 Rx cells (Figure 9B, lanes 1–3). All three cell types expressed a similar level of 3 integrin on the cell surface (Figure 9B, lanes 4–6).

View larger version (43K): [in this window] [in a new window]   Figure 9. Reexpression of CD151 in A431 sh3 cells reverses defects in 3 and 6 integrin functions. A CD151 cDNA (CD151 Rx) containing silent mutations that defeat RNAi was used to restore CD151 expression in A431 sh3 cells (Materials and Methods for details). (A) Flow cytometry using the 5C11 anti-CD151 antibody to stain A431 wild-type cells, A431 sh3 cells, or A431 sh3 cells reconstituted with CD151 (Rx). neg, con., wild-type cells stained with an isotype-matched negative control antibody. (B) A431 wild-type, sh3, and sh3 Rx cells were cell surface–labeled with biotin and extracted with 1% Triton X-100. CD151 or 3 integrin were immunoprecipitated with 5C11 or the A3-X8 anti-3 integrin antibody, respectively, and 31 integrin was detected by blotting with Extravidin-HRP. (C) A431 wild-type, sh3, or sh3 Rx cells were plated in laminin-5– or BSA-coated wells, in the presence or absence of 10 µg/ml function-blocking antibodies. After 25 min, nonadherent cells were removed by rinsing, and adherent cells were stained and quantified as in Figure 5. Function blocking antibodies were anti-6 integrin, GoH3, and anti-3 integrin, A3-IIF5. Values represent the means ± SEM of eight wells per condition from two experiments that yielded very similar results. Values are reported as the fraction of total input cells measured in PLL-coated-wells, as in Figure 5. Significantly different from either wild-type or sh 3 Rx cells (*p < 0.001) ANOVA with Bonferroni post-tests. The A431 sh3 cell defect in 6 integrin–dependent adhesion shown in the third set of C is also illustrated by time-lapse assay in Figure 9.mov, in which cells treated with A3-IIF5 anti-3 antibody are plated on laminin-5. (D) A431 wild-type, sh3, and sh3 Rx cells motility on laminin-5 was measured in multiple separate time-lapse assays as in Figure 2 (at least 5 trials per cell type). Significantly different from either wild-type (*p < 0.001) or sh3 Rx cells (*p < 0.05), ANOVA with Bonferroni post-tests.

The defect in 6-dependent sh3 cell adhesion was also dramatically illustrated by time-lapse assays of cells plated on laminin-5 in the presence of 3 function-blocking antibody (see Supplementary Video, Figure 9.mov). At the beginning of the assays, which started 15 min after plating, most wild-type cells appeared loosely adherent to the laminin-5 substrate, while many sh3 cells remained nonadherent and were swept along by current flow in the plating medium. At intermediate time points, sh3 cells remained loosely adherent and unspread, while many wild-type cells had begun to spread partially, extending short protrusions and/or small lamellipodia. These short protrusions appeared qualitatively different from the persistent lateral/trailing edge protrusions observed in migrating sh3 cells in Figure 6A and Figure 6.mov because 1) they formed circumferentially around the perimeter of the cells, 2) they were not associated with any significant translocation of the cell body, and 3) they were not observed to "snap back" into the soma, as had been observed during sh3 cell migration. Rather, they more closely resembled similar protrusions observed in 3-null keratinocytes plated on laminin-5 (Choma et al., 2004; see Discussion). Only toward the end of the assay did sh3 cells begin to elaborate protrusions and spread.

Used together, anti-3 and 6 antibodies blocked adhesion of all cell types on laminin-5 to background levels (Figure 9C, fourth set). Additional time-lapse assays revealed that A431 sh3 Rx cell motility on laminin-5 was restored to a level indistinguishable from that of wild-type cel