![]() |
|
|
Vol. 17, Issue 7, 2986-2995, July 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





*Department of Biochemistry, Christian-Albrechts-Universität, D-24098 Kiel, Germany;
Gesellschaft für Biotechnologische Forschung GmbH, D-38124 Braunschweig, Germany;
Deutsches Krebsforschungszentrum, D-61920 Heidelberg, Germany; and ||Colon Molecular and Cell Biology Laboratory, Ludwig Institute for Cancer Research, Parkville VIC 3050, Australia
Submitted December 13, 2005;
Revised March 27, 2006;
Accepted April 7, 2006
Monitoring Editor: Carl-Henrik Heldin
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
IL-6 has pro- and anti-inflammatory properties and plays a central role in host defense against infection and tissue injuries (Simpson et al., 1997
). The activities of IL-6 are highly pleiotropic, stimulating a wide range of biological activities, including B-cell maturation, hepatocyte regeneration, and neuronal growth (Kishimoto et al., 1995
).
IL-6 binds to the specific IL-6 receptor (IL-6R), and this complex associates with two molecules of the ubiquitously expressed gp130 (Taga and Kishimoto, 1995
; Heinrich et al., 2003
). The formation of a hetero-oligomeric receptor complex containing the gp130 signal transducing receptor leads to intracellular activation of Janus tyrosine kinase (JAK)/Tyk tyrosine kinases as well as the signal transducer and activator of transcription (STAT) family of transcription factors. Furthermore, gp130 activation leads to stimulation of the phosphoinositide 3-kinase and RAS/mitogen-activated protein kinase (MAPK) pathways (Hibi et al., 1996
). Interestingly, cells that do not express a membrane bound IL-6R and that are therefore not responsive to IL-6, can be stimulated by IL-6 binding to a soluble form of the IL-6R, which is produced by limited proteolysis or translation from a differentially spliced mRNA. This process has been named trans-signaling (Rose-John and Heinrich, 1994
).
The extracellular part of gp130 consists of an immunoglobulin (Ig)-like domain followed by a cytokine binding domain and three fibronectin III domains. The binding of the IL-6/IL-6R complex to the Ig-like and cytokine binding domain of gp130 is well understood (Boulanger et al., 2003
). The gp130 dimer is formed by contact of gp130 to the binding sites II and III (Ehlers et al., 1994
), whereas the IL-6R contacts IL-6 via the binding sites I (Boulanger et al., 2003
). The role of the three fibronectin III domains is less clear. Truncation of these domains results in gp130 molecules devoid of signaling capacity (Kurth et al., 2000
). Because all cytokine receptors, which are activated by ligand binding via sites II and III, contain fibronectin III domains, it has been speculated that these domains are needed to position the transmembrane domains of gp130 in proximity (Skiniotis et al., 2005
).
The dimerization domain of Jun transcription factor proteins are
-helical structures characterized by a periodic repeat of leucine every seven amino acids, i.e., every two helical turns, which forms a parallel coiled coil structure (OShea et al., 1989
; Glover and Harrison, 1995
). Such leucine zippers are found in transcription factors, including c-fos and c-jun, which form the adaptor protein-1 transcription complex. Naturally, Fos and Jun zippers form heterodimers, but they also can form stable homodimers albeit with significantly lower stability. The Jun-Fos leucine zipper has previously been used to dimerize scFv antibodies (de Kruif and Logtenberg, 1996
), interferon
receptor
subunit (Patel et al., 1996
) and the receptors for the cytokines granulocytemacrophage colony stimulating factor and growth hormone, which both use receptor binding sites I and II (Patel et al., 1996
; Behncken et al., 2000
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
-mouse-AlexaFluor488 and wheat germ agglutinin-tetramethylrhodamine were from Invitrogen (Karlsruhe, Germany; and anti-phospho-extracellular signal-regulated kinase (ERK)1/2 and anti-ERK were from Cell Signaling Technology (Danvers, MA). All restriction enzymes were obtained from MBI Fermentas (St. Leon-Rot, Germany). Tran35S-label and [3H]thymidine were purchased from Amersham Biosciences (Freiburg, Germany).
Construction and Expression of L-gp130 Expression Plasmids
The standard cloning procedures were performed as described previously (Sambrook et al., 1989
). For the gp130 hybrid receptor constructs, we added the FLAG-sequence (DYKDDDDK) downstream of the signal peptide (nucleotides 166) of the human wild-type gp130. Further downstream, a linker was introduced (for L-gp130, ELCGG and for
cys-L-gp130, ELGGG) followed by a 39-aa fragment of the human c-jun gene (RIARLEEKVKTLKAQNSELASTANMLREQVAQLKQKVMN) (OShea et al., 1989
; Patel et al., 1996
). The transmembrane domain and the cytoplasmatic domain of the wild-type gp130, corresponding to the nucleotides 20683007 was added downstream. For
-gp130, the 39-aa fragment of the human c-jun gene was deleted. For expression studies, L-gp130 and
-gp130transfected cells were cultured for 48 h and metabolically labeled with 50 µCi/ml [35S]methionine/[35S]cysteine (Tran-35S-Label) in methionine/cysteine-free medium for 2 h. The cells were lysed, and after immunoprecipitation, the complexes were isolated with beads coupled to protein A, subjected to SDS-PAGE, and transferred onto polyvinylidene difluoride (PVDF) membranes.
Transfection, Transduction, and Selection of Cells
COS-7 and HepG2 cells were transfected by DEAE-dextran technique as described previously (McMahan et al., 1991
). HeLa cells were transfected by ExGen technique, according to manufacturers instructions (BD Biosciences Clontech, Palo Alto, CA). Ba/F3-, Ba/F3-gp130 cells were transduced retrovirally. The retroviral expression plasmid pMOWS have been described previously (Ketteler et al., 2002
). pMOWS-L-gp130, pMOWS-
cys-L-gp130, and the control vector pMOWS-GFP (5 µg each) were transiently transfected in Phoenix-Eco cells (grown on a 6-well plate) by calcium phosphate precipitation as described previously (Ketteler et al., 2002
) and according to manufacturers instructions (BD Biosciences Clontech). The transfection efficiency was visualized after 24 h by green fluorescent protein (GFP) expression (Axiovert 200 Microscope; Carl Zeiss, Jena, Germany). Transducing supernatants were produced as described previously (Ketteler et al., 2002
). Two hundred fifty microliters of the transducing supernatants was applied to 1 x 105 Ba/F3 cells, mixed and centrifuged at 1800 rpm for 2 h at 37°C. Afterward, cells were grown in standard medium supplemented with 10% WEHI. Pools of Ba/F3 cells expressing the L-gp130 or the
cys-L-gp130-chimera were selected in 1.5 µg/ml puromycin (Sigma-Aldrich) 48 h after transduction without any cytokine. Surviving cells were daily observed, resulting in Ba/F3-L-gp130 and Ba/F3-
cys-L-gp130 cells growing independently from cytokines.
Surface Biotinylation
COS-7 cells were washed four times with phosphate-buffered saline (PBS). Cells were incubated for 15 min with 5 µg/ml LC-Sulfo-NHS-(+)-Biotin (Pierce Chemical, Rockford, IL). Biotinylation was stopped with 50 mM NH4Cl. Cells were washed with PBS, lysed, and frozen. Cell lysates were thawed at 4°C and centrifuged. The supernatants were incubated with BS12 (anti-gp130) (L-gp130,
-gp130, and wt-gp130).
Immunoprecipitation
Cells were lysed (lysis buffer: 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 50 mM Na-F, 3 mM Na3VO4, and 1% Brij96 supplemented with the Complete protease inhibitor cocktail tablets [Roche Diagnostics, Mannheim, Germany]), scraped off the dishes, and quick frozen in liquid nitrogen before thawing at 4°C on a shaker. Lysates were centrifuged and cleared supernatants were immunoprecipitated with 12 µg of the indicated antibodies overnight at 4°C followed by addition of 50 µl of protein A-Sepharose (50% slurry) for at least 1 h at 4°C. Immunoprecipitates were washed two times (with lysis buffer but only with 0.1% Brij96) and one time with Tris 20 mM, pH 8, before addition of sample buffer and boiling at 95°C for 5 min.
Immunoblotting and Enhanced Chemiluminescence (ECL) Detection
Immunoprecipitated proteins separated by SDS-PAGE were transferred to PVDF membranes by a semidry electroblotting procedure. Membranes were blocked in a solution of Tris-buffered saline (10 mM Tris, pH 8, and 150 mM NaCl) supplemented with 0.02% Tween and 5% skimmed milk powder for at least 1 h, probed with indicated antibodies overnight at 4°C, and incubated with horseradish peroxidase-conjugated secondary antibody. Immunoreactive proteins were detected by chemiluminescence using the ECL kit (Amersham Biosciences) following the manufacturers instructions.
DNA-binding Protein Assay
HepG2 cells were left untransfected or were transiently transfected with plasmids L-gp130 or
cysL-gp130. The cells were stimulated with 50 ng/ml IL-6 for 10 min at 37°C after a serum starvation for 4 h or left unstimulated for controls. Whole cell extracts were prepared as described above. The streptavidin agarose beads were preincubated for 1 h with 2 µg of double-strand 5'-biotinylated oligonucleotide. Specificity of the observed signals was controlled by introducing in IL-6activated cell extracts a 30-fold excess of unlabeled double-strand DNA as competitor for the biotinylated oligonucleotide. Solubilized proteins were then incubated with the streptavidin agarose beads overnight at 4°C. Immunoprecipitated complexes were subjected to SDS-PAGE and transferred to a nitrocellulose membrane. Detection by immunoblotting was performed with an anti-STAT3-phosphotyrosine mAb followed by ECL (Amersham Biosciences). STAT3 high-affinity interacting motif SIEM67 was derived from the c-fos gene (cis-inducible element: SIEM67-sense, CATTTCCCGTAAATCTTGTCG; SIEM67-reverse, CGACAAGATTT ACGGGAAATG) (Sadowski et al., 1993
; Beadling et al., 1996
; Giraud et al., 2001
).
Luciferase Assay
HepG2 cells were transiently transfected with expression vectors encoding L-gp130 and
-gp130 along with the SIEM-Luc reporter gene vector (kindly provided by Prof. Gascan (INSERM U564, Centre Hospitalier Universitaire dAngers, Angers, France) (Auguste et al., 1997
) and the Renilla luciferase-encoding vector pRL-Tk. Forty-eight hours posttransfection, cells were washed and deprived of serum. After another 48 h, cells were stimulated with 50 ng/ml IL-6 or left unstimulated. After an additional 1518 h, cell lysis and luciferase activity measurement was performed following the manufacturers instructions (Dual-Luciferase Reporter Assay system; Promega Madison, WI). Firefly luciferase expression (Siem-Luc) was normalized to constitutive Renilla luciferase expression (pRL-Tk), determined in parallel.
Proliferation Assays
Ba/F3-, Ba/F3-gp130-, BaF/3-L-gp130, BaF/3-gp130-L-gp130, and BaF/3-gp130-
cys-L-gp130 cells were washed three times and resuspended in cytokine-free medium at 5 x 103 cells/well of a 96-well plate. They were cultured in a final volume of 100 µl with cytokines as indicated in the figure legend for 7296 h and subsequently pulse labeled with 0.25 µCi of [3H]thymidine for 4 h. Cells were harvested on glass filters and incorporated [3H]thymidine was determined by scintillation counting. Bioassays were performed with each value being determined in triplicate.
Flow Cytometry Analysis. For analysis, cells were washed with fluorescence-activated cell sorting (FACS) buffer (PBS and 0.2% bovine serum albumin) and then incubated at 3 x 105 cells/100 µl in 20 µg/ml anti-FLAG M1 antibody in buffer for 60 min on ice. Anti-FLAG antibody was purchased from Sigma-Aldrich. After a single wash in buffer, cells were incubated at 3 x 105 cells/100 µl in a 1:100 dilution of allophycocyanin conjugated anti-mouse-antibody (Dianova, Hamburg, Germany). Cells were washed once, resuspended in 500 µl, and analyzed by flow cytometry (BD FACSCanto; BD Biosciences, Franklin Lakes, NJ).
Fos Peptide
The following peptide sequence was synthesized: Fos, N-LTDTLQAETDQLEDKKSALQTEIANLLKEKEKLEFILAAY-C (Patel et al., 1996
). Lyophilized peptides were solubilized in PBS to a final concentration of 2 mM, and aliquots were stored at 80°C.
Generation of L-gp130Expressing Embryonic Stem (ES) Cell Lines.
ES cells, derived from the parental line W9.5, were routinely grown in the absence of feeder cells in ES cell medium (DMEM containing 15% FCS and 0.1 mM 2-mercaptoethanol) and supplemented with 1000 U/ml LIF (Chemicon International, Temecula, CA) as described previously (Ernst et al., 1994
; Starr et al., 1997
). Stable transfectants were obtained following coelectroporation (Bio-Rad Gene Pulser set at 250 V and 500 µF) of the expression plasmid comprising the L-gp130 cDNA inserted in the pEF-BOS plasmid backbone and the resistance marker plasmid pPGKPuropA (Starr et al., 1997
). A single cell suspension of electroporated cells was plated at 5 x 103 cells/cm2 in gelatin-precoated 100-mm-diameter culture plates (Nalge Nunc, Naperville, IL), and 24 h later a 10-d selection period was started in the presence of 1 µg/ml puromycin (Sigma-Aldrich). Individual puromycin-resistant colonies were analyzed by Western blot analysis for expression of L-gp130, and positive clones expanded by repeated plating of single cell suspension every 45 d after trypsinization.
ES Cell Analysis
The extent to which gp130 signaling prevents ES cell differentiation was determined by morphology as described previously (Ernst et al., 1994
) and by analysis of Oct-4 expression. All results were confirmed with two independently and clonally derived ES either expressing L-gp130 or the empty pEF-BOS plasmid. Individual ES cell lines were trypsinized, plated at 1 x 103 cells/cm2 in gelatin-precoated 100-mm-diameter culture plates (Nalge Nunc) in ES cell medium either in the absence of presence of 1000 U/ml LIF, and cultured for up to 6 d. To document cellular morphology, phase contrast photomicrographs of cultures were taken at the indicated time, where pluripotent ES cells look like adherent berry-like balls of tightly packed cells, whereas differentiated cells adopt a spread-out fibroblast-like morphology. Quantitative real-time (RT)-PCR for Oct-4 was carried out on cDNA prepared by the random priming method, using random hexamer oligonucleotide primers and Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA), on total RNA extracted by the TRIzol method (Invitrogen) from ES cells cultured as described in the legend to the corresponding figure. We performed quantitative RT-PCR analysis in triplicate in a Rotor-Gene 3000 system (Corbett Research, Sydney, Australia) using SYBR Green (Fisher Biotech, Perth, Australia) with 40 cycles (94°C for 20 s, 62°C for 30 s, and 72°C for 30 s) after initial denaturation at 95°C for 10 min with eukaryotic 18S rRNA serving as a standardize for cDNA concentrations. Data quantification and acquisition of amplification products were carried out with the Rotor-Gene 3000 software on fluorescence resulting from intercalation of SYBR Green dye. Data are expressed in units relative to 18s RNA expression level. The following set of primers was used for amplification: murine Oct-4-specific primers (Oct4fwd, 5'-CCGGAAGAGAAAGCGAACTA; Oct4rev, 5'-TCTCCAGACTCCACCTCACA); and 18S rRNA-specific primers (M18Sf, 5'-GTAACCCGTTGAACCCCATT; M18sr, 5'-CCATCCAATCGGTAGTAGCG).
| RESULTS |
|---|
|
|
|---|
-gp130), was constructed (Figure 1C).
|
-gp130 constructs were expressed as proteins of the expected size of 46 and 36 kDa, respectively, whereas gp130 migrated at 130 kDa. To examine whether the expressed proteins were expressed at the cell surface, we performed surface biotinylation of transiently transfected COS-7 cells. As shown in Figure 2B, only gp130 and the L-gp130 were detected after precipitation with the mAb sc655, which is directed against the intracellular domain of gp130. This result indicates that the gp130 and L-gp130 protein, but not the
-gp130 protein, were exposed to the cell surface (Figure 2B). Accordingly, when we analyzed the transfected cells for phosphorylation of the two leucine zipper proteins, it turned out that only the L-gp130 protein was tyrosine phosphorylated (Figure 2C). Apparently the
-gp130 protein is not transported to the cell surface and therefore most likely is not functional.
|
-gp130 resulted in activation of the transcription factor STAT3 in transiently transfected HepG2 cells. For this purpose, cells were lysed 48 h after transfection, and the lysates were precipitated with the mAb sc655 followed by Western blot analysis with a phosphotyrosine-specific mAb. As can be seen in Figure 3A, expression of the
-gp130 did not lead to measurable STAT3 phosphorylation. In contrast, cells expressing L-gp130 showed similar STAT3 phosphorylation as mock-transfected HepG2 cells stimulated with recombinant IL-6 (Figure 3A). Furthermore, L-gp130 and
cysL-gp130transfected cells showed STAT3-specific DNA binding activity (Figure 3B).
|
-gp130 protein, was constitutively active, leading to phosphorylation of its cytoplasmic portion as well as of STAT3, and resulting in DNA binding of STAT3 and the subsequent induction of STAT3-dependent target genes.
STAT3 Activation and Cytokine Independent Proliferation of Ba/F3 Cells Stably Transfected with an L-gp130 cDNA
Next, we asked whether installation of L-gp130 into cells would lead to permanent activation of the gp130/STAT3 signaling pathway. The IL-3dependent murine pro-B-cell line Ba/F3 is the only cell line known not to express gp130. However, these cells are capable to grow in the absence of IL-3 and in the presence of IL-6 when gp130 and IL-6R are supplied by stable transfection (Palacios and Steinmetz, 1985
; Gearing et al., 1994
; Horsten et al., 1997
). We therefore selected Ba/F3 cells as an ideal cellular system to assess the long-term activity of the L-gp130 protein.
We used a retroviral system (Ketteler et al., 2002
) to transduce Ba/F3 cells with the cDNA encoding the L-gp130 protein. Cells were transduced and selected with puromycin (see Materials and Methods). Resistant cells were placed in medium lacking IL-3. Although untransfected or GFP-transduced cells did not survive in the absence of IL-3, cells transduced with L-gp130 survived and proliferated. We then asked which signaling pathway was activated in control and L-gp130transduced Ba/F3 cells. In parental Ba/F3 cells treated with either conditioned medium of WEHI-3 cells as a source of murine IL-3, or with recombinant murine IL-3, phosphorylated STAT5 could be detected. No phosphorylated STAT5, the major signaling molecule activated by IL-3, was seen in the absence of IL-3 (Figure 4A). A similar result was obtained in cells stably transfected with a cDNA encoding human wild-type gp130 (Fischer et al., 1997
). As expected, treatment of these cells with Hyper-IL-6, a fusion protein of IL-6 and sIL-6R (Fischer et al., 1997
), resulted in phosphorylation of STAT3 but not in phosphorylation of STAT5. Similarly, Ba/F3 cells transduced with L-gp130 showed constitutive phosphorylation of STAT3 but not STAT5 in the absence of any cytokine stimulation. These observations are consistent with the well recognized role for STAT3 but not STAT5, in mediating intracellular signaling from gp130. Phosphorylation of the second membrane-proximal tyrosine residue leads to recruitment of a Src homology 2-containing tyrosine phosphatase, SHP2, and subsequent phosphorylation of ERK1/2. Therefore, treatment of Ba/F-3-gp130 cells with Hyper-IL-6 induced ERK1/2 phosphorylation, whereas unstimulated cells exhibit no ERK1/2 phosphorylation. As expected, Ba/F3-L-gp130 cells display ERK1/2 phosphorylation without cytokine stimulation (Figure 4B).
|
Because L-gp130 contains a single cysteine residue in its extracellular portion, we were interested whether the cysteines of two L-gp130 molecules were affiliated with each other. Therefore, we performed an anti-FLAG-tag Western blot analysis of cell lysates from Ba/F3 and Ba/F3-L-gp130 cells under reducing and nonreducing conditions. The molecular mass of L-gp130 was calculated to be 43.4 kDa. As depicted in Figure 4D, monomeric L-gp130 could be clearly detected under reducing conditions and a dimeric form of L-gp130 under nonreducing conditions. We conclude that L-gp130 homodimers are further stabilized by intermolecular disulfide bridges. Two minor bands with a molecular mass of
40 and 80 kDa most likely represent unspecific binding of the antibody to endogenous cellular proteins because they occur already in the controls.
Leucine Zipper-enforced Dimerization of gp130 Can Be Reversed with a fos Leucine Zipper Peptide
To stabilize the leucine zipper-mediated dimerization of gp130, we had engineered a cysteine residue between the leucine zipper and the FLAG sequence in the L-gp130 protein (Figure 1B). We reasoned that it should be possible to reversibly dissociate the jun leucine zipper used in the L-gp130 protein with the help of a fos leucine zipper peptide (Patel et al., 1996
). We therefore first asked whether the presence of the cysteine residue was necessary for the long-term constitutive activation of L-gp130. For these experiments, we used Ba/F3-gp130 cells, because these could be grown as controls in the presence of Hyper-IL-6 to verify that the gp130 signaling pathway was intact after treatment of the cells with Hyper-IL-6 or the fos leucine zipper peptide.
We generated a version of L-gp130, which lacks the cysteine residue (
cys-L-gp130). Both, the L-gp130 and the
cys-L-gp130 retroviral cDNA constructs were transduced into Ba/F3-gp130 cells. As observed already, puromycin-resistant cells proliferated in the absence of IL-3 (see above).
We determined cell surface expression of the chimeric receptors by flow cytometry (Figure 5A). Cells were stained with anti-FLAG M2 as the primary antibody, followed by a secondary antibody detection step. Both cell lines expressed FLAG-tag containing hybrid receptors on their cell surface at comparable levels. Next, we assessed for STAT3 phosphorylation (Figure 5B). Clearly, in Ba/F3 cells expressing L-gp130 or
cys-L-gp130 receptor constructs, constitutively phosphorylated STAT3 protein could be detected at similar levels. Ba/F3-gp130 cells stimulated with Hyper-IL-6 also showed phosphorylated STAT3, whereas in unstimulated Ba/F3-gp130, no phosphorylated STAT3 was detected. Phosphorylated STAT3 protein levels in stimulated Ba/F3-gp130 were about twofold higher than in unstimulated L-gp130 or
cys-L-gp130expressing BAF/3 cells (Figure 5B). The proliferation of the Ba/F3 cells expressing the L-gp130 and the
cys-L-gp130 receptor constructs was compared with the proliferation of Ba/F3 cell stably transfected with a human gp130 cDNA. As can be seen in Figure 5C, proliferation of Ba/F3 cells expressing the L-gp130 and the
cys-L-gp130 receptor proteins was comparable with the proliferation obtained with the highest Hyper-IL-6 concentration.
|
cys-L-gp130 protein, in which leucine zipper-mediated dimerization is not stabilized by a disulfide bond, behaved similar to the stabilized L-gp130 protein complex, we asked whether the jun leucine zipper could be destabilized by adding monomeric fos leucine zipper peptide. Thermodynamic analysis had shown that junfos heterodimers are more stable than jun homodimers, as a result of electrostatic interactions between residues adjacent to the leucines (OShea et al., 1989
We analyzed the leucine zipper-destabilizing activity of a synthetic 36 amino acid peptide corresponding to the leucine zipper region of the fos protein. The constitutive proliferative activity transduced by the
cys-L-gp130 protein expressed in Ba/F3 cells was essentially abolished in the presence of 200 µM fos-peptide (Figure 5D). Alternatively, the fos peptide-mediated blockage of proliferation could be overcome by treatment of these cells with 10 ng/ml Hyper-IL-6, which induced dimerization of endogenous gp130. This result indicated that the fos peptide at a concentration of 200 µM had no unspecific cytotoxic effects. Furthermore, proliferation of Ba/F3 cells stably transfected with L-gp130 cells could not be inhibited with 200 µM Fos-peptide, implying that the leucine zipper in the L-gp130 protein is stabilized by an additional disulfide bridge.
We conclude from these experiments that the jun homodimer in the leucine zipper receptor chimeric protein can be destabilized by the fos leucine zipper peptide and that this destabilization can be used to modulate gp130 signaling pathway activity, which is constitutively activated by the jun leucine zipper in L-gp130.
Use of Leucine Zipper gp130 Receptor Hybrids to Prevent Differentiation of Mouse Embryonic Stem Cells
To test the biological activity of L-gp130 in a relevant homologous cell system, we turned our attention to gp130-mediated regulation of the pluripotent phenotype of mouse ES cells (Evans and Kaufman, 1981
; Martin, 1981
). Although ES cells undergo spontaneous differentiation when cultured in vitro, their pluripotent character can be maintained by gp130-mediated stimulation as brought about, for example, by administration of LIF, IL-6/sIL-6R, or Hyper-IL-6 (Smith et al., 1988
; Nichols et al., 1994
; Viswanathan et al., 2002
). We therefore asked whether L-gp130 when transfected into ES cells would lead to the maintenance of an undifferentiated state of these cells in the absence of exogenously added gp130 ligands.
Figure 6 shows that ES cells stably transfected with a cDNA coding for the L-gp130 receptor protein maintained a completely undifferentiated phenotype in the absence of the cytokine LIF (Figure 6A, v). By comparison, untransfected wild-type ES cells (Figure 6A, i) cultured for 4 d in the absence of recombinant LIF exhibited a fibroblast-like, differentiated phenotype (Figure 6A, ii), which could be prevented when LIF was included in the culture medium (Figure 6A, iii). As expected, L-gp130expressing ES cells grown in the presence of LIF also retained a morphologically undifferentiated phenotype (Figure 6A, vi).
|
Collectively, our results in Ba/F3 and murine ES strongly suggest that forced dimerization of gp130 via a leucine zipper is sufficient to activate gp130 to the extent which is needed to support cytokine-independent growth of pre-B-cells and to maintain an undifferentiated state in ES cells.
| DISCUSSION |
|---|
|
|
|---|
The approach taken assumes that the activation of gp130-associated JAK-kinases is triggered by juxtapositioning of the cytoplasmic tails within gp130 homodimers. Gp130, like other cytokine receptors, has two cytokine binding domains (CBDs) and additional subdomains like an Ig-like and a fibronectin-like (FNIII)-fold. It is believed that during activation, cytokine ligands reorganize their receptor complexes in such a way that the JAKs are correctly juxtaposed, allowing their activation by cross-phosphorylation. There is increasing evidence that many cytokine receptors seem to exist as inactive, preassembled complexes at the cellular surface. This has been demonstrated for the receptors for erythropoietin (Livnah et al., 1999
; Remy et al., 1999
; Constantinescu et al., 2001
); growth hormone (Frank, 2002
); interferon-
(Krause et al., 2002
); IL-6 (Schuster et al., 2003
); the
c signaling component in the receptors for IL-3, IL-5, and granulocyte macrophagecolony stimulating factor (Carr et al., 2001
); and also for gp130 (Giese et al., 2005
; our unpublished data). This implies that ligand binding induces a spatial reorganization within the receptor complex, thereby triggering intracellular signaling.
The contact between IL-6 and the gp130 receptor occurs via the site II and site III on the IL-6 protein. Gp130 contacts these sites via its CBD and the Ig-like domain, which are separated from the plasma membrane by three fibronectin III domains. It is clear that deletion of one or more of the fibronectin III domains leads to receptor molecules that can still bind their ligands but fail to activate intracellular signal transduction (Kurth et al., 2000
). This apparently paradoxical situation, although not completely understood, has been illuminated by a recent study by Skiniotis et al. (2005)
who used single particle electron microscopy to visualize the entire extracellular hexameric IL-6IL-6Rgp130 complex, containing the Ig-like domain, the CBD, and the three fibronectin III domains. The authors noted that the COOH-terminal portions of the cytokine binding domain are
100 Å apart. The COOH terminal portions of the membrane proximal fibronectin III domains are dimerized, which would lead to juxtaposition of the transmembrane domains of the cell expressed receptor. In this view, the functional role of the fibronectin III domains would be to assemble the transmembrane domains in proximity. Although we have not addressed this point in our study directly, our results imply that the COOH terminal portion of the membrane proximal transmembrane fibronectin III domains of the activated gp130 dimer need to be positioned in proximity to allow for full activation of the receptor.
In a previous study, we attempted to construct a constitutively active gp130 molecule where dimerization of gp130 was achieved by replacing its entire extracellular portion of the mature gp130 protein with the nine most carboxyl-terminal amino acids from Dind
(Hannemann et al., 1995
; Palmer et al., 2005
). Although this construct readily conferred STAT3-reporter gene activity, it was unable to sustain factor-independent growth in transfected Ba/F3 cells or to maintain the undifferentiated state of ES cells in the absence of LIF (Ernst, unpublished data).
Our approach to dimerize gp130 with the help of the jun leucine zipper is the first successful strategy to confer constitutive gp130 activation in the complete absence of any extracellular stimulation (Tanner et al., 1995
; Li et al., 2002
; Kawahara et al., 2004
). Moreover, we showed that activation of our gp130 receptor chimeric protein could be abrogated by the addition of a short peptide corresponding to the fos leucine zipper sequence. Our findings add support to the current view that IL-6 induces a conformational change in the extracellular domains of gp130 that is necessary for optimal alignment and binding of the amino acids in the dimerization domain. Finally, this rearrangement stabilizes the dimerized receptor in a conformation that holds gp130-associated JAK kinases in proximity, thereby facilitating signaling.
IL-6/hybridoma growth factor has been shown to be required for growth of murine hybridomas in vivo or in vitro (Mikami et al., 1991
). It would be a great advantage in hybridoma technology to develop IL-6independent hybridoma cell lines by stable transfection of L-gp130 cDNA. The general feasibility of this concept has been shown by Karahara et al. (2004)
who generated IL-6independent hybridoma cells stable transfected with a gp130 hybrid receptor, which was inducible by hen egg lysozyme.
Constitutive activation of STAT3, the gp130-dependent transcription factor, has been implicated in many human neoplastic malignancies, including multiple myeloma (Catlett-Falcone et al., 1999
; Rawat et al., 2000
); prostate cancer, melanoma, ovarian cancer, and renal carcinoma (Bromberg, 2002
); and gastric cancer (Jenkins et al., 2005
). Artificially dimerized STAT3 was shown to exhibit oncogenic potential, and STAT3 was therefore designated as an oncogene (Bromberg et al., 1999
). So far, it is not understood which processes lead to the observed constitutive activation of STAT3. It is not unlikely that in such malignancies, constitutive activation of gp130 either by an autocrine or paracrine loop of stimulating cytokines, e.g., of IL-6 or by genetic alterations, causes the activation of STAT3 (Sriuranpong et al., 2003
; Selander et al., 2004
). Moreover, a constitutively active gp130 protein provides an excellent molecular tool to establish animal models of diseases in which activated STAT3 is believed to play a role. Therefore, our constitutively active L-gp130 receptor molecule, for example, in conjunction with the reversibly inducible tetracycline expression system (Gossen et al., 1995
), may provide an exciting opportunity to generate animal models to assess the consequence of constitutive pathophysiologic activation of STAT3. The potential advantage of using a model based on L-gp130 rather than to rely on a constitutive active STAT3 mutants relates to the observation that the extent of STAT3 activation in the latter case is only a fraction of that observed in tumor cells (Bromberg et al., 1999
), whereas the levels of L-gp130mediated STAT3 activation are comparable with those observed after full stimulation of the wild-type gp130 receptor. The use of L-gp130 is therefore likely to provide novel insight into the consequences of massive and uncontrolled activation of gp130 signaling cascades in vivo, which has been associated with many types of solid and hematological tumors.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Address correspondence to: Stefan Rose-John ( rosejohn{at}biochem.uni-kiel.de)
Abbreviations used: CNTF, ciliary neurotrophic factor; ES, embryonic stem; GFP, green fluorescent protein; Gp130, glycoprotein 130 kDa; IL, interleukin; JAK, Janus tyrosine kinase; LIF, leukemia inhibitory factor; NNT-1, new neurotrophin-1; OSM, oncostatin M; R, receptor; S, soluble; STAT, signal transducer and activator of transcription.
| REFERENCES |
|---|
|
|
|---|
Beadling, C., Ng, J., Babbage, J. W., Cantrell, D. A. (1996). Interleukin-2 activation of STAT5 requires the convergent action of tyrosine kinases and a serine/threonine kinase pathway distinct from the Raf1/ERK2 MAP kinase pathway. EMBO J 15, 19021913.[Medline]
Behncken, S. N., Billestrup, N., Brown, R., Amstrup, J., Conway-Campbell, B., Waters, M. J. (2000). Growth hormone (GH)-independent dimerization of GH receptor by a leucine zipper results in constitutive activation. J. Biol. Chem 275, 1700017007.
Boulanger, M. J., Chow, D. C., Brevnova, E. E., Garcia, K. C. (2003). Hexameric structure and assembly of the interleukin-6/IL-6 alpha-receptor/gp130 complex. Science 300, 21012104.
Bromberg, J. (2002). Stat proteins and oncogenesis. J. Clin. Investig 109, 11391142.[CrossRef][Medline]
Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., Darnell, J.E.J. (1999). Stat3 as an oncogene. Cell 98, 295303.[CrossRef][Medline]
Carr, P. D., Gustin, S. E., Church, A. P., Murphy, J. M., Ford, S. C., Mann, D. A., Woltring, D. M., Walker, I., Ollis, D. L., Young, I. G. (2001). Structure of the complete extracellular domain of the common beta subunit of the human GM-CSF, IL-3, and IL-5 receptors reveals a novel dimer configuration. Cell 104, 291300.[CrossRef][Medline]
Catlett-Falcone, R., et al. (1999). Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity 10, 105115.[CrossRef][Medline]
Constantinescu, S. N., Keren, T., Socolovsky, M., Nam, H., Henis, Y. I., Lodish, H. F. (2001). Ligand-independent oligomerization of cell-surface erythropoietin receptor is mediated by the transmembrane domain. Proc Natl. Acad. Sci. USA 98, 43794384.
de Kruif, J. and Logtenberg, T. (1996). Leucine zipper dimerized bivalent and bispecific scFv antibodies from a semi-synthetic antibody phage display library. J. Biol. Chem 271, 76307634.
Ehlers, M., Grötzinger, J., deHon, F. D., Müllberg, J., Brakenhoff, J. P., Liu, J., Wollmer, A., Rose-John, S. (1994). Identification of two novel regions of human IL-6 responsible for receptor binding and signal transduction. J. Immunol 153, 17441753.[Abstract]
Ernst, M., Gearing, D. P., Dunn, A. R. (1994). Functional and biochemical association of Hck with the LIF/IL-6 receptor signal transducing subunit gp130 in embryonic stem cells. EMBO J 13, 15741584.[Medline]
Evans, M. J. and Kaufman, M. H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154156.[CrossRef][Medline]
Fischer, M., Goldschmitt, J., Peschel, C., Kallen, K. J., Brakenhoff, J.P.J., Wollmer, A., Grötzinger, J., Rose-John, S. (1997). A designer cytokine with high activity on human hematopoietic progenitor cells. Nat. Biotechnol 15, 142145.[CrossRef][Medline]
Frank, S. J. (2002). Receptor dimerization in GH and erythropoietin actionit takes two to tango, but how? Endocrinology 143, 210.
Gearing, D. P., Ziegler, S. F., Comeau, M. R., Friend, D., Thoma, B., Cosman, D., Park, L., Mosley, B. (1994). Proliferative responses and binding properties of hematopoietic cells transfected with low-affinity receptors for leukemia inhibitory factor, oncostatin M, and ciliary neurotrophic factor. Proc. Natl. Acad. Sci. USA 91, 11191123.
Giese, B., Roderburg, C., Sommerauer, M., Wortmann, S. B., Metz, S., Heinrich, P. C., Muller-Newen, G. (2005). Dimerization of the cytokine receptors gp130 and LIFR analysed in single cells. J. Cell Sci 118, 51295140.
Giraud, S., Bienvenu, F., Avril, S., Gascan, H., Heery, D. M., Coqueret, O. (2001). Functional interaction of STAT3 transcription factor with the coactivator NcoA/SRC1a. J. Biol. Chem 277, 80048011.[CrossRef][Medline]
Glover, J. N. and Harrison, S. C. (1995). Crystal structure of the heterodimeric bZIP transcription factor c-Fos-c-Jun bound to DNA. Nature 373, 257261.[CrossRef][Medline]
Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., Bujard, H. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268, 17661769.
Hannemann, J., Hara, T., Kawai, M., Miyajima, A., Ostertag, W., Stocking, C. (1995). Sequential mutations in the interleukin-3 (IL3)/granulocyte-macrophage colony-stimulating factor/IL5 receptor beta-subunit genes are necessary for the complete conversion to growth autonomy mediated by a truncated beta C subunit. Mol. Cell. Biol 15, 24022412.
Heinrich, P. C., Behrmann, I., Haan, S., Hermanns, H. M., Muller-Newen, G., Schaper, F. (2003). Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem. J 374, 120.[CrossRef][Medline]
Hibi, M., Nakajima, K., Hirano, T. (1996). IL-6 cytokine family and signal transduction: a model of the cytokine system. J. Mol. Med 74, 112.[CrossRef][Medline]
Horsten, U., Muller Newen, G., Gerhartz, C., Wollmer, A., Wijdenes, J., Heinrich, P. C., Grotzinger, J. (1997). Molecular modeling-guided mutagenesis of the extracellular part of gp130 leads to the identification of contact sites in the interleukin-6 (IL-6).IL-6 receptor.gp130 complex. J. Biol. Chem 272, 2374823757.
Jenkins, B. J., et al. (2005). Hyperactivation of Stat3 in gp130 mutant mice promotes gastric hyperproliferation and desensitizes TGF-beta signaling. Nat. Med 11, 845852.[CrossRef][Medline]
Kawahara, M., Kimura, H., Ueda, H., Nagamune, T. (2004). Selection of genetically modified cell population using hapten-specific antibody/receptor chimera. Biochem. Biophys. Res. Commun 315, 132138.[CrossRef][Medline]
Ketteler, R., Glaser, S., Sandra, O., Martens, U. M., Klingmuller, U. (2002). Enhanced transgene expression in primitive hematopoietic progenitor cells and embryonic stem cells efficiently transduced by optimized retroviral hybrid vectors. Gene Ther 9, 477487.[CrossRef][Medline]
Kishimoto, T., Akira, S., Narazaki, M., Taga, T. (1995). Interleukin-6 family of cytokines and gp130. Blood 86, 12431254.
Krause, C. D., Mei, E., Xie, J., Jia, Y., Bopp, M. A., Hochstrasser, R. M., Pestka, S. (2002). Seeing the light: preassembly and ligand-induced changes of the interferon gamma receptor complex in cells. Mol. Cell Proteomics 1, 805815.
Kurth, I., Horsten, U., Pflanz, S., Timmermann, A., Kuster, A., Dahmen, H., Tacken, I., Heinrich, P. C., Muller-Newen, G. (2000). Importance of the membrane-proximal extracellular domains for activation of the signal transducer glycoprotein 130. J. Immunol 164, 273282.
Li, Z. Y., Otto, K., Richard, R. E., Ni, S., Kirillova, I., Fausto, N., Blau, C. A., Lieber, A. (2002). Dimerizer-induced proliferation of genetically modified hepatocytes. Mol. Ther 5, 420426.[CrossRef][Medline]
Livnah, O., Stura, E. A., Middleton, S. A., Johnson, D. L., Jolliffe, L. K., Wilson, I. A. (1999). Crystallographic evidence for preformed dimers of erythropoietin receptor before ligand activation. Science 283, 987990.
Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl. Acad. Sci. USA 78, 76347638.
McMahan, C. J., et al. (1991). A novel IL-1 receptor, cloned from B cells by mammalian expression, is expressed in many cell types. EMBO J 10, 28212832.[Medline]
Mikami, T., Makishima, F., Suzuki, E. (1991). Enhancing effect of mouse peritoneal exudate cells and their products on antibody productivity of hybridoma cells: application of in vivo factors to in vitro culture. Cytotechnology 7, 93101.[Medline]
Nichols, J., Chambers, I., Smith, A. (1994). Derivation of germline competent embryonic stem cells with a combination of interleukin-6 and soluble interleukin-6 receptor. Exp. Cell Res 215, 237239.[CrossRef][Medline]
OShea, E. K., Rutkowski, R., Stafford, W.F.R., Kim, P. S. (1989). Preferential heterodimer formation by isolated leucine zippers from fos and jun. Science 245, 646648.
Palacios, R. and Steinmetz, M. (1985). Il-3-dependent mouse clones that express B-220 surface antigen, contain Ig genes in germ-line configuration, and generate B lymphocytes in vivo. Cell 41, 727734.[CrossRef][Medline]
Palmer, J., Ernst, M., Hammacher, A., Hertzog, P. J. (2005). Constitutive activation of gp130 leads to neuroendocrine differentiation in vitro and in vivo. Prostate 62, 282289.[CrossRef][Medline]
Patel, N., Herrman, J. M., Timans, J. C., Kastelein, R. A. (1996). Functional replacement of cytokine receptor extracellular domains by leucine zippers. J. Biol. Chem 271, 3038630391.
Pflanz, S., Hibbert, L., Mattson, J., Rosales, R., Vaisberg, E., Bazan, J. F., Phillips, J. H., McClanahan, T. K., de Waal Malefyt, R., Kastelein, R. A. (2004). WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J. Immunol 172, 22252231.
Rawat, R., Rainey, G. J., Thompson, C. D., Frazier-Jessen, M. R., Brown, R. T., Nordan, R. P. (2000). Constitutive activation of STAT3 is associated with the acquisition of an interleukin 6-independent phenotype by murine plasmacytomas and hybridomas. Blood 96, 35143521.
Remy, I., Wilson, I. A., Michnick, S. W. (1999). Erythropoietin receptor activation by a ligand-induced conformation change. Science 283, 990993.
Rose-John, S. and Heinrich, P. C. (1994). Soluble receptors for cytokines and growth factors: generation and biological function. Biochem. J 300, 281290.[Medline]
Sadowski, H. B., Shuai, K., Darnell, J.E.J., Gilman, M. Z. (1993). A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261, 17391744.
Sambrook, J., Fritsch, E. F., Maniatis, T. (1989). In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Schuster, B., Meinert, W., Rose-John, S., Kallen, K. J. (2003). The human interleukin-6 (IL-6) receptor exists as a preformed dimer in the plasma membrane. FEBS Lett 538, 113116.[CrossRef][Medline]
Selander, K. S., Li, L., Watson, L., Merrell, M., Dahmen, H., Heinrich, P. C., Muller-Newen, G., Harris, K. W. (2004). Inhibition of gp130 signaling in breast cancer blocks constitutive activation of Stat3 and inhibits in vivo malignancy. Cancer Res 64, 69246933.
Simpson, R. J., Hammacher, A., Smith, D. K., Matthews, J. M., Ward, L. D. (1997). Interleukin-6, structure-function relationships. Protein Sci 6, 929955.[Medline]
Skiniotis, G., Boulanger, M. J., Garcia, K. C., Walz, T. (2005). Signaling conformations of the tall cytokine receptor gp130 when in complex with IL-6 and IL-6 receptor. Nat. Struct. Mol. Biol 12, 545551.[CrossRef][Medline]
Smith, A. G., Heath, J. K., Donaldson, D. D., Wong, G. G., Moreau, J., Stahl, M., Rogers, D. (1988). Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688690.[CrossRef][Medline]
Sriuranpong, V., Park, J. I., Amornphimoltham, P., Patel, V., Nelkin, B. D., Gutkind, J. S. (2003). Epidermal growth factor receptor-independent constitutive activation of STAT3 in head and neck squamous cell carcinoma is mediated by the autocrine/paracrine stimulation of the interleukin 6/gp130 cytokine system. Cancer Res 63, 29482956.
Starr, R., Novak, U., Willson, T. A., Inglese, M., Murphy, V., Alexander, W. S., Metcalf, D., Nicola, N. A., Hilton, D. J., Ernst, M. (1997). Distinct roles for leukemia inhibitory factor receptor alpha-chain and gp130 in cell type-specific signal transduction. J. Biol. Chem 272, 1998219986.
Taga, T. and Kishimoto, T. (1997). gp130 and the interleukin-6 family of cytokines. Annu. Rev. Immunol 15, 797819.[CrossRef][Medline]
Taga, T. and Kishimoto, T. (1995). Signaling mechanisms through cytokine receptors that share signal transducing receptor components. Curr. Opin. Immunol 7, 1723.[CrossRef][Medline]
Tanner, J. W., Chen, W., Young, R. L., Longmore, G. D., Shaw, A. S. (1995). The conserved box 1 motif of cytokine receptors is required for association with JAK kinases. J. Biol. Chem 270, 65236530.
Viswanathan, S., Benatar, T., Rose-John, S., Lauffenburger, D., Zandstra, P. (2002). Maintenance of ES cell pluripotentiality is regulated by the number and types of gp130-mediated signaling complexes. Stem Cells 20, 119138.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
N. Adam, B. Rabe, J. Suthaus, J. Grotzinger, S. Rose-John, and J. Scheller Unraveling Viral Interleukin-6 Binding to gp130 and Activation of STAT-Signaling Pathways Independently of the Interleukin-6 Receptor J. Virol., May 15, 2009; 83(10): 5117 - 5126. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Bronte-Tinkew, M. Terebiznik, A. Franco, M. Ang, D. Ahn, H. Mimuro, C. Sasakawa, M. J. Ropeleski, R. M. Peek Jr., and N. L. Jones Helicobacter pylori Cytotoxin-Associated Gene A Activates the Signal Transducer and Activator of Transcription 3 Pathway In vitro and In vivo Cancer Res., January 15, 2009; 69(2): 632 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Rabe, A. Chalaris, U. May, G. H. Waetzig, D. Seegert, A. S. Williams, S. A. Jones, S. Rose-John, and J. Scheller Transgenic blockade of interleukin 6 transsignaling abrogates inflammation Blood, February 1, 2008; 111(3): 1021 - 1028. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||