![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 17, Issue 7, 2942-2951, July 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*John Innes Centre, Colney, Norwich NR4 7UH, United Kingdom; CIIT Centers for Health Research, Research Triangle Park, NC 27709-2137; and Institute of Biology, Leiden University, 2333 AL Leiden, The Netherlands
Submitted December 21, 2005;
Revised April 11, 2006;
Accepted April 12, 2006
Monitoring Editor: A. Gregory Matera
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and designated nucleolar accessory bodies (see Gall, 2000, 2003; Ogg and Lamond, 2002; Matera, 2003; Shaw and Brown, 2004; Cioce and Lamond, 2005, for recent reviews). They were subsequently imaged by electron microscopy by Monneron and Bernhard (1969), who called them coiled bodies because they appeared to contain many coiled threads, but the name Cajal body has now been agreed in honor of their original discoverer. They have been identified in many but not all vertebrate cell types, and in all cell types so far examined in several species of monocot and dicot plants (Lafontaine, 1965; Beven et al., 1995; Acevedo et al., 2002). CBs have also been identified in Xenopus oocytes (Gall et al., 1995). More recently an apparently similar nuclear body has been demonstrated in yeast cells (Verheggen et al., 2001), and recent data show that analogous nuclear bodies are also present in Drosophila (J. G. Gall, personal communication). CBs have been shown to be dynamic structures, moving, fusing together, and splitting apart within the nucleus and occasionally within the nucleolus (Boudonck et al., 1999; Platani et al., 2000).
CBs contain a very wide variety of different proteins and small RNAs, both small nuclear (snRNAs) and small nucleolar (snoRNAs), along with their associated protein complexes, as well as telomerase (Zhu et al., 2004; Cioce and Lamond, 2005). They also contain scaRNAs–small RNAs that are specifically targeted to CBs—and are involved in directing modifications of snRNAs and snoRNAs (Jady and Kiss, 2001; Darzacq et al., 2002). Many of the proteins, such as fibrillarin and dyskerin/cbf5p, are shared with the nucleolus, in line with Ramon y Cajal’s original description of CBs as nucleolar accessory bodies. The various constituent proteins and RNA species dynamically move in and out of the CBs, showing that these factors transit through rather than being stably stored in this compartment (Sleeman et al., 2003; Dundr et al., 2004). To date, the biochemical data, although still far from complete, suggest that CBs have a range of functions centered around the maturation of RNA species and the assembly of transcription-related complexes. For example, CBs have been shown to have a role in the recycling/assembly of the U4/U6/U5 tri-snRNP, because RNAi knockdown of specific factors necessary for tri-snRNP assembly causes U4/U6 di-snRNP to accumulate in CBs (Schaffert et al., 2004). Fluorescence resonant energy transfer (FRET) microscopy has further shown the assembly of the U4/U6 di-snRNP occurring in CBs (Stanek and Neugebauer, 2004). A role for CBs in the maturation of U2 snRNP has also been shown (Nesic et al., 2004).
Vertebrate CBs are highly enriched in coilin, a protein of unknown function that is considered diagnostic of this type of nuclear body (Andrade et al., 1991; Raska et al., 1991). Xenopus has a closely related homologue to coilin, which again is localized in Xenopus CBs (Tuma et al., 1993). A mouse insertional mutant in the coilin gene had markedly altered CBs, termed residual CBs, which failed to recruit CB constituent proteins such as SMN (Tucker et al., 2001). The mutant mice had a reduced litter size, but were otherwise apparently normal. A distant potential homologue to coilin in the Arabidopsis genome has been noted (Tucker and Matera, 2005), but the degree of similarity is very low (E = 0.05), and neither the gene nor its product have been previously characterized.
Here we describe results from a fluorescence microscopy–based mutant screen of an Arabidopsis line engineered to express GFP in CBs and show the CB phenotypes of the six mutants identified. We further demonstrate that three no cajal bodies (ncb) mutants have mutations in At1g13030, which we identify as a distant homologue of the vertebrate coilin gene. ncb-1 lacks any detectable CBs, whereas ncb-2 and ncb-3 have smaller CBs than wild type. Stable expression of a fusion of At1g13030 with red fluorescent protein in the ncb-1 background restores nuclear bodies in all cell types, verifying that mutations in the At1g13030 gene are responsible for the ncb-1 phenotype. Furthermore these CBs recruit the spliceosomal U2B''-GFP, suggesting that the restored bodies are functional. Interestingly the CBs induced in this way are much larger than native CBs.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
EMS Mutagenesis
Previously the full-length (693 base pairs) potato U2B' cDNA fused in frame to the 5' end of sGFPS65T under the control of the 35S promoter was transformed into Arabidopsis, Colombia ecotype, to generate the line used in this study (line 1214; Boudonck et al., 1999). Seeds homozygous for the U2B':GFP construct were subjected to ethyl methanesulfonate (EMS) mutagenesis. The seeds were incubated in 30 ml 0.1% Tween-20 for 48 h at 4°C, followed by 8-h incubation in 20 ml 0.5% (wt/vol) EMS. The seeds were washed three times in water and then transferred into 2 l of water and stirred overnight. The mutagenized seed (M1) was sown on soil and grown in the glasshouse, and the M2 seed was harvested. Four separate batches of mutagenized U2B':GFP seed were collected.
Screening for Cajal Bodies
The EMS M2 population of seed generated from the U2B':GFP Arabidopsis line (1214) was used in the screen. To obtain the longer roots and hypocotyls needed for screening, seeds were sown in a row across Petri-dishes containing MS phytagel solid media. After a 48-h stratification at 4°C, they were germinated in a standard growth cabinet (25°C, constant light) with the plates inclined at a 90° angle, allowing roots to grow along the surface of the medium. After 36 h, they were covered with a black plastic bag, which was removed 48 h later. Seedlings were grown for a further 5 d in the light before being screened. Eight-day-old seedlings in a row across a Petri dish were covered with 0.5 ml MS liquid media (3% [wt/vol] sucrose and 4.4 g/l Murashige and Skoog medium with vitamins, pH 5.8; Imperial Laboratories, Andover, United Kingdom) and a coverslip. The hypocotyl cells of the seedlings were then examined for abnormalities in the GFP-labeled CBs using a Nikon Eclipse E600 epifluorescence microscope with a 100x/1.4 Nikon Plan Apo objective (Nikon UK, Kingston upon Thames, United Kingdom). It was important not to cover leaves with immersion oil, which kills the seedlings, and it was important to use minimal exposure to the microscope illumination. Those with abnormal CBs were moved to fresh plates and returned to the growth room until large enough to be transplanted on to soil in the greenhouse. Putative mutants were grown to maturity, and the M3 seedlings rescreened to ensure the line was stable and homozygous.
Mapping
A segregating F2 population was made by crossing a plant homozygous for the ncb-1 mutation in ecotype Columbia background (Col) and a wild-type ecotype Landsberg erecta (Ler) plant. Mapping was then carried out according to the procedure described by Bell and Ecker (1994).
Primers Used
Primers used were as follows: At1g13030: F1: GTGAGGGTTCGTCTGGTGTT; R3: AGCCTTCTTCTCTGGCACAA: F9: ATGGGGCACAGAGAAGTCAGG; R10: TCAATGAGGCGGTATGC; R12: TGGTCAGGCTCGGGCAGTG and F-At1g13030: TGCTTTTGTGGATTGCAGGTC; R-At1g13030: GAAACTGTGAGGAGCCTTGC.
Sequencing Primers
Sequencing primers used were as follows: Coilin-1f: CTGTGCGTTTACAGCATCAAA; Coilin-1r: GAAGATGGATCCCTGGAGGT; Coilin-2f: TTACCTTTTGCAGGGGTTTG; Coilin-2r: TTACTACCCCCAGCAGGTTG; Coilin-3f: TGAGGCGGTATGCAATAACA; Coilin-3r: AGATCACCAAGCAACCAAGG; Coilin-4f: GAAACTGTGAGGAGCCTTGC; Coilin-4r: TGCTTTTGTGATTGCAGGTC; Coilin-5f: TGGCACAGATCGTTATGCTC; Coilin-5r: TGGAGATTGTTGGGGAAGAC; Coilin-6f: AGCCTTCTTCTCTGGCACAA; Coilin-6r: GTGAGGGTTCGTCTGGTGTT; Coilin-7f: AGAGAGAGGCCATGAGGACA; and Coilin-7r: AGAAGACGAAGGCTCCAACA.
cDNA Preparation and Expression Analysis
RNA from flower buds of the parental 1214 line and ncb-1 and ncb-2 plants was prepared using the TRI method. Briefly, tissue was ground in liquid nitrogen and then TRI reagent (Sigma, Poole, Dorset, United Kingdom) was added; then the mixture was vortexed and allowed to extract for 10 min. The sample was then extracted with chloroform, the aqueous phase was collected, and RNA was precipitated with isopropanol, washed in 70% ethanol, and resuspended in DEPC (diethyl pyrocarbonate)-containing water. Reverse transcription was carried out using Abgene Reverse-IT First Strand Synthesis Kit (Abgene, Epsom, United Kingdom) to generate cDNAs of each sample. Then standard Taq PCR was performed using coilin primers F9 and R10 and F9 and R12 spanning the mutation sites. The PCR products were excised from the gel and then cloned using the Topo II cloning system (Invitrogen, Paisley, United Kingdom). DNA from single colonies was sequenced using standard procedures. Primers for purification of full-length At1g13030 and ligation into Gateway entry vector were designed and used as described by Koroleva et al. (2005). The mRFP Gateway destination vector was a gift from John Brown and Sang Hyon Kim (Scottish Crop Research Institute, Dundee, Scotland).
T-DNA Insertion Line Analysis
Line 233HO2 was obtained from the GABI/kat collection (http://www.gabi-kat.de/). DNA was prepared from approximately 50 individual plants of the line and screened for homozygous insertion by PCR using T-DNA left border and forward and reverse primers specific for gene At1g13030 (F-At13030 and R-At13030). A plant homozygous for the insertion was selected, and seed from this plant was collected. cDNA was prepared from the homozygous line in the same manner as described above for the parental and mutant lines and was analyzed by PCR using a primer pair (F1 and R3) before the T-DNA insertion and a primer pair (F9 and R12) after the insertion.
Microscopy and Image Processing
Immunofluorescence labeling was carried out using 4G3 antibody against U2B'' or 72B9 antibody against fibrillarin as described by Boudonck et al. (1999). Samples were imaged with a Nikon Eclipse 600 epifluorescence microscope equipped with a Hamamatsu ORCA-ER cooled CCD camera (Bridgewater, NJ) and a Prior Proscan x,y,z stage using Metamorph software (Universal Imaging, West Chester, PA) and were processed using ImageJ, a public domain image processing program written by Wayne Rasband and obtainable from http://rsb.info.nih.gov/ij/ and Photoshop7 (Adobe, San Jose, CA). Image deconvolution of 3D z series was carried out using Autodeblur (Autoquant Imaging, Troy, NY). Confocal microscopy was carried out using a Leica SP confocal microscope (Leica Microsystems UK, Milton Keynes, United Kingdom).
Section Preparation and Transmission Electron Microscopy
Three-day-old seedlings were fixed overnight in a 2.5% glutaraldehyde in 0.05 M cacodylate buffer, pH 7.2. Samples were washed three times in 0.05 M sodium cacodylate for 15 min and postfixed in 1% osmium tetroxide for 1 h followed by three 15-min washes in 0.05 M sodium cacodylate. Samples were dehydrated for 1 h in each of the serial ethanol dilutions: 30, 50, 70, 90, and 100%. Samples were then infiltrated for 1 h with LR white resin (Agar Scientific, Stansted, United Kingdom) resin:ethanol 1:1, 2:1, 3:1, 100% resin, and finally 100% resin overnight. Samples were then polymerized in fresh resin at 60°C for 16 h. sections of 100 nm were made on an ultramicrotome (Reichert Ultracut E, Leica Microsystems UK) using a 45° glass knife. Samples were picked up with carbon-coated 200-mesh hexagon copper/palladium grids (Agar Scientific), air dried, and stained with 2% aqueous uranyl acetate for 1 h and 1% lead citrate for 30 s. TEM images were obtained using a JEOL 1200 transmission electron microscope (JEOL UK, Welwyn Garden City, United Kingdom). TEM images were recorded using a Deben AMT 1.3K digital camera system and subsequently processed for publication using Adobe Photoshop7 (Adobe, San Jose, CA).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).Therefore, it was deemed a good marker line in which to generate, identify, and study living plants with mutated CBs. CBs in Arabidopsis are spherical and often found in close association with the nucleolus. In the hypocotyl cells, the cell type used in the screen, the nuclei are large and usually contain a single CB 
1 µm in diameter. Two batches of seed were treated with EMS and then grown to maturity. The resulting M2 seed was then screened for abnormal CBs by epifluorescence microscopy of the seedling hypocotyl cells. M2 families were examined from the first series and the second series (n = 725 and 510, respectively), a total of 1235 separate lines. From these, six separate CB mutants were identified, a frequency of 0.5%. These included mutants with smaller or no visible CBs, multiple CBs, and cap-shaped CBs. In this article we characterize two distinctive CB phenotypes. The first mutant has no visible CBs in any cell type examined (Figure 1B); the second has a very similar phenotype, but often shows small CBs (Figure 1C). These mutants were later shown to be allelic to each other and were named no cajal body 1 (ncb-1), and no cajal body 2 (ncb-2). Both the mutants segregate in 3:1 ratio, indicating that they are caused by recessive loss-of-function mutations at a single allele. These two mutant lines were back-crossed to the parental 1214 line three times before further analysis and mapping of the mutations. Neither of these lines showed any significant growth defects when compared with the parental line.
|
|
). In fact, of the 38 wild-type cells, 10 (26%) contained a clearly identifiable CB (e.g., Figure 4A). Of the 39 ncb-1 cells, none contained a clearly identifiable CB (e.g., Figure 4B). If we take 26% as the probability of visualizing a CB in a background that contains CBs, that is a probability of 74% of missing CBs when they are present. This means that the probability of missing CBs in 39 ncb-1 sections assuming the null hypothesis (that they are present) is 0.7439 or 7.9 x 10–6—a very small probability. We therefore conclude that ncb-1 lacks ultrastructurally identifiable CBs by the criterion of electron microscopy as well as by GFP-U2B'' labeling.
|
|
Identification of the NCB Gene
The NCB gene was isolated using a map-based cloning strategy. A segregating F2 population was made by crossing a plant homozygous for the ncb-1 mutation (in ecotype Columbia background; Col) and a wild-type ecotype Ler (Landsberg erecta) plant. Plants from this population were phenotyped by fluorescence microscopy and genotyped by PCR using characterized markers (Bell and Ecker, 1994). The mutation was initially mapped to the top of chromosome 1 between the SSLP (single sequence length polymorphism) markers nga59 and nga392 (Bell and Ecker, 1994), using a population of 100 chromosomes. The markers nga126 and AthCHIB on chromosome 3 also gave a low recombination frequency, indicating that this region may contain the U2B'':GFP transgene. Analysis of a further 560 chromosomes identified a single recombination event between the SSLP markers F3F19–935 and F3F19–941 on chromosome 1, but no recombination between F3F19–935 and ncb-1. On the other side of the mutation, 10 recombination events occurred between T28P6 and ncb-1. The gene At1g13030, which has some similarity to the human coilin gene (Figure 5; Tucker and Matera, 2005), is located in the interval between T28P6 and F3F19–935. We therefore sequenced the genomic region containing At1g13030 from the ncb-1 background. When compared with the wild-type sequence, a single base change from G to A was found at the 3' splice site at the beginning of exon 12 (Figure 6).
|
|
Finally, we sequenced At1g3030 in the other four mutants identified in the screen. One of them, which we then named ncb-3, is another allele and contains a single base change from G to A at position 320. This is predicted to change glutamate E106 to lysine. In line A3572 (Figure 2C), only primer pairs coilin-2r/f and coilin-3r/f produced a PCR product; the other primer pairs used for sequencing the gene in all the other mutants and in the wild type failed to amplify PCR products. This suggests a complex rearrangement or deletion in the gene. Sequence analysis showed that At1g13030 was unaffected in ccb and pcb. It is therefore probable that these mutant phenotypes are caused by other loci.
Analysis of T-DNA Insertional Mutant
Because At1g13030 was identified as the gene responsible for ncb-1, ncb-2, and ncb-3, we searched publicly available collections for T-DNA insertions into this gene. Line 233H02 from the GABI-Kat collection was annotated as having a T-DNA insertion into exon 7 of At1g13030. We obtained this line and verified the insertion site by PCR analysis, using primers from each side of the insertion site (to determine the direction of the insertion) and from the left border of the T-DNA sequence. Plants from this line were then screened by PCR to identify plants homozygous for the insertion, and seed was collected from a homozygous plant for further analysis.
We carried out immunofluorescence analysis of CBs in seedlings homozygous for the insertion using 4G3 antibody, which is specific for U2B'' and which we have previously shown localizes CBs clearly in plants (Beven et al., 1995). No CBs are visible in plants homozygous for the T-DNA insertion, as shown by immunofluorescence labeling in Figure 7. We designated this mutation ncb-4. Therefore we have identified four independent mutations in At1g13030, and each confers a defective CB phenotype. This confirms that At1g13030 is required for CB formation.
|
The predicted consequences of these mis-spliced mRNAs when translated into protein are shown in diagrammatic form in Figure 6C and in detail in Supplementary Figure 2. The wild-type protein has 608 amino acid residues. For ncb-1, the 4 bases lost in the shorter mRNA will introduce a frame shift after residue 493, and a stop codon in this frame will terminate translation after 39 extraneous residues. In the case of the longer, intron-containing mRNA, 37 extra residues will be translated from the intron starting at residue 496. There is no stop codon in the intron in this reading frame, and translation will continue back into the correct frame at the start of exon 12, giving a polypeptide of 645 residues with the correct start and finish, but with extraneous residues internally inserted after residue 493. For ncb-2 the shorter mRNA, missing 6 bases would simply cause 2 residues to be deleted (420 and 421, valine and lysine, respectively, in the wild-type protein). The longer mRNA containing the intron would translate 5 amino acid residues from the intron before encountering a stop codon, generating a truncated protein of 424 residues.
mRNA from the T-DNA insertional mutant ncb-4 was also analyzed in the same way (unpublished data). The insertion was in exon 7 of At1g13030, and the cDNA from the homozygous ncb-4 plants was analyzed by PCR using primer pairs before (F1 and R3) and after (F9 and R12) the insertion site. Both primer pairs gave clear, single PCR products, showing that transcription progressed through the T-DNA insertion. Translation would be predicted to progress through to exon 7 of the gene and to terminate at a stop codon in the T-DNA sequence. Thus, the N terminal sequence from At1g13030 would be predicted to be expressed, but to end prematurely within exon 7 with extraneous residues at the C-terminus.
Overexpression of NCB/At1g13030 Results in the Formation of Larger CBs
Given that plants homozygous for loss-of-function ncb alleles have either smaller or no CBs, we predicted that plants overexpressing NCB/At1g13030 should have larger CBs. Full-length cDNA for At1g13030 was prepared by PCR from a cDNA library, cloned into a Gateway entry vector, and then transferred to a plant binary destination vector designed to express mRFP N-terminal fusions under the 35S promoter (Campbell et al., 2002; Koroleva et al., 2005). We transformed the ncb-1 line stably with this construct. Figure 8 shows different cell types from the resulting line. Large nuclear bodies are visible in all cell types, in which both the NCB/At1g13030:mRFP and the U2B'':GFP are concentrated. This shows that nuclear bodies analogous to CBs were formed in the ncb-1 line when it expressed the NCB/At1g13030 cDNA. Furthermore these structures are likely to be functional because U2B'':GFP is recruited to them. In addition these CBs that form in the 35S:NCB:mRFP transformed plants are larger than those observed in wild-type nuclei. This indicates that levels of NCB/At1g13030 protein may regulate the sizes of CBs that form in nuclei.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Thus pcb may be altered either in the number of CBs nucleated or in the dynamics of their fusion. The flattened CBs seen in the ccb are also interesting and may indicate a change in phosphorylation status of CB components (e.g., Lyon et al., 1997). A similar approach could be used in screens for factors affecting other subcellular or subnuclear structures, provided that the structures can be easily visualized by GFP fusions and can be quickly assessed by limited fluorescence microscopy of easily accessible cell types. In particular, our results show that this type of open-ended screening approach may be very useful in finding factors involved in localization or trafficking of snRNPs. In the present screen it was important to use the large and easily visible hypocotyl cells and to limit exposure of the rest of the seedling to the high-intensity microscope excitation light, which can easily cause irreversible damage to other parts of the plant. Other more subtle phenotypes in CB activity or dynamics may have been produced, but would not have been detected by our simple microscopy screen.
Coilin is known to be concentrated in CBs in a range of vertebrates, including mammals and amphibians, and is now widely regarded as diagnostic for this subnuclear organelle (Gall, 2000, 2003; Ogg and Lamond, 2002; Matera, 2003; Cioce and Lamond, 2005). However, the biochemical activity of coilin is still not fully understood. One major role appears to be directly in the formation of CBs. In support of this, a mouse coilin "knockout" line lacks normal CBs and shows only residual CB-like structures, which fail to recruit SMN protein and which therefore are not fully functional (Tucker et al., 2001). The phenotype of the Arabidopsis ncb-1 mutant indicates that coilin is absolutely required for the formation of CBs because no CBs are seen in any cell type examined in plants homozygous for the ncb-1 mutation. Thus we can identify this Arabidopsis gene as a clear homologue of the vertebrate coilin gene, both on the basis of (limited) structural homology and of functional correspondence in being required for CB formation. Subsequently we refer to the protein encoded as Atcoilin.
Both ncb-1 and ncb-2 have point mutations at splice sites, and each gives rise to two aberrantly spliced mRNAs. In the case of ncb-1, the spliced mRNAs are predicted to produce substantially altered proteins either lacking the correct C-terminal sequences or containing extraneous internal residues. In the case of ncb-2 one of the aberrantly spliced mRNAs is predicted to produce a protein lacking only two amino acid residues, but otherwise correct. This is likely to be the reason that this mutant exhibits some CBs, although smaller than the wild type. The decrease in CB size may be because the deletion of the two residues in the predicted protein impairs its function to some extent. Alternatively, it may be that this variant is fully functional, but that, representing only about half the spliced mRNA, the level of the protein is reduced. In the ncb-3 mutant a single amino acid change from aspartate to lysine was identified. Again, this mutation, which introduces a charge alteration, may impair Atcoilin activity and thus cause the observed reduction in CB size.
The idea that levels of coilin protein determine size of CBs is supported by expressing Atcoilin cDNA in transgenic Arabidopsis plants under the control of the strong constitutive 35S promoter, which would be expected to lead to overexpression of Atcoilin. In these plants the CBs are greatly increased in size in all cells examined. Thus we have obtained the full spectrum of CB size, from complete absence through reduced size to great enlargement, simply by changing Atcoilin or its expression level. In this respect, Atcoilin seems to differ from mammalian coilins. When human coilin was expressed at high levels in HeLa cells, the CBs were disrupted (Shpargel et al., 2003). A similar result was obtained when mouse coilin was overexpressed in mouse cells. However, overexpression of mouse coilin in HeLa cells produced an increased number of CB-like foci, although not of increased size.
We have clearly demonstrated that functional full-length Atcoilin is necessary for formation of CBs in Arabidopsis. Equally, we have found no obvious growth phenotype in the mutant lacking observable CBs, so that CBs cannot be essential for viability. Similarly, not all mammalian cell types or cell lines have observable CBs, and the progeny of the mouse coilin deletion mutant appeared to develop normally with only residual CBs lacking full functionality (although the litter size was reduced; Tucker et al., 2001). However, the conservation of this structure across such as wide phylogenetic range from vertebrates to plants suggests that it must confer significant selective advantages. We can only speculate what these advantages may be as yet, but the most likely suggestion is that of concentrating particular nuclear components, either RNA species or proteins or both, together in a small subnuclear volume so as to increase the probability and thus efficiency of their interactions (see, e.g., Shaw and Brown, 2004; Tucker and Matera, 2005). If this were the case, we would predict that in a genetic background lacking CBs, such as ncb-1, the levels of such interacting factors would be altered. Either the levels of complexes or modifications produced by such interactions (e.g., RNA methylation or pseudouridylation) may be reduced, or alternatively the expression levels of limiting interacting factors may be increased to compensate for the reduction of probability of interaction. This is likely to be a fruitful area for investigation of both ncb-1 and the mouse coilin knockout line. As regards coilin itself neither our studies nor those in other species can formally eliminate the possibility that at least the N terminal part of coilin is essential for viability, because the currently available mutant lines in both Arabidopsis and in mouse (Tucker et al., 2001) may not be true null mutants and may express N terminal coilin fragments.
How far the functional homology between animal and plant coilins extends is an interesting question that requires more research in both kingdoms. The sequence similarity between the animal and plant proteins is restricted to the N and C terminal regions; the region in between, the major part of the protein, shows no significant similarity (Figure 5; Tucker and Matera, 2005). It is clear that the formation of CBs is likely to depend on self-association of coilin and that the N terminal region, in which significant conservation between plants and animals is seen, is important for this (Hebert and Matera, 2000). The known animal coilins have an internal region of repeated arginine and glycine residues, termed the RG domain. Matera and colleagues have shown that the arginine residues are post-translationally modified to symmetrical dimethyl arginines (Hebert et al., 2001, 2002) and that this domain is involved in interaction with the core spliceosomal protein SMN. Furthermore the interaction between the methylated RG domain and SMN is in turn involved in the interaction between CBs and gem nuclear bodies, which contain SMN. Interestingly, Atcoilin does not contain an RG domain, and it is currently not known whether any of the arginine residues in Atcoilin are dimethylated. Similarly, no homologue of SMN has currently been identified in the Arabidopsis genome. Thus both SMN and its cognate binding site may have diverged too far to be recognizable in Arabidopsis.
Nevertheless, the fact, that CBs are found in both plants and animals, contain, as far as is known, similar components, and are dependent on recognizably similar proteins for their formation strongly suggest that they have diverged from a common precursor, rather than being the product of convergent evolution. Such a common precursor structure is likely to have been present in the common ancestors of plants and animals and must represent a very ancient structure in the early eukaryotes. This in turn suggests that, although individual groups of organisms may have lost CBs, they are likely to be present throughout higher eukaryotes in some form. Thus, although the biochemical processes being carried in CBs are still not fully understood, it is likely that CBs are fundamentally important in eukaryotic biology.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). 
These authors contributed equally to this work.
Address correspondence to: Peter J. Shaw ( peter.shaw{at}bbsrc.ac.uk)
Abbreviations used: CB, Cajal body.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Andrade, L. E., Chan, E. K., Raska, I., Peebles, C. L., Roos, G., Tan, E. M. (1991). Human autoantibody to a novel protein of the nuclear coiled body: immunological characterization and cDNA cloning of p80-coilin. J. Exp. Med 173, 1407–1419.
Bell, C. J. and Ecker, J. R. (1994). Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics 19, 137–144.[CrossRef][Medline]
Beven, A. F., Simpson, G. G., Brown, J. W., Shaw, P. J. (1995). The organization of spliceosomal components in the nuclei of higher plants. J. Cell Sci 108, 509–518.[Abstract]
Boudonck, K., Dolan, L., Shaw, P. J. (1999). The movement of coiled bodies visualized in living plant cells by the green fluorescent protein. Mol. Biol. Cell 10, 2297–2307.
Campbell, R. E., Tour, O., Palmer, A. E., Steinbach, P. A., Baird, G. S., Zacharias, D. A., Tsien, R. Y. (2002). A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA 99, 7877–7882.
Cioce, M. and Lamond, A. I. (2005). Cajal bodies: a long history of discovery. Annu. Rev. Cell Dev. Biol 21, 105–131.[CrossRef][Medline]
Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. EMBO J 21, 2746–2756.[CrossRef][Medline]
Dundr, M., Hebert, M. D., Karpova, T. S., Stanek, D., Xu, H., Shpargel, K. B., Meier, U. T., Neugebauer, K. M., Matera, A. G., Misteli, T. (2004). In vivo kinetics of Cajal body components. J. Cell Biol 164, 831–842.
Gall, J. G. (2000). Cajal bodies: the first 100 years. Annu. Rev. Cell Dev. Biol 16, 273–300.[CrossRef][Medline]
Gall, J. G. (2003). The centennial of the Cajal body. Nat. Rev. Mol. Cell. Biol 4, 975–980.[CrossRef][Medline]
Gall, J. G., Tsvetkov, A., Wu, Z., Murphy, C. (1995). Is the sphere organelle/coiled body a universal nuclear component? Dev. Genet 16, 25–35.
Hebert, M. D. and Matera, A. G. (2000). Self-association of coilin reveals a common theme in nuclear body localization. Mol. Biol. Cell 11, 4159–4171.
Hebert, M. D., Shpargel, K. B., Ospina, J. K., Tucker, K. E., Matera, A. G. (2002). Coilin methylation regulates nuclear body formation. Dev. Cell 3, 329–337.[CrossRef][Medline]
Hebert, M. D., Szymczyk, P. W., Shpargel, K. B., Matera, A. G. (2001). Coilin forms the bridge between Cajal bodies and SMN, the spinal muscular atrophy protein. Genes Dev 15, 2720–2729.
Jady, B. E. and Kiss, T. (2001). A small nucleolar guide RNA functions both in 2'-O-ribose methylation and pseudouridylation of the U5 spliceosomal RNA. EMBO J 20, 541–551.[CrossRef][Medline]
Koroleva, O. A., Tomlinson, M. L., Leader, D., Shaw, P., Doonan, J. H. (2005). High-throughput protein localization in Arabidopsis using Agrobacterium-mediated transient expression of GFP-ORF fusions. Plant J 41, 162–174.[CrossRef][Medline]
Lafontaine, J. G. (1965). A light and electron microscope study of small spherical nuclear bodies in meristematic cells of Allium cepa. J. Cell Biol 26, 1–17.
Lyon, C. E., Bohmann, K., Sleeman, J., Lamond, A. I. (1997). Inhibition of protein dephosphorylation results in the accumulation of splicing snRNPs and coiled bodies within the nucleolus. Exp. Cell Res 230, 84–93.[CrossRef][Medline]
Matera, A. G. (2003). Cajal bodies. Curr. Biol 13, R503.[CrossRef][Medline]
Monneron, A. and Bernhard, W. (1969). Fine structural organization of the interphase nucleus in some mammalian cells. J. Ultrastruct. Res 27, 266–288.[CrossRef][Medline]
Nesic, D., Tanackovic, G., Kramer, A. (2004). A role for Cajal bodies in the final steps of U2 snRNP biogenesis. J. Cell Sci 117, 4423–4433.
Ogg, S. C. and Lamond, A. I. (2002). Cajal bodies and coilin—moving towards function. J. Cell Biol 159, 17–21.
Platani, M., Goldberg, I., Swedlow, J. R., Lamond, A. I. (2000). In vivo analysis of Cajal body movement, separation, and joining in live human cells. J. Cell Biol 151, 1561–1574.
Ramon y Cajal, S. (1903). Un sencillo metodo de coloracion seletiva del reticulo protoplasmatico y sus efectos en los diversos organos nerviosos de vertebrados e invertebrados. Trab. Lab. Invest. Biol. (Madrid) 2, 129–221.
Raska, I., Andrade, L.E.C., Ochs, R. L., Chan, E.K.L., Chang, C. M., Roos, G., Tan, E. M. (1991). Immunological and ultrastructural studies of the nuclear coiled body with autoimmune antibodies. Exp. Cell Res 195, 27–37.[CrossRef][Medline]
Schaffert, N., Hossbach, M., Heintzmann, R., Achsel, T., Luhrmann, R. (2004). RNAi knockdown of hPrp31 leads to an accumulation of U4/U6 di-snRNOs in Cajal bodies. EMBO J 23, 3000–3009.[CrossRef][Medline]
Shaw, P. J. and Brown, J. W. (2004). Plant nuclear bodies. Curr. Opin. Plant Biol 7, 614–620.[CrossRef][Medline]
Shpargel, K. B., Ospina, J. K., Tucker, K. E., Matera, A. G., Hebert, M. D. (2003). Control of Cajal body number is mediated by the coilin C-terminus. J. Cell Sci 116, 303–312.
Sleeman, J. E., Trinkle-Mulcahy, L., Prescott, A. R., Ogg, S. C., Lamond, A. I. (2003). Cajal body proteins SMN and Coilin show differential dynamic behaviour in vivo. J. Cell Sci 116, 2039–2050.
Stanek, D. and Neugebauer, K. M. (2004). Detection of snRNP assembly intermediates in Cajal bodies by fluorescence resonance energy transfer. J. Cell Biol 166, 1015–1025.
Tucker, K. E., Berciano, M. T., Jacobs, E. Y., LePage, D. F., Shpargel, K. B., Rossire, J. J., Chan, E. K., Lafarga, M., Conlon, R. A., Matera, A. G. (2001). Residual Cajal bodies in coilin knockout mice fail to recruit Sm snRNPs and SMN, the spinal muscular atrophy gene product. J. Cell Biol 154, 293–307.
Tucker, K. E. and Matera, A. G. (2005). The Cajal body—a nuclear gathering place. In: Visions of the Nucleus, ed. P. Hemmerich and S. Diekmann. Stevenson Ranch, CA: American Scientific Publishers, 159–171.
Tuma, R. S., Stolk, J. A., Roth, M. B. (1993). Identification and characterization of a sphere organelle protein. J. Cell Biol 122, 767–773.
Verheggen, C., Mouaikel, J., Thiry, M., Blanchard, J. M., Tollervey, D., Bordonne, R., Lafontaine, D. L., Bertrand, E. (2001). Box C/D small nucleolar RNA trafficking involves small nucleolar RNP proteins, nucleolar factors and a novel nuclear domain. EMBO J 20, 5480–5490.[CrossRef][Medline]
Zhu, Y., Tomlinson, R. L., Lukowiak, A. A., Terns, R. M., Terns, M. P. (2004). Telomerase RNA accumulates in Cajal bodies in human cancer cells. Mol. Biol. Cell 15, 81–90.
This article has been cited by other articles:
|
|
 |
|
  Y. Fujioka, M. Utsumi, Y. Ohba, and Y. Watanabe Location of a Possible miRNA Processing Site in SmD3/SmB Nuclear Bodies in Arabidopsis Plant Cell Physiol., September 1, 2007; 48(9): 1243 - 1253. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Morency, M. Sabra, F. Catez, P. Texier, and P. Lomonte A novel cell response triggered by interphase centromere structural instability J. Cell Biol., June 21, 2007; 177(5): 757 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Song, M.-H. Han, J. Lesicka, and N. Fedoroff Arabidopsis primary microRNA processing proteins HYL1 and DCL1 define a nuclear body distinct from the Cajal body PNAS, March 27, 2007; 104(13): 5437 - 5442. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
