QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 17, Issue 6, 2824-2838, June 2006

This Article Abstract Full Text (PDF) All Versions of this Article: E05-11-1040v1 17/6/2824    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barale, S. Articles by Arkowitz, R. A. Search for Related Content PubMed PubMed Citation Articles by Barale, S. Articles by Arkowitz, R. A.

Cdc42p GDP/GTP Cycling Is Necessary for Efficient Cell Fusion during Yeast Mating

Sophie Barale^*,, Derek McCusker^,, and Robert A. Arkowitz^*

*Institute of Signaling, Developmental Biology, and Cancer, Centre National de la Recherche Scientifique UMR 6543, Université de Nice, Faculté des Sciences-Parc Valrose, 06108 Nice Cedex 2, France; and Department of Biology, Sinsheimer Laboratories, University of California at Santa Cruz, Santa Cruz, CA 95064

Submitted November 14, 2005; Revised March 2, 2006; Accepted March 20, 2006
Monitoring Editor: Janet Shaw

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The highly conserved small Rho G-protein, Cdc42p plays a critical role in cell polarity and cytoskeleton organization in all eukaryotes. In the yeast Saccharomyces cerevisiae, Cdc42p is important for cell polarity establishment, septin ring assembly, and pheromone-dependent MAP-kinase signaling during the yeast mating process. In this study, we further investigated the role of Cdc42p in the mating process by screening for specific mating defective cdc42 alleles. We have identified and characterized novel mating defective cdc42 alleles that are unaffected in vegetative cell polarity. Replacement of the Cdc42p Val36 residue with Met resulted in a specific cell fusion defect. This cdc42[V36M] mutant responded to mating pheromone but was defective in cell fusion and in localization of the cell fusion protein Fus1p, similar to a previously isolated cdc24 (cdc24-m6) mutant. Overexpression of a fast cycling Cdc42p mutant suppressed the cdc24-m6 fusion defect and conversely, overexpression of Cdc24p suppressed the cdc42[V36M] fusion defect. Taken together, our results indicate that Cdc42p GDP–GTP cycling is critical for efficient cell fusion.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Eukaryotic cells respond to a range of different external signals by gene induction, protein recruitment and activation, and morphological changes. Such responses are critical during diverse developmental processes. The mating process in the yeast Saccharomyces cerevisiae is an ideal system for investigating external signal-mediated responses as exposure to mating pheromone triggers an ordered series of events, which terminates in the formation of a diploid zygote. During mating in S. cerevisiae, MATa and MATa cells respond to peptide pheromones, - and a-factor, respectively, secreted by cells of the opposite mating type (for reviews see; Leberer et al., 1997; Dohlman and Thorner, 2001). These mating pheromones bind to specific G-protein–coupled receptors on each cell type and receptor activation results in cell cycle arrest, transcriptional induction of mating-specific genes, morphological changes leading to formation of a pear-shaped shmoo, and polarized growth toward a mating partner. In response to pheromone, the actin cytoskeleton and secretory apparatus polarize toward the tip of the mating projection (Baba et al., 1989; Read et al., 1992; Smith et al., 2001), and new cell wall and plasma membrane material is deposited at this unique location, which becomes the site of cell contact and ultimately fusion (Lipke et al., 1976; Tkacz and MacKay, 1979). In particular, polarized growth is necessary for positioning the cell fusion apparatus to the site of cell contact. During mating, two yeast cells physically attach to one another forming a prezygote with a continuous extracellular matrix. Specific degradation of the cell wall material at the prezygote septum is necessary so that the plasma membranes can become tightly apposed and fuse. Subsequently, nuclear migration and nuclear fusion result in the formation of a diploid zygote.

The binding of pheromone to the G-protein–coupled pheromone receptor results in release of the subunits of the heterotrimeric G-protein. This heterodimer G is critical for activation of the mitogen-activated protein kinase (MAPK) cascade that is necessary for G₁ cell cycle arrest and mating-specific gene transcription. In addition, released G is required for cell shape changes and oriented growth along a pheromone gradient (chemotropism) via interactions with the guanine nucleotide exchange factor Cdc24p and the cyclin-dependent kinase inhibitor Far1p (Valtz et al., 1995; Butty et al., 1998; Nern and Arkowitz, 1998, 1999). Recently, it has been shown that the released G subunit can bind the MAP kinase Fus3p, which subsequently phorphorylates the formin Bni1p (Metodiev et al., 2002; Matheos et al., 2004), both of which are necessary for cell fusion leading to a diploid zygote (Dorer et al., 1997).

Proteins involved in different signaling processes, such as osmotic balance (Philips and Herskowitz, 1997; Nelson et al., 2004), cell wall remodeling (Santos et al., 1997; Fitch et al., 2004), cell polarization (Valtz and Herskowitz, 1996; Dorer et al., 1997; Gammie et al., 1998), and pheromone response (Brizzio et al., 1996; Elia and Marsh, 1998) are important for cell fusion. In addition, several proteins that are highly induced by mating pheromone including the integral membrane protein Fus1p and the cytoplasmic protein Fus2p, which binds the yeast amphiphysin ortholog Rvs161p (Brizzio et al., 1998), are thought to have a specific function in cell fusion (Trueheart et al., 1987) and interact with a range of proteins implicated in cell fusion (Nelson et al., 2004). These proteins may serve as a scaffold or platform for proteins involved in pheromone signaling and polarity. Fus1p and Fus2p localize to the region of cell fusion before cell wall degradation (Trueheart et al., 1987; Elion et al., 1995; Brizzio et al., 1998), where clusters of vesicles have been observed by electron microscopy (Gammie et al., 1998). Fus1 mutants do not accumulate such vesicles at the zone of cell fusion, whereas fus2 mutants accumulate vesicles at this region (Gammie et al., 1998). For plasma membrane fusion the integral membrane protein, Prm1p is important for stabilizing membrane fusion after septum degradation (Heiman and Walter, 2000; Jin et al., 2004).

The highly conserved small GTPase Cdc42p and its guanine nucleotide exchange factor Cdc24p are critical for polarized growth during budding (Johnson, 1999). Cdc42p has been shown to also be required for pseudohyphal and invasive filamentous growth (Mosch et al., 2001). Temperature-sensitive cdc42 and cdc24 mutants are defective in pheromone-dependent FUS1 induction and G₁ arrest at the nonpermissive temperature (Simon et al., 1995); however, these effects are likely to be due to an unresponsiveness to pheromone as a result of cells in an inappropriate cell cycle stage (Oehlen and Cross, 1998). Several -factor resistant alleles of cdc42 have been isolated that are defective in PAK kinase interactions indicating that this G-protein functions in pheromone-dependent MAP-kinase signaling (Moskow et al., 2000). Mating-specific cdc24 mutants have been isolated that are chemotropism defective (Nern and Arkowitz, 1998), and more recently, cdc24 alleles that are defective in cell fusion have been isolated (Barale et al., 2004). These cdc24 alleles defective in cell fusion during mating have mutations in conserved residues of the catalytic exchange factor domain, raising the possibility that Cdc42p might also be important for cell fusion. The role of this GTPase module could be analogous to that of the guanine nucleotide exchange factor Myoblast city (a DOCK-180 homolog) and the small G-protein Rac1 during Drosophila myoblast fusion (Nolan et al., 1998; Hakeda-Suzuki et al., 2002). Consistent with this hypothesis, a recent study examining two-hybrid interactions of Fus1p showed that a GTP-locked Cdc42p mutant (G12V) interacts with Fus1p and Fus2p (Nelson et al., 2004).

In this study, we show that the highly conserved Rho G-protein Cdc42p is necessary for cell fusion in yeast. We identified mating-specific cdc42 mutants that had a valine-to-methionine change in position 36 in the Switch I region. This cdc42 mutant responds to mating pheromone but is defective in cell fusion and in localizing Fus1p to the site of polarized growth, similar to the previously isolated cdc24-m6 mutant. Overexpression of a fast cycling Cdc42p mutant suppresses the cdc24-m6 fusion defect, and conversely, overexpression of Cdc24p suppresses the cdc42[V36M] fusion defect. Together our results indicate that Cdc42p GDP–GTP cycling is critical for cell fusion.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
General Techniques
Standard techniques and media were used for yeast growth and genetic manipulation (Rose et al., 2004), and unless otherwise indicated yeast were grown at 30°C.

Strains and Plasmids
The strains used in this study are described in Table 1. CDC42 deletion strains were generated either with a knockout cassette (1) or by polymerase chain reaction (PCR)-mediated gene replacement (2; Nern and Arkowitz, 1999). The knockout cassette was constructed from pBSCDC42 (CDC42 ORF with 147 nucleotides 3' of stop codon) with LEU2 replacing all but the first 62 and the last 15 codons. STE18 deletion strain was generated by PCR-mediated gene replacement (Nern and Arkowitz, 1999). Gene disruptions were confirmed by PCR and phenotype. A cdc24 cdc42 haploid strain with CDC24 and CDC42 on CEN plasmids (RAY1728) was obtained by crossing the corresponding single deletion strains (a derivative of RAY1052 with a pRS414CDC24 and RAY1556) followed by sporulation. Cdc24 cdc42 double mutant strains were generated by transformation and plasmid shuffling of RAY1728. For all experiments, with the exception of suppression experiments, the indicated CDC24, cdc24, CDC42, and cdc42 genes are the sole copies present, and their expression is driven by their endogenous promoters on CEN plasmids. Fusion defects were similar in all strain backgrounds (single and double deletion strains and both mating types).

For localization of Cdc42p, pRS413GFPCDC42, which contained a 521-nucleotide CDC42 promoter followed by GFP fused to CDC42, was used. GFP was PCR amplified using a 5' primer with a HindIII site preceding the ATG and a 3' primer with an EcoRI site 5' of the stop codon. This HindIII/EcoRI-digested PCR product was cloned into appropriately digested pBluescript, yielding pBSGFP. Subsequently CDC42 was PCR amplified using a 5' primer with an EcoRI site immediately 3' of the ATG and a 3' primer with a BamHI site after the stop codon using pBSCDC42 as a template and cloned into EcoRI/BamHI-digested pBSGFP, yielding pBSGFPCDC42. The promoter region of CDC42 (521 nucleotides 3' of ATG) was PCR amplified from genomic DNA using 5' primer with a XbaI site and a 3' primer with a HindIII site that replaced 6 nucleotides 5' of the ATG. This XbaI/HindIII-digested CDC42 promoter fragment together with a HindIII/SacI GFPCDC42 fragment from pBSGFPCDC42 were cloned into pRS413 digested with XbaI/SacI, yielding p413GFPCDC42. pRS424GALGFPCDC42 was constructed by cloning a BamHI/KpnI GFPCDC42 fragment from pBSGFPCDC42 into appropriately digested pRS424GAL. pRS424GAL was constructed by cloning a NgoMIV/SacII GAL1 fragment from pRS416GAL into appropriately digested pRS424. pRS416GAL was constructed by cloning a NgoMIV/XbaI GAL1 fragment from pYes into appropriately digested pRS416. For the localization of Fus1GFP, a 5.2-kb NgoMIV/ScaI FUS1GFP fragment from pRS316FUS1GFP (Santos and Snyder, 2003) was cloned into an appropriately digested pRS413 vector. For septin localization pRS316-CDC3-GFP (Caviston et al., 2003) was used.

For in vitro–coupled transcription-translation, the entire CDC24 ORF (a 2.6-kb BamHI/SalI fragment) from pEG(KT)CDC24 was cloned into a pT7Tag plasmid (Pollock and Treisman, 1990). Furthermore, the entire CDC42 ORF was amplified by PCR using a 5' primer preceded by a BamHI site and a 3' primer with an XbaI site after the stop codon using pBSCDC42 as a template and cloned into pT7Tag plasmid (Pollock and Treisman, 1990). For MBPCdc42p expression, the entire CDC42 ORF was PCR amplified using a 5' primer with an EcoRI site immediately 3' of the ATG and a 3' primer with a BamHI site after the stop codon with pBSCDC42 as a template and cloned into EcoRI/BamHI-digested pMal-c2 (New England Biolabs, Saint Quentin en Yvelines, France). For GST-CRIB pulldown experiments, the CRIB domain of Ste20p was amplified by PCR with primers containing unique BglII and NotI sites. This PCR product, which encodes aa 304-346 of Ste20p, was then cloned into a pGEX 6P-2 plasmid (Amersham, Orsay, France). All constructs were verified by dye terminator sequencing (ABI prism).

Isolation of Mating Mutants
For the initial cdc42 mutant screen, the entire ORF was amplified with Taq polymerase using mutagenic PCR conditions with pBSCDC42 as a template and cloned into HindIII/XbaI-digested pRS416CDC42 as previously described (Nern and Arkowitz, 1998; Barale et al., 2004). This library was transformed into RAY513, and mating mutants were isolated (Nern and Arkowitz, 1998; Barale et al., 2004). The second screen was carried out in which the Switch I region (amino acids 31-41) was mutagenized using oligonucleotide mixtures. An oligonucleotide encompassing this region (GACTATGTTCCAACAGTGTTCGATAACTATGCG) with 15 base pairs on 5' and 3' ends was synthesized in which at each base there was a mixture of 91% indicated base and 3% of the three remaining bases. This frequency was chosen to introduce between two and three nucleotide changes per mutant copy. Ten bacterial clones of this library were sequenced, confirming that mutations were randomly located. In the third screen the valine 36 residue in Cdc42p was changed to 15 different amino acids (V36M, V36A, V36L, V36I, V36P, V36S, V36T, V36Y, V36W, V36Q, V36C, V36K, V36R, V36H, V36E) with the Pfu polymerase (Promega) using the DpnI method (Weiner et al., 1994). These mutants were transformed into RAY513, and viability was assessed by growth on glucose-containing media. Spot matings were also carried out with log phase–growing cells on a lawn of enfeebled tester RAY1142 on a YEPD plate incubated 3 h at 30°C before being replica plated.

Sequence Alignment and Structure Modeling
Sequence alignments were carried out using the BLAST algorithm (Altschul et al., 1990). Structural model threading was generated by homology modeling of the S. cerevisiae Cdc42p primary sequence using Swiss-Model service based on the transition state human Cdc42 complex for GTP hydrolysis structure pdb file 2NGR (Nassar et al., 1998).

Mating Assays, Pheromone Response Assays, and Phenotypic Analyses
Patch and quantitative mating were carried out as described (Nern and Arkowitz, 1998) with the indicated tester strain. Bud scars and actin cytoskeleton were visualized with formaldehyde-fixed cells as previously described (Nern and Arkowitz, 1998) except that Alexa-488 phalloidin (Molecular Probes, Cergy Pontoise, France) was used for the latter. Pheromone-induced cell cycle arrest (halo assays), induction of a Fus1LacZ reporter, and cell shape changes were assayed as described (Nern and Arkowitz, 1998, 1999). For quantitative cell fusion assays, matings were performed as described (Barale et al., 2004). Mating pairs included both prezygotes and zygotes, where prezygotes were identified as a mating pair in which only one cell was fluorescent and a septum was visible between the cells. The percentage of prezygotes is the number of prezygotes divided by the total number of mating pairs.

Microscopy
Actin cytoskeleton was imaged using a Deltavision deconvolution microscopy system (Applied Precision, Issaquah, WA) on an Olympus IX-70 microscope (Rungis, France) with an NA 1.4 60x objective. Images were deconvolved using softWoRX, and maximum intensity projections of Z-stacks were carried out. Cells were examined using a Leica DMR epifluorescence microscope (Rueil-Malmaison, France) with an NA 1.35 100x objective. Images were recorded with a Princeton Instruments Micromax CCD (Roper Scientific, Evry, France), using IPLab (Scanalytics, Rockville, MD) software. Scale bars represent 5 µm.

Immunoblot Analyses
Total yeast protein extracts were prepared (Nern and Arkowitz, 1999) from budding and shmooing cells using 10⁷ cells and from mating mixtures using 10⁶ cells. Extracts were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE), transferred to nitrocellulose membrane (Amersham), and probed with a polyclonal serum against Cdc42p (1:1000), a mouse monoclonal antibody (mAb) BP1FG (a kind gift from T. Lithgow, 1:10,000) against glyceraldehyde-3-phosphate dehydrogenase, a polyclonal serum against GFP (1:5000; Nern, 2000), or an mAb against HA (HA.11 Babco, Seraing, Belgium, 1:1000). Polyclonal serum against Cdc42p was either from Santa Cruz Biotechnology (Heidelberg, Germany, sc-7172) or from rabbits immunized with MBPCdc42. Immunoblots were visualized by enhanced chemiluminescence (luminol-coumaric acid) on a Fuji-Las3000 (Clichy, France). Equal amounts of cells were used in each experiment, and equal amounts of protein in each lane were confirmed by Ponceau S staining of nitrocellulose membranes.

In Vitro Binding Studies
In vitro–coupled transcription-translation was carried out using a Quick TNT rabbit reticulocyte lysate system (Promega) and 80 µCi [³⁵S]methionine (ICN, Illkirch, France, 1175 Ci/mmol) in a reaction volume of 100 µl using either pT7CDC24, pT7CDC42, pT7cdc42[V36M], or pT7cdc42[T35A], following the manufacturer's instructions.

MBPCdc42 fusion proteins or GSTCRIB fusion protein were expressed in BL21 Escherichia coli cells grown at 37°C. After 4-h induction with 0.1 mM IPTG, cells were resuspended in 10% sucrose, 50 mM TrisCl, pH 8, and frozen in liquid nitrogen. All subsequent steps were carried out at 4°C. Cells were lysed by sonication in buffer A (phosphate-buffered saline containing 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 0.1% Triton X-100). Extracts were clarified by centrifugation (10,000 x g for 10 min), and fusion proteins were isolated using amylose resin (New England Biolabs) or glutathione Sepharose 4B (Amersham). Protein concentrations were estimated by comparing intensities of bands on Coomassie-stained SDS-PAGE gels.

For Cdc24p Cdc42p bindings amylose resin bound MBPCdc42 was incubated with buffer B (20 mM TrisCl, pH 7.5, 50 mM NaCl, 1 mM DTT, 5% glycerol, 0.1% Triton X-100, and Boehringer Mannheim protease inhibitor, Meylan, France) containing 10 mM EDTA, for 1 h at room temperature in order to strip nucleotides (nucleotide free). To GTPS load nucleotide free fusion proteins, amylose resin–bound MBPCdc42 was incubated with buffer B containing 10 mM MgCl₂ and 120 µM GTPS (Boehringer Mannheim) for 30 min at room temperature (Hart et al., 1994). For binding assays, MBPCdc42 fusion proteins (500 ng) bound to amylose resin were incubated with [³⁵S]Cdc24p in 100 µl of buffer B containing either 10 mM EDTA or 10 mM MgCl₂ and 120 µM GTPS for 2 h at 30°C. Amylose resin samples were then washed five times with 100 µl of the respective buffer. Proteins were eluted with SDS-PAGE sample buffer and analyzed by SDS-PAGE followed by Coomassie blue staining and autoradiography. A Fuji BAS1000 phosphorimager was used for quantification based on two input amounts.

For GSTCRIB pulldown experiments, EDTA (30 µM) was first added to 100 µl of the in vitro–translated [³⁵S]Cdc42p; subsequently GTPS (0.3 mM) was added, the reaction was incubated at room temperature for 15 min, and finally MgCl₂ (200 µM) was added. Subsequently GSTCRIB bound to GSH agarose was added, and reactions were incubated for 1 h at 4°C. Glutathione Sepharose resin samples were then washed five times with 200 µl of GPL buffer (20 mM TrisCl, pH 7.4, 150 mM NaCl, 5 mM MgCl₂, 5 mM glycerol phosphate, 1 mM DTT, Boehringer Mannheim protease inhibitor, 0.5% NP-40), and then proteins were eluted in SDS-PAGE sample buffer and analyzed by SDS-PAGE, followed by autoradiography and phosphorimager quantification.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Identification of cdc42 Mating Mutants
To elucidate the functions of the Rho G-protein Cdc42p in the yeast mating process, we screened a randomly mutagenized library for cdc42 mutants specifically defective in mating, as previously described (Nern and Arkowitz, 1998; Barale et al., 2004). Over 25,000 yeast colonies were tested for mating-specific defects and two mutants were isolated. Sequencing revealed that both mutants had the amino acid alteration V36M. One of these mutants had an additional P69T mutation. Recreation of each individual amino acid change indicated that V36M was responsible for the mating defect. Valine 36 is located in the Switch I region (Figure 1, A and B). Switch I and II regions undergo nucleotide-dependent conformational changes when the two hydrogen bonds between an amino acid from each Switch domain and the gamma phosphate of GTP are released after GTP hydrolysis (Vetter and Wittinghofer, 2001). Structural studies have revealed that these Switch regions show increased flexibility compared with the rest of the G-protein (Farrar et al., 1997; Ito et al., 1997). Hence we mutagenized the region encoding amino acids 31-41 using randomized oligonucleotide mixtures. These oligonucleotide mixtures were designed to introduce on average two to three nucleotide changes in each CDC42 copy. After screening 3000 yeast transformants, 14 mutants defective in mating were isolated. Sequencing revealed 9 mutants, which had only the V36M amino acid change. Two mutants had the V36M amino acid change in addition to a second change (either D38A or A41R), and two mutants had both the V36A and A41G amino acid alterations. Finally, one mating mutant had a F37I mutation. The cdc42[V36M], cdc42[V36A, A41G], and cdc42[F37I] mutants were all defective for mating when crossed with an enfeebled mating partner (Figure 1C) and did not exhibit any growth defects at 30 and 37°C (Figure 1D).

View larger version (42K): [in this window] [in a new window]   Figure 1. Characterization of cdc42 mating mutants. (A) Three-dimensional structure model of S. cerevisiae Cdc42p. Model generated by homology modeling of S. cerevisiae primary sequence using Swiss-Model service based on the transition state Cdc42 complex for GTP hydrolysis structure pdb file 2NGR (Nassar et al., 1998). The amino acid residue Val 36 identified in this study is indicated, and Switch I and Switch II domains are colored in blue. (B) Sequence alignment of S. cerevisiae Cdc42p (ScCdc42) and human Cdc42 (HsCdc42). Vertical lines indicate identical residues. Guanine nucleotide-binding domain (GDP/GTP), Switch I and II regions, Rho insert, and membrane localization domain are indicated. (C) Spot mating of cdc42 mutants isolated from screen of aa 31-41. Matings using strains derived from RAY513 with indicated CDC42 or cdc42 gene (as sole copy behind its endogenous promoter on a CEN plasmid) are shown. Matings were carried out with the enfeebled tester RAY1142. (D) Cdc42 mutants grow normally. Serial dilutions of indicated mutants (same strains as above) were spotted onto YEPD plates and incubated for 2 d at the indicated temperatures.

View larger version (59K): [in this window] [in a new window]   Figure 2. cdc42[V36M] cells respond to mating pheromone. (A) cdc42[V36M] cells are not resistant to mating pheromone. CDC42 (RAY1772), cdc42[V36M] (RAY1926), and ste18 strains were spotted on YEPD plates containing or lacking 8 µg/ml -factor and incubated for 5 d. (B) cdc42[V36M] cells arrest growth in the presence of mating pheromone similar to wild-type cells. -factor (1, 0.5, and 0.2 µg) was spotted on filters placed on a lawn of the indicated strain. Plates were incubated for 3 d. Measurements of the halo diameter indicated 5% difference between CDC42 and cdc42[V36M] halos. (C) cdc42[V36M] cells induce the mating-specific FUS1 gene in a pheromone-dependent manner. Cells containing the FUS1-lacZ plasmid pSG231 were incubated with 10 µM -factor for 1 h, and LacZ activity was determined. The means of four determinations from two independent experiments are shown. Error bars, SD. LacZ activity for CDC42 cells (21.0 Miller units) was set at 100%. (D) cdc42[V36M] cells polarize their actin cytoskeleton. DIC and fluorescence images of budding cells and cells treated with 12 µM -factor for 2 h are shown. Actin cytoskeleton is visualized with Alexa-488 phalloidin. Fluorescence images are maximum intensity projections of Z-sections (8–12 x 0.1 µm).

MAT

View larger version (33K): [in this window] [in a new window]   Figure 3. cdc42[V36M] cells have a reduced mating efficiency and accumulate prezygotes. (A) Spot matings and growth of cdc42 mutants. Serial dilutions of mutants derived from RAY513 with indicated CDC42 or cdc42 gene (as sole copy) were spotted onto YEPD plates and incubated for 2 d. Spot matings with indicated strains are shown. Matings were carried out with the enfeebled tester JY426. (B) The expression level of the Cdc42[V36M]p is similar to that of wild type in budding and mating cells. Strains were derived from RAY1772 (MATa) and RAY513 (MAT) with indicated CDC42 or cdc42 gene (as sole copy behind its endogenous promoter on a CEN plasmid). Cell extracts of budding and mating cells were analyzed by SDS-PAGE, followed by immunoblotting and probing with anti-Cdc42p polyclonal sera. Similar results were observed in three independent experiments. (C) The cdc42[V36M] mating defect is independent of the mating type. Strains in which CDC42 or cdc42[V36M] is the sole copy behind its endogenous promoter on a CEN plasmid (derived from MATa strain RAY1772 or MAT strain RAY513) were used for quantitative matings with a wild-type tester. Values shown are the means of five or six independent experiments with SD indicated and mating efficiencies for MATa and MAT CDC42 strains (1.4 and 3.0%, respectively) set to 100%. (D) cdc42[V36M] mating mixtures accumulate prezygotes. Strains with indicated CDC42 or cdc42 as sole copy behind its endogenous promoter on a CEN plasmid derived from RAY1772 (MATa) or RAY513 (MAT) were mated with a GFP-Bud1 expressing strain (RAY1907 or RAY1487). The percentage of prezygotes formed after 4 h was determined as the number of prezygotes (fluorescence in only one cell) divided by the number of mating pairs (prezygotes and zygotes), with values representing the means of 5 to 10 determinations (n = 200–300 mating pairs) from four to eight independent matings. Error bars, SD.

View larger version (46K): [in this window] [in a new window]   Figure 4. Cdc42p and Cdc24p are required for correct localization of the cell fusion protein Fus1. (A) GFP-Cdc42[V36M] localizes to the bud and shmoo tips. Indicated strains (RAY1830, RAY1951, and RAY1833), which are MATa cdc24 cdc42 cells carrying a plasmid copy of CDC24 and GFP-Cdc42 or CDC24 and GFP-Cdc42[V36M] or cdc24-m6 and GFP-Cdc42, each behind their respective endogenous promoter on a CEN plasmid, were either grown in the absence (left panels) or presence (right panels) of 12 µM -factor for 2 h, and fluorescence and DIC images were taken. (B) cdc24-m6 and cdc42[V36M] mating mixtures accumulate similar amounts of prezygotes. Indicated strains (RAY1793, RAY1801, and RAY1952) were mated with RAY1487 (GFP-Bud1) and analyzed as in 3D. Values are the means of four independent matings (n = 200 mating pairs). Error bars, SD. (C) Expression levels of Cdc42p in CDC42/CDC24, cdc42[V36M]/CDC24, and CDC42/cdc24-m6 cells. Extracts of logarithmically growing cells (RAY1793, RAY1801, and RAY1952) were analyzed by immunoblot and probed with anti-Cdc42p polyclonal sera. Similar results were observed in three independent experiments. (D) cdc42[V36M] cells induce Fus1-GFP in the presence of mating pheromone. Extracts of cells from the same experiment as above were analyzed by immunoblot either in the absence or presence of -factor. The lower band is an unglycosylated form of Fus1-GFP. Similar results were observed in three independent experiments. (E) Fus1-GFP is not correctly localized in cdc24-m6 and cdc42[V36M] shmoos. Indicated strains (RAY1793, RAY1801, and RAY1952) carrying a Fus1-GFP plasmid were incubated with 12 µM -factor for 2 h, and fluorescence images were taken. The mean percentage of shmoos with an observable fluorescence signal at the tip of the mating projection was determined from two independent experiments (n = 200). Bars indicate values.

View larger version (61K): [in this window] [in a new window]   Figure 5. The septin cytoskeleton is unaffected in cdc42[V36M] budding and shmooing cells. Indicated strains (RAY1918 and RAY1920) carrying a plasmid copy of Cdc3-GFP behind its endogenous promoter on a CEN plasmid were either grown in the absence (left) or presence (right) of 12 µM -factor for 2 h, and fluorescence and DIC images were taken.

View larger version (24K): [in this window] [in a new window]   Figure 6. Cdc42[V36M]p can bind Cdc24p in vitro. (A) In vitro–translated [35S]Cdc24p was incubated with resin-immobilized MBP, MBPCdc42, or MBPCdc42[V36M]. Where indicated, MBP fusions were loaded with GTPS before binding. Binding reactions were analyzed by SDS-PAGE followed by autoradiography. Standard indicates the percentage of [35S]Cdc24p used in the binding reaction. The two different panels are from two independent experiments. (B) Quantitation of Cdc42p–Cdc24p in vitro bindings. A phosphoimager was used for quantitation. Values are the mean of four independent binding experiments. Error bars, SD. Binding of [35S]Cdc24p to Cdc42pGTPS (6.8% of input [35S]Cdc24p) was set to 100%.

View larger version (49K): [in this window] [in a new window]   Figure 7. Overexpression of CDC24 but not cdc24-m6 partially suppresses fusion defect in cdc42[V36M] matings. (A) Overexpression of CDC24 suppresses mating defect of cdc42[V36M] cells. Strains in which CDC42 or cdc42[V36M] is the sole copy behind its endogenous promoter on a CEN plasmid (derived from RAY1918 or RAY1920) and indicated CDC24 is overexpressed were analyzed for mating efficiency and prezygote formation as described in Figure 3, C and D. Values represent the means of two independent matings, with bars indicating actual values. Matings were carried out with the enfeebled tester JY429. (B) Overexpression of CDC24 suppresses the fusion defect of cdc42[V36M] cells during mating. Values represent the means of two independent matings (n = 200–300 mating pairs), with bars indicating actual values. (C) Overexpression of CDC24 and cdc24-m6 does not affect growth of cdc42[V36M] cells. Cells were spotted on –Ade plates as described in Figure 3A. (D) Overexpression of CDC24 or cdc24-m6 does not affect the morphology of cdc42[V36M] cells. DIC images of indicated cells used for above matings grown in –Ade-containing media. (E) Cdc42[V36M]pGTPS binds the Ste20p CRIB domain similar to wild-type Cdc42p. [35S]Cdc42p loaded with GTPS was incubated with GSTCRIB immobilized on amylose resin and bound radioactivity was analyzed by SDS-PAGE followed by autoradiography. Input [35S]Cdc42p reticulocyte lysate (5%) is shown. Quantitation by phosphorimager revealed no difference between Cdc42p and Cdc42[V36M]p GSTCRIB binding, whereas binding of Cdc42[T35A]p was dramatically reduced (unpublished data).

View larger version (27K): [in this window] [in a new window]   Figure 8. Overexpression of a fast-cycling Cdc42p mutant partially suppresses the cdc24-m6 cell fusion defect. (A) Expression levels of different Cdc42p versions in CDC24 and cdc24-m6 cells. Extracts of logarithmically growing cells (RAY1042, and RAY1685) carrying pYes plasmid with indicated Cdc42p grown in galactose/fructose containing media were analyzed by immunoblot and probed with anti-HA mAb or anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mAb. Similar results were observed in three independent experiments. (B) Overexpression of fast-cycling Cdc42p partially suppresses the cdc24-m6 cell fusion defect. Cells were grown as described above, mated on galactose/fructose containing media with RAY1487 (GFP-Bud1), and analyzed as in 3D. Values are the means of two independent matings (n = 400 mating pairs). Error bars, SD. (C) Morphology of CDC24 and cdc24-m6 budding cells is unaffected by Cdc42p or Cdc42[C18A]p overexpression. DIC Images of indicated cells used for above matings grown in galactose/fructose containing media.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Roles of Cdc42p in Mating
Different studies have examined the role of the small GTPase Cdc42p and its exchange factor Cdc24p in yeast mating and suggest that these proteins function in different steps of this process. Cdc24p interacts with G and Far1p, and this complex is required for chemotropic growth toward a mating partner (Valtz et al., 1995; Butty et al., 1998; Nern and Arkowitz et al., 1998, 1999). More recently, cdc24 mutants that are defective in cell fusion during mating have been isolated, indicating that this exchange factor functions also in a later step of the mating process (Barale et al., 2004). Cdc42p has been shown to be required for pheromone signaling and Ste20p localization (Moskow et al., 2000). Our work provides evidence for a role of Cdc42p in the cell fusion process. Together, these different analyses of CDC24 and CDC42 mutants indicate that this GTPase module is important for chemotropism (cdc24-m1), pheromone signaling (cdc42-md1), and cell fusion (cdc24-m6 and cdc42[V36M]). The functions of Cdc24p and Cdc42p in these processes are likely to be distinct events as cdc24-m6 and cdc42[V36M] are not defective in pheromone signaling nor chemotropism. Furthermore, Cdc42p interacts with different proteins during pheromone signaling and cell fusion, and these processes are likely to be temporally distinct.

Cdc42p Valine 36 Mutations
Three cdc42 mutants in which valine 36 is mutated (V36A, V36T, V36G) have been previously characterized. Moskow et al., 2000 isolated a cdc42-md1 in which residues Val36, Lys149, and Leu177 were altered to Ala, Gln, and Ser, respectively. This mutant is pheromone resistant and defective in FUS1 induction. In a mutant that contained only the Val36Ala substitution, both the pheromone resistance and the gene induction defect were reduced compared with cdc42-md1. The Cdc42p[V36A] mutant also had a mild defect in binding the Ste20p CRIB domain, in contrast to Cdc42p[V36M], which binds the CRIB domain similar to the wild type.

In cdc42[V36T], cdc42[V36A], and cdc42[V36G] mutants, cells are elongated with wide and misshaped mother bud necks and defects in septin organization, yet the actin cytoskeleton was correctly polarized (Galdfelter et al., 2001, 2002; Caviston et al., 2003). Overexpression of Cla4p suppressed the septin organization defect in cdc42[V36T] and cdc42[V36A] cells (Gladfelter et al., 2001, 2002). In vitro, Cdc42[V36T]p has reduced intrinsic GTPase activity when compared with wild-type Cdc42p, and overexpression of Rga1p suppressed the septin organization defect in this cdc42 mutant (Gladfelter et al., 2002). Both Cdc42[V36T]p and Cdc42[V36A]p mutants were shown to be impaired in binding the Cla4p, Ste20p, Gic1p, and Gic2p CRIB domains (Gladfelter et al., 2001).

We consider it unlikely that the cell fusion defect in cdc42[V36M] mutants is due to an indirect effect on septin organization for the following reasons. First, both cdc42[V36T] and cdc42[V36A] cells have a more pronounced morphology defect than cdc42[V36M] cells, yet a weaker mating defect. Second, we did not observe any alterations in the septin cytoskeleton in cdc42[V36M] cells either during budding or shmooing. Third, overexpression of Rga1p, instead of suppressing the fusion defect in cdc42[V36M] cells, increased the fusion defect in this mutant. In summary, our results strongly suggest that the fusion defect in cdc42[V36M] cells is not the result of perturbations of the septin cytoskeleton nor pheromone signaling, indicating that alterations in residue 36 in Switch I affect interactions with different effectors, depending on the amino acid substitution.

The Switch I together with the Switch II regions undergo nucleotide-dependent conformational changes. Release of the -phosphate upon hydrolysis of GTP allows the Switch regions to relax into the GDP-specific conformation. The Switch I region overlaps with an effector-binding region that includes the adjacent 2 strand and binds, for example, CRIB domain–containing effectors. Targeted molecular dynamics computational techniques have identified the Ras residue equivalent to valine 36 in Cdc42 as a critical hinge in the movements of the Switch I region (Diaz et al., 1997). Replacement of this residue in Ras (Ile 36) with an amino acid with a small side chain, such as glycine, increases the flexibility of this loop and hence accelerates the conformational changes between inactive and active states (Kuppens et al., 1999, 2003). Conversely, it is likely that replacement of valine 36 with either the bulky side chains of methionine or tryptophan residues decreases the flexibility of the Switch I loop and results in the conformational changes between inactive and active states becoming rate limiting in Cdc42, and we speculate that this conformational change is also rate limiting in vivo, in particular during cell fusion. Alternatively, an association of Cdc42[V36M]p with Cdc24p or another protein that stabilizes the interaction with this exchange factor may be reduced in vivo. This affect could be due to alterations in the dynamic properties of the Switch I region as has been suggested for the case of Ras (Spoerner et al., 2004). In either case, overexpression of Cdc24p would be expected to suppress the cell fusion defect as observed.

GDP–GTP Cycling of Cdc42p
Several studies have revealed that Cdc42p GTP hydrolysis is important for the function of this critical G-protein. In budding yeast, using mutants locked in the GTP-bound state (Cdc42[Q61L]p) or deletion of GAPs, it has been suggested that GTP hydrolysis is necessary for septin ring assembly (Gladfelter et al., 2002; Caviston et al., 2003) and establishment of cell polarity (Irazoqui et al., 2003). The inability of this GTP-locked Cdc42p mutant to function in septin ring assembly and cell polarity establishment has led to the suggestion that GDP–GTP cycling is important in these two processes. In mammalian cells a fast cycling version of Cdc42p, which undergoes a rapid GDP–GTP exchange without affecting GTPase activity induces cellular transformation (Lin et al., 1997, 1999). The replacement of alanine for cysteine in the Cdc42[C18A]p fast cycling mutant results in the loss of a hydrogen bond to the nucleotide -phosphate, a concomitant reduction in GDP affinity and an 20-fold increase in the GDP–GTP exchange rate in vitro (Rossman et al., 2002). The increased intrinsic exchange rate of this mutant is further enhanced 10-fold by the presence of the exchange factor Dbs (Rossman et al., 2002). Our results demonstrate that the Cdc42[C18A]p fast cycling mutant can partially suppress the fusion defect of the cdc24-m6 cells. Neither overexpression of Cdc42p, nor Cdc42[Q61L]p were sufficient to suppress the cdc24-m6 fusion defect, indicating that the suppression by the fast cycling Cdc42p mutant was specific. Interestingly, overexpression of the Cdc42[C18A]p fast cycling mutant did not affect the fusion efficiency of wild-type cells, suggesting that GDP–GTP cycling is not limiting in this context.

Conversely, it is likely that in cdc42[V36M] mutants GDP–GTP exchange is limiting, because overexpression of the exchange factor Cdc24p partially suppresses the fusion defect in these cells. In contrast, overexpression of Cdc24-m6p had no effect on this fusion defect, suggesting that Cdc24-m6p has an altered exchange factor activity, consistent with structure function studies of analogous mutations in the Trio and Tiam1 exchange factors (Liu et al., 1998; Worthylake et al., 2000). It is unlikely that Cdc42[V36M]p GAP interactions are limiting during cell fusion because overexpression of the Rga1p GAP, which functions in yeast mating, did not decrease the fusion defect but rather increased the number of prezygotes that accumulate during mating. Furthermore, two-hybrid interactions between Cdc42[Q61L]p and Rga1p are not affected by the presence of the V36M mutation (S. Barale and R. Arkowitz, unpublished observations), suggesting that Cdc42[V36M]p interacts normally with this GAP. Together, our results strongly suggest that cycling of Cdc42p between GDP and GTP bound forms is important for efficient fusion, perhaps playing a role in correctly localizing and/or activating the fusion machinery.

Cdc42p and Fus1p
Recently, interactions between proteins required for cell fusion and components of the pheromone response pathway and cell polarity proteins were examined in a two-hybrid matrix (Nelson et al., 2004). A number of positive interactions were identified; among them GTP-locked Cdc42p was shown to interact with both Fus1p and Fus2p and Cdc24p with Fus2p (Nelson et al., 2004). These two-hybrid interactions together with the cdc24 and cdc42 mutants specifically defective in Fus1p localization that we have isolated suggest that this GTPase module may directly interact with the fusion machinery. We suggest that this specific interaction is necessary for restricting the localization of the fusion machinery, which is required for efficient fusion. We have attempted to coimmunoprecipitate Fus1p using epitope-tagged Cdc42p and conversely Cdc42p using a Fus1GFP fusion in cells treated with -factor; however, we were unable to detect a stable coimmunoprecipitation (S. Barale and R. Arkowitz, unpublished observations). Hence, although Cdc42p GTP appears to be important for binding Fus1p and Fus2p as measured by two-hybrid assays (Nelson et al., 2004), we favor the notion that Cdc42p GDP–GTP cycling is necessary for assembly and maintenance of the fusion machinery to the site of cell contact and fusion. We propose that assembly of the protein complexes involved in cell fusion requires Cdc42p GTP binding and that GDP–GTP cycling mediated by GEFs and GAPs is critical for cell fusion. The fusion of other cell types as such as myoblast fusion requires the G-protein Rac and the guanine nucleotide exchange factor DOCK180 family member Myoblast city in Drosophila (Nolan et al., 1998; Hakeda-Suzuki et al., 2002), suggesting that the regulation of G-protein GDP–GTP cycling is conserved in range of cell fusion processes.

	ACKNOWLEDGMENTS

 
We thank M. Bassilana for constructive criticism, C. Matthews for aid with microscopy, S. Clement for technical assistance, and E. Bi and M. Snyder for plasmids. This work was supported by the Centre National de la Recherche Scientifique, Fondation pour la Recherche Médicale-BNP-Paribas, and La Ligue Contre le Cancer. S.B. was supported by Fellowships from La Ligue Contre le Cancer and Association pour la Recherche sur le Cancer.

	Footnotes

 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E05-11-1040) on March 29, 2006.

These authors contributed equally to this work.

Address correspondence to: Robert A. Arkowitz ( arkowitz{at}unice.fr)

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol 215, 403–410.[CrossRef][Medline]

Arkowitz, R. A. and Lowe, N. (1997). A small conserved domain in the yeast Spa2p is necessary and sufficient for its polarized localization. J. Cell Biol 138, 17–36.[Abstract/Free Full Text]

Baba, M., Baba, N., Ohsumi, Y., Kanaya, K., Osumi, M. (1989). Three-dimensional analysis of morphogenesis induced by mating pheromone alpha factor in Saccharomyces cerevisiae. J. Cell Sci 94, 207–216.[Abstract/Free Full Text]

Barale, S., McCusker, D., Arkowitz, R. A. (2004). The exchange factor Cdc24 is required for cell fusion during yeast mating. Eukaryot. Cell 3, 1049–1061.[Abstract/Free Full Text]

Bose, I. I., Irazoqui, J. E., Moskow, J. J., Bardes, E. S., Zyla, T. R., Lew, D. J. (2001). Assembly of scaffold-mediated complexes containing Cdc42p, the exchange factor Cdc24p, and the effector Cla4p required for cell cycle regulated phosphorylation of Cdc24p. J. Biol. Chem 11, 7176–7186.

Brizzio, V., Gammie, A. E., Nijbroek, G., Michaelis, S., Rose, M. D. (1996). Cell fusion during yeast mating requires high levels of a-factor mating pheromone. J. Cell Biol 135, 1727–1739.[Abstract/Free Full Text]

Brizzio, V., Gammie, A. E., Rose, M. D. (1998). Rvs161p interacts with Fus2p to promote cell fusion in Saccharomyces cerevisiae. J. Cell Biol 141, 567–584.[Abstract/Free Full Text]

Butty, A. C., Pryciak, P. M., Huang, L. S., Herskowitz, I., Peter, M. (1998). The role of Far1p in linking the heterotrimeric G protein to polarity establishment proteins during yeast mating. Science 282, 1511–1516.[Abstract/