|
|
|
|
Vol. 17, Issue 9, 3717-3728, September 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
,
*Laboratory of Protein Dynamics and Signaling, National Cancer Institute-Frederick, Frederick, MD 21702; and
Molecular Oncology Group and
Departments of Biochemistry, Medicine, and Oncology, McGill University Health Center, Montreal, Quebec, Canada H3A 1A1
Submitted March 28, 2006;
Revised April 18, 2006;
Accepted June 2, 2006
Monitoring Editor: Gerard Evan
| ABSTRACT |
|---|
|
|
|---|
binding sites. Importantly, we establish that Gab1-mediated signals are critical for cell cycle transition promoted by the oncogenic Met and fibroblast growth factor receptors, but not by progesterone, the natural inducer of cell cycle transition in Xenopus oocytes. Moreover, Gab1 is essential for Tpr-Metmediated morphological transformation and proliferation of fibroblasts. This study provides the first evidence that Gab1 is a key binding partner of the Met receptor for induction of cell cycle progression, proliferation, and oncogenic morphological transformation. This study identifies Gab1 and its associated signaling partners as potential therapeutic targets to impair proliferation or transformation of cancer cells in human malignancies harboring a deregulated Met receptor. | INTRODUCTION |
|---|
|
|
|---|
From studies in mice, the Met receptor has been implicated in several facets of embryogenesis, such as the growth and survival of epithelial cells, migration of myogenic and neuronal precursor cells, development of the kidney and mammary glands as well as liver and placenta formation (Bladt et al., 1995
; Schmidt et al., 1995
; Uehara et al., 1995
). Moreover, the activation of the Met receptor promotes angiogenesis and wound healing in mice (Toyoda et al., 2001
; Horiguchi et al., 2002
), and evidence indicates a role in primitive hematopoiesis during early Xenopus development (Koibuchi et al., 2004
). In cell culture systems, the HGF/Met receptor has been shown to affect many cellular functions, including mitogenesis of hepatocytes and myoblasts, cell scattering, invasion and branching tubulogenesis of epithelial cells as well as chemoattraction of motor neurons (for reviews, see Birchmeier et al., 2003
; Zhang and Vande Woude, 2003
).
The recruitment of signaling proteins and the biological activities of both the Met receptor and Tpr-Met oncoprotein are dependent on only two phosphotyrosine residues outside of the catalytic domain (pTyr-482 and -489 in Tpr-Met and pTyr-1349 and -1356 in Met). When phosphorylated, Tyr-1356 (Tyr-489 in Tpr-Met) provides a direct binding site for the Grb2 and Shc proteins (Fixman et al., 1996
; Ponzetto et al., 1996
). In turn, Grb2 acts to indirectly recruit the c-Cbl ubiquitin ligase and docking protein Gab1 (Weidner et al., 1996
; Bardelli et al., 1997
; Fixman et al., 1997
; Nguyen et al., 1997
). In addition, the docking protein Gab1 associates directly with the Met receptor through an interaction between the Met-binding motif (MBM) within Gab1 (13-amino acid proline-rich motif), and pTyr-1349 along with upstream residues of the Met receptor (pTyr-482 in Tpr-Met) (Lock et al., 2003
). Importantly, regardless of its mode of association, Gab1 becomes phosphorylated on multiple tyrosine residues upon its recruitment by the Met receptor, providing binding sites for multiple signaling proteins, including the p85 subunit of phosphatidylinositol 3-kinase (PI3K), phospholipase C
(PLC
), the Crk adaptor protein, and the tyrosine phosphatase SHP-2 (Garcia-Guzman et al., 1999
; Maroun et al., 1999a
; Gual et al., 2000
; Lamorte et al., 2000
).
Structurefunction studies have revealed key roles for Grb2, Shc, and Gab1 adaptor proteins downstream of the Met receptor in various biological events, which, if not strictly coordinated, may contribute to the development and progression of cancers. Recruitment of the Grb2 or Shc adaptor proteins is required and sufficient for oncogenic transformation, anchorage-independent growth, and experimental metastasis by the Met receptor oncoprotein (Fixman et al., 1996
; Ponzetto et al., 1996
; Bardelli et al., 1999
; Saucier et al., 2002
). Shc also plays a critical role in promoting the production of vascular endothelial growth factor and early onset of tumor angiogenesis by the Met receptor (Saucier et al., 2004
). Alternatively, the recruitment of the docking protein Gab1 is essential for Met receptor-mediated invasive branching morphogenesis of epithelial cells (Weidner et al., 1996
; Nguyen et al., 1997
; Maroun et al., 1999a
).
Although the mitogenic effect of HGF is well documented (Birchmeier et al., 2003
), little is known about the signals involved in the induction of cell cycle progression by the HGF/Met receptor. The Xenopus system is an extremely tractable system for dissecting the signaling networks implicated in cell cycle progression induced by proto-oncogenes and kinases. Significantly, many of the signaling networks implicated in cell cycle progression of Xenopus oocytes have been shown to be shared with those of somatic cell division (Ferrell, 1999
; Nebreda and Ferby, 2000
). In a recent study, we exploited this system to define which one of the many signaling pathways engaged downstream of the oncogenic Met receptor Tpr-Met is involved in cell cycle progression (Mood et al., 2006
). Similar to the signal requirements for Met receptor-mediated cell transformation, we have shown that cell cycle progression as well as activation of MAPK and c-Jun NH2-terminal kinase (JNK) required both the kinase activity of Tpr-Met and an intact multidocking protein site (phosphotyrosine residues Y482 and Y489). Moreover, using Met oncoproteins engineered to recruit a signaling protein of choice (Saucier et al., 2002
), we have established that although the recruitment of Grb2 or Shc is sufficient to induce cell cycle progression and the activation of MAPK and JNK, their recruitment to the oncogenic Met receptor is not essential for cell cycle progression (Mood et al., 2006
). This study suggested that, in addition to Grb2 and Shc adaptor proteins, another proximal-binding protein of the Met receptor contributes to its ability to induce cell cycle progression and cell transformation.
In the present study, we establish for the first time a critical contribution of the Gab1-docking protein downstream of the oncogenic Met receptor Tpr-Met in cell cycle progression of Xenopus oocytes as well as proliferation and cellular transformation of fibroblast cells. By performing structurefunction studies, we show that the direct interaction of Gab1 protein with the Tpr-Met oncoprotein is necessary and sufficient to promote cell cycle progression, and associated MAPK and JNK activation, whereas the recruitment of Gab1 via Grb2 is dispensable. Furthermore, we show that the Gab1 pleckstrin homology (PH) domain and the PI3K and SHP-2 binding sites in Gab1 are crucial for cell cycle progression mediated by Tpr-Met.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PH: sense, 5'-GCTGGGATCCACCATGGGATTCAATCCCACAGAAGAAGATCCTTCTT GGTGGGTGTCTCGG-3' and antisense, same as above; and Met-binding domain (MBD) domain constructs: sense, 5'-GCTGGGATCCACCATGGACGAGAACTTCGTTCCCATGAACCCCAACTC-3' and antisense, 5'-ACTGGAATTCTCAGGGCCCAGCGTAATCTGGAACATCGTATGGGTAGTC TAA AGGTGCCGGCTTGACTT-3'. The putative full-length Gab1 cDNA was cloned by PCR from a Xenopus oocyte cDNA library (a gift of Dr. Alan Wolfe, National Institutes of Health, Bethesda, MD) using the following primers: sense, 5'-ACGACGAGGAGCAG GATGATGAGC-3' and antisense, 5'-TCATTTGATATTCTTG GTTGGAG-3'. Sequence analyses were performed using the MacVector 7.2 program (Accelrys, San Diego, CA).
RNA Injections in Frog Oocytes
Xenopus laevis females were purchased from Nasco (Fort Atkinson, WI) and prepared as described previously (Fabian et al., 1993
). All capped mRNA was made using the SP6 mMessage mMachine kit as specified by the manufacturer (Ambion, Austin, TX). Microinjections of various RNAs, at the amounts indicated in the text or figures, were performed 18 h after oocyte isolation with a volume of 1030 nl (Harvard Apparatus, Holliston, MA). Experiments using Gab1 mutants were performed by microinjecting mutant RNAs and culturing oocytes 418 h in 50% L-15 media with 1% bovine serum albumin before microinjection with Tpr-Met construct RNAs. For experiments using the wt fibroblast growth factor receptor (FGFR)1, oocytes were microinjected with mutant Gab1 RNAs, cultured 4 h, coinjected with wt FGFR1 and fibroblast receptor substrate-2 (FRS2) RNAs, and then cultured an additional 4 h before the addition of 200 ng/ml basic FGF. Oocytes were scored 1620 h later for cell cycle progression as evidenced by the appearance of a white spot at the animal pole, a process know as germinal vesicle breakdown (GVBD), and this was verified in many cases by manual dissection of oocytes after fixation in 8% trichloroacetic acid.
Western Blot Analysis and Antibodies
The methodology for the preparation of lysates, SDS-PAGE electrophoresis, and Western blot analyses were described previously (Lock et al., 2003
; Mood et al., 2006
). Primary antibodies were used at the following dilutions: Met rabbit polyclonal at 1:2000 (Rodrigues et al., 1991
); phospho-Met polyclonal to Y1234 and Y1235 (Upstate Biotechnology, Lake Placid, NY) at 1:2000; Gab1 (Upstate Biotechnology) at 1:1000; phospho-Gab1-Tyr627 (Abcam, Cambridge, MA) at 1:1000, phospho-Cdc2-Tyr15 (Upstate Biotechnology) at 1:2000; phospho-MAP kinase (Sigma-Aldrich, St. Louis, MO) at 1:5000; MAPK (extracellular signal-regulated kinase [ERK]2; Upstate Biotechnology) at 1:2000; phospho-JNK-Thr183/Tyr185 (Upstate Biotechnology) at 1:1000; JNK2 (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:2000; horseradish-conjugated HA antibody (Roche Diagnostics, Indianapolis, IN) at 1:1000;
-tubulin (Sigma-Aldrich) at 1:5000; and phospho-Tyr (Upstate Biotechnology or BD Biosciences Transduction Laboratories, Lexington, KY) at 1:1000.
Cell Culture, Transfection, and Retroviral Infection
Fisher Rat 3T3 fibroblast (Fr3T3) and human epithelial kidney (HEK) 293 cells were cultured in DMEM containing 10% fetal bovine serum and 50 µg/ml gentamicin (Invitrogen, Carlsbad, CA). Transient transfections in HEK 293 cells were performed using Lipofectamine Plus reagent according to the manufacturers instructions (Invitrogen). Retroviral infection of Fr3T3 cells were performed as described previously (Fixman et al., 1996
). After selection with 2 µg/ml puromycin for at least 10 d, >100 colonies were pooled to generate cell populations, or alternatively, individual resistant colonies were picked and expanded to establish stable cell lines. Phase contrast images were taken with a Zeiss Axiovision 135 microscope with a 10x objective (Carl Zeiss Canada, Toronto, Ontario, Canada) using Northern Eclipse version 6.0 (Empix Imaging, Mississauga, Ontario, Canada).
Proliferation Assays
Cells were seeded in triplicate at a density of 5 x 104/well in six-well plates, and the number of cells was subsequently counted daily. Growth curve analysis was performed using Prism version 3.0c (GraphPad Software, San Diego, CA).
| RESULTS |
|---|
|
|
|---|
|
The adaptor protein Gab1 has binding motifs for the recruitment of multiple signal transduction proteins, including the Crk adaptor, PLC
, PI3K, and the SHP-2 tyrosine phosphatase (Gu and Neel, 2003
). Thus, Gab1 amplifies and diversifies the signals downstream from receptors by assembling multiprotein complexes. We have previously shown that all Tpr-Met mutants and docking-specific variants able to induce oocyte maturation (Mood et al., 2006
) have in common the capacity to recruit Gab1 (Figure 1), suggesting that a Gab1-like scaffolding protein is a potential key player in Tpr-Metmediated cell cycle progression in Xenopus oocytes.
A Xenopus Gab1 cDNA clone (EMBL accession no. Q6AZI1) with a high degree of homology to the human and mouse Gab1 sequences has been previously identified (Klein et al., 2002
), and we have isolated full-length Gab1 cDNA from a Xenopus oocyte library. Xenopus Gab1 (XGab1) displays 75 and 73% identity to the human and murine Gab1 protein sequences, respectively (Holgado-Madruga et al., 1996
; Weidner et al., 1996
) (Figure 2). Significantly, all of the functionally relevant tyrosine phosphorylation sites identified previously in mammalian Gab1 proteins (Gu and Neel, 2003
) are conserved within the XGab1 protein (Figure 2), including those responsible for the binding of PI3K (Y443, Y468, and Y586), Crk (Y239, Y255, Y303, Y313, Y369, and Y402), PLC
(Y303, Y369, and Y402), and SHP-2 (Y624 and Y656). Moreover, like the mammalian Gab1 protein, XGab1 contains an N-terminal PH domain (Maroun et al., 1999a
), the two Grb2 carboxy-terminal SH3 domain binding sites (Lock et al., 2000
) as well as the MBD (aa 440-532) that encompasses the 13-amino acid sequence corresponding to the MBD (aa 482-494) responsible for the direct recruitment of Gab1 to the Met receptor (Lock et al., 2003
). Notably, the mammalian Gab1 antibody detects a protein of appropriate size in uninjected Xenopus oocyte extracts (Figure 3A). These data suggest that Xenopus oocytes express a form of Gab1 that possesses all of the appropriate structural features for signaling downstream of the oncogenic Met receptor.
|
|
The Shc adaptor protein binds through its PTB domain to Tyr-489 of Tpr-Met (Saucier et al., 2002
), an association that is not abrogated in the context of the Y482F or N491H Tpr-Met mutants (Fournier et al., 1996
; Saucier et al., 2002
), which may lead to the engagement of Gab1 (Figure 1). To determine whether the association of Shc with Tpr-Met contributes to the induction of GVBD mediated by Gab1, we tested the effect of the ShcPTB domain that binds Tyr-489 and blocks the direct interaction of Shc with Tpr-Met (Saucier et al., 2002
; Mood et al., 2006
). In oocytes injected with an optimal level of the Shc-specific docking variant of Tpr-Met (400 pg/oocyte), GVBD was efficiently suppressed in the presence of the ShcPTB domain (Figure 3B). Consistent with Gab1 being recruited through Shc, the expression of Gab1 mediates cell cycle progression in the presence of low levels of the Shc specific docking variant of Tpr-Met, and this event is blocked in the presence of the ShcPTB domain (Figure 3B). However, abrogating Shc recruitment had no effect on the ability of Gab1 to restore Tpr-Met-induced cell cycle progression as well as GVBD mediated by the Y482F or N491H Tpr-Met mutants (Figure 3A).
The induction of GVBD was confirmed by detection of tyrosine phosphorylation of Cdc2 at position 15 (Figure 3, A and B), an inhibitory phosphorylation site that displays an inverse correlation with GVBD (Pickham et al., 1992
). Moreover, when Gab1 was expressed in oocytes in the presence of low levels of Tpr-Met, Y482F, or N491H as well as the Shc- specific docking oncoprotein, a corresponding activation of MAPK and JNK was observed (Figure 3, A and B). As expected, the ShcPTB domain blocked MAPK and JNK phosphorylation in the presence of high levels of the Shc-specific docking mutant (400 pg; Figure 3B), but not in the presence of Tpr-Met, Y482F, or N491H (Figure 3A). Together, these data support the role of Gab1 as a downstream mediator of the oncogenic Met receptor for induction of cell cycle progression, and activation of MAPK and JNK, and that neither the engagement of Shc-dependent signals nor the Grb2-dependent recruitment of Gab1 protein to the Met receptor is essential for the induction of these responses.
Direct Recruitment of Gab1 Is Required for Induction of Cell Cycle Progression in the Presence of Suboptimal Levels of the Tpr-Met Oncoprotein
To formally assess the role of the direct or indirect interaction of Gab1 with the Met receptor for cell cycle progression, we tested the ability of Gab1 mutants either lacking the Grb2-binding sites (Gab
Grb2) or the MBM (Gab
MBM), or both (Gab
Grb2
MBM) to induce GVBD in the presence of suboptimal levels of either the wt Tpr-Met (Figure 4A) or the Tpr-Met N491H mutant specifically devoid of its Grb2 binding site (Figure 4B). We observed that the Gab1
Grb2 mutant efficiently promotes cell cycle progression in the presence of either wt Tpr-Met or the Tpr-Met N491H mutant (Figure 4, A and B). Furthermore, the ability of the Gab1
Grb2 mutant to mediate Tpr-Met N491H-induced GVBD was not impaired in the presence of the Shc-PTB domain (Figure 4B), supporting the dispensability of Shc-dependent signals for the induction of these responses. In contrast, Gab1-mediation of GVBD responses by wt Tpr-Met or the Tpr-Met N491H mutant, was severely impaired with the Gab1
MBM mutant and completely abrogated for the mutant of Gab1 lacking both the Grb2 and MBM binding motifs (Figure 4, A and B). In a similar manner to wt Gab1, the coexpression of Gab1
Grb2 with either the wt Tpr-Met or N491H mutant enhances Cdc2 dephosphorylation, and MAPK and JNK activation (Figure 4, A and B). In contrast, this activation was considerably reduced with Gab1 mutants lacking the MBM, or lacking both the MBM and Grb2 binding sites (Figure 4, A and B). These data establish that Grb2-dependent recruitment of Gab1 to the Met receptor complex is dispensable for the induction of cell cycle progression in Xenopus oocytes and that the direct interaction of Gab1 with the Met receptor is both necessary and sufficient for the induction of cell cycle progression as well as activation of MAPK and JNK.
|
(Figure 5A). Consistent with this, a decrease in the level of Cdc2 phosphorylation was detected by Western analysis, and MAPK and JNK phosphorylation was induced to levels comparable with that observed with wt Gab1 (Figure 5A). In contrast, a Gab1 mutant lacking the PH domain, or the PI3K (Figure 5A) or SHP-2 interaction sites (Figure 5B), fails to promote Tpr-Metmediated cell cycle progression as well as MAPK and JNK activation. These data demonstrate that the PH domain and the PI3K and SHP-2 binding sites in Gab1 are essential for the ability of Gab1 to rescue cell cycle progression and for activation of MAPK and JNK mediated by Tpr-Met.
|
Overexpression of the MBD of Gab1 in epithelial cells inhibits HGF-induced scattering and branching morphogenesis (Weidner et al., 1996
). Given that the MBD encompasses one Grb2 SH3 binding site and the MBM responsible for the direct interaction of Gab1 with the Met receptor (Lock et al., 2000
, 2003
), the dominant-negative effect of the MBD of Gab1 on Met-induced responses may reflect a block in the engagement of endogenous Gab1 by the Met receptor. Consistent with this, Tpr-Met and HA-tagged MBD of the Gab1 protein are present in an immune complex when coexpressed in HEK 293 cells, but not when Tpr-Met was cotransfected with an MBD of Gab1 lacking both the MBM and Grb2 interaction site (Figure 6A). Significantly, Tpr-Metinduced Gab1 phosphorylation, which is associated with Gab1 signaling functions, was potently inhibited by expression of the MBD of Gab1 (Figure 6B).
|
PI3K or MBD
Grb2; Figure 7) is expressed, suggesting that the dominant-negative effect is independent of PI3K or Grb2 binding. Importantly, expression of a Gab1-MBD in which the MBM is deleted (MBD
MBM or MBD
MBM
Grb2) is unable to block GVBD promoted by Tpr-Met (Figure 7). A strong correlation between GVBD and the activation of MAPK and JNK was also observed (Figure 7). These data demonstrate that cell cycle progression and activation of MAPK and JNK induced by the oncogenic Met receptor require the engagement of Gab1-dependent signaling pathways.
|
MBM only partially prevents oocytes from undergoing GVBD upon activation of FGFR (Figure 8A). These results show that Gab1 plays an important role in FGFR-induced cell cycle progression and support a major contribution for the Grb2-dependent mechanism for the engagement of Gab1 downstream of the FGFR in these processes. Importantly, both cell cycle progression and activation of MAPK or JNK triggered by treatment of the oocytes with the natural inducer progesterone (5 µM) are not effected by the expressing the wt MBD of Gab1 or any of the MBD mutants (Figure 8B). These data support the specificity of the MBD domain toward the Met and FGF receptors and show that Gab1-dependent signals are not required for progesterone-mediated cell cycle progression, and for activation of MAPK or JNK.
|
To address whether Gab1 may be essential for Tpr-Metinduced morphological transformation, Tpr-Metexpressing fibroblasts (Fr3T3) were infected with retroviruses encoding the wt MBD of Gab1, with an MBD mutant lacking both MBM and Grb2 binding sites, or with empty pBabe vector. We observed that Tpr-Metexpressing fibroblasts infected with a Gab1 MBD lacking both the MBM and Grb2 motifs (
MBM/
Grb2) remained refractile, spindle shaped, and grew in a disorganized manner, a typical morphology for Tpr-Mettransformed fibroblasts (Figure 9A). In contrast, the transformed morphology of Tpr-Metexpressing cells was dramatically reversed in cells infected with the wt MBD of Gab1, as evidenced by reduced refractility and a flatter, more organized growth pattern and morphology (Figure 9A). Stable cell lines expressing Tpr-Met and the Gab1 MBD proteins were isolated to perform cell proliferation assays (Figure 9, B and C). We observed that Tpr-Mettransformed cells coexpressing wt MBD of Gab1 grow at a considerably slower rate (doubling time of 21 h), compared with those expressing the empty vector (doubling time of 16 h), or those coexpressing the Gab1 MBD lacking the MBM and Grb2 binding sites (doubling time of 17 h; Figure 9C). These data provide the first evidence that engagement of Gab1-dependent signals is essential for induction of proliferation and oncogenic morphological transformation promoted by the oncogenic Met receptor in fibroblasts.
|
| DISCUSSION |
|---|
|
|
|---|
Structurefunction analyses show that either the direct binding of Gab1 to the oncogenic Met receptor or the indirect recruitment of Gab1 via the Grb2 adaptor protein is sufficient to induce cell cycle progression in Xenopus oocytes. For example, overexpression of either wt Gab1 or a mutant of Gab1 devoid of Grb2 binding sites (Gab
Grb2), promotes cell cycle progression in the presence of suboptimal levels of the wt Tpr-Met (Figure 4). Similar results are observed with the N491H Tpr-Met mutant that lacks the Grb2 binding site but retains Y482 required for direct recruitment of Gab1 through the Gab1 MBM (Lock et al., 2003
), demonstrating that the direct recruitment of Gab1 through the MBM is sufficient to mediate GVBD. Conversely, we have shown that Tpr-Met docking mutants that specifically bind Grb2 or Shc adaptor proteins, and thus recruit Gab indirectly, promote cell cycle progression (Mood et al., 2006
). In agreement with these data, overexpression of Gab1 mediates cell cycle progression in the presence of suboptimal levels of Y482F Tpr-Met (Figure 3), a mutant that lacks the direct Gab1 interaction site (Y482) but retains the ability to recruit Gab1 indirectly via either Grb2 or Shc, binding to Y489 in Tpr-Met (Lock et al., 2003
). Interestingly, deletion of the MBM in Gab1 impairs its ability to mediate cell cycle progression downstream of Tpr-Met (Figure 4), under conditions where Gab1 is recruited indirectly to Met via Grb2 (Lock et al., 2003
). Considering that deletion of the MBM does not hinder the association of Grb2 with the MBD of Gab1 (our unpublished data), this suggests that the MBM of Gab1 may have additional functions in Gab1 signaling beyond its direct interaction with the Met receptor.
Gab1 is an essential mediator of the Met receptor-induced epithelial morphogenetic program; a biological process that requires coordinated epithelial cell proliferation, adhesion, migration, and invasion (Pollack et al., 1998
). Given the importance of cell proliferation during epithelial morphogenesis, our finding that Gab1 plays a critical role in cell cycle progression and proliferation downstream of the Met receptor (Figures 7 and 9) suggests that Gab1 is a key modulator of cell proliferation during Met receptor epithelial morphogenesis. Consistent with this concept, the morphogenetic defect resulting from expression of a Met receptor mutant devoid of the direct Grb2 binding site (N1358H) is rescued by overexpression of wt Gab1 or a Gab1 mutant lacking the Grb2 interaction sites. In contrast, a Gab1 mutant lacking the MBM fails to rescue the defect (Lock et al., 2002
, 2003
), and an intact MBM in Gab1 is essential for Met-mediated cell cycle progression in Xenopus oocytes (Figure 4). Moreover, overexpression of the MBD domain prevents both oncogenic Met receptor-induced cell cycle progression (Figure 7) and HGF/Met receptor epithelial morphogenesis (Weidner et al., 1996
).
By structurefunction analyses, we show that the ability of Gab1 to promote cell cycle progression downstream of Tpr-Met is dependent on the Gab1 PH domain, and the association of Gab1 with the tyrosine phosphatase SHP-2 and with PI3K, whereas the recruitment of Crk and PLC
signaling molecules is dispensable (Figure 5). Thus, many of the identified signaling requirements for induction of cell cycle progression by the oncogenic Met receptor are also necessary for Met-induced cell dispersal or epithelial morphogenesis, including a requirement for the PH domain and SHP-2 binding sites in Gab1 (Figure 5), and activation of MAPK or PI3K (Maroun et al., 1999a
, 2000; Yu et al., 2003
; Mood et al., 2006
).
The association of Gab1 with the tyrosine phosphatase SHP-2 is required for sustained ERK activation and for epithelial morphogenesis downstream from the Met receptor and may act upstream of Ras (Maroun et al., 2000
; Cunnick et al., 2002
). A Gab1 mutant lacking the ability to bind SHP-2 fails to activate MAPK and cell cycle progression downstream of the Tpr-Met (Figure 5), indicating that activation of MAPK may occur predominantly through the Gab1/SHP-2 protein complex during cell cycle progression in oocytes.
Tpr-Met induces activation of Ras, an upstream activator of Raf1, and we have shown that activation of MAPK and cell cycle progression induced by Tpr-Met are dependent on Raf kinase (Mood et al., 2006
). This implies that activation of MAPK and cell cycle progression mediated by Tpr-Met may also require Ras activation, likely via the recruitment of an exchange factor for Ras. This may occur through the recruitment of both Grb2/Sos and Gab1/Crk/C3G proteins to a complex with Tpr-Met, because a Gab1 mutant lacking the Grb2 binding sites maintains the ability to enhance cell cycle transition downstream of a Tpr-Met mutant lacking the direct Grb2 binding site, even in the presence of the Shc-PTB domain (Figure 4B). Moreover, the Crk binding sites in Gab1 are dispensable for the induction of cell cycle progression mediated by the Tpr-Met (Figure 5), suggesting that direct binding of Crk alone to Gab1 is not essential for the process.
The Gab1 PH domain has been shown to bind phosphatidylinositol-3,4,5-trisphosphate (PIP3), the lipid products of PI3K, and to mediate the recruitment Gab1 and Gab1-associated protein complexes to PIP3-rich microdomains (Maroun et al., 1999b
). This recruitment may be critical for Met-induced cell cycle progression and for the enhanced activation of PI3K by membrane associated Gab1. PI3K activity is required for cell proliferation induced by a variety of mitogens, but evidence suggests that the activation of PI3K is not sufficient for cell cycle progression (Katso et al., 2001
) and as demonstrated for the oncogenic Met receptor (Mood et al., 2006
). Indeed, PI3K may act in conjunction with MAPK signaling pathways to stimulate cell cycle progression and proliferation (Katso et al., 2001
). The function of the PH domain and PI3K binding of Gab1 therefore may be to localize the Tpr-Met/Gab1/SHP-2 protein complex to a particular membrane compartment, where Gab1-dependent recruitment of SHP-2 leads to the sustained activation of MAPK signaling pathways.
We observed that the binding of Crk/PLC
to Gab1 is required to rescue Met receptor-induced branching morphogenesis (Lamorte et al., 2002b
), and it has been shown that inhibition of PLC
activity prevents HGF-mediated epithelial branching morphogenesis (Gual et al., 2000
), but it does not preclude cell cycle progression induced by Tpr-Met (Mood et al., 2006
). The distinct signaling requirement observed downstream of Gab1 for cell cycle progression and branching morphogenesis suggests that Gab1 may serve multiple functions during Met-induced branching morphogenesis. Whereas one function may be in the regulation of cell proliferation through Gab1 PH-dependent mechanism and the activation of SHP-2, PI3K and MAPK signaling pathways, another may involve a key role for the Crk adaptor protein and/or PLC
, which affect epithelial branching morphogenesis through functions in cell spreading, breakdown of adherens junctions, and migration of epithelial cells (Lamorte et al., 2002b
; Rodrigues et al., 2005
).
The signaling requirements for Tpr-Metinduced cell cycle progression in Xenopus oocytes are similar to those implicated in fibroblast cell transformation. For example, both processes are dependent on the presence of the twin phosphotyrosine (Y482 and Y489) residues in the C terminus of Tpr-Met and are associated with activation of PI3K, MAPK, and JNK signaling pathways (Kamikura et al., 1996
; Rodrigues et al., 1997
; Bardelli et al., 1999
; Lamorte et al., 2000
; Mood et al., 2006
). Furthermore, the specific recruitment of Grb2 or Shc adaptor is sufficient to induce these responses, but the direct recruitment of PLC
or PI3K to Tpr-Met is not sufficient (Saucier et al., 2002
; Mood et al., 2006
). Importantly, as demonstrated for cell cycle progression in Xenopus oocytes (Figure 7), expression of the MBD impairs proliferation and morphological transformation of Tpr-Metexpressing fibroblasts (Figure 9). This is the first demonstration that engagement of Gab1 signals are required for the transforming activities of the Met receptor oncoprotein.
Bcr-Abl and TEL-TRKC (ETV6-NTRK3) oncoproteins, like Tpr-Met, are cytoplasmic constitutively activated kinases resulting from chromosomal rearrangements that fuse dimerization motifs to their kinase domains. Interestingly, the transforming activity of Bcr-Abl has been shown to be dependent on its ability to associate with Gab2, whereas TEL-TRKC requires association with IRS-1, and to be dependent on activation of PI3K (Sattler et al., 2002
; Lannon et al., 2004
). In addition, oncogenic transformation induced by the polyoma middle T antigen, a cytoplasmic oncoprotein, tightly correlates with its capacity to interact with and to phosphorylate Gab1, and to activate PI3K (Ong et al., 2001
). Given that these are scaffolding proteins that all contain a PH domain, their importance in cell transformation may reflect the property of these proteins to target a multiprotein complex to a specific membrane location, thus allowing for an interaction with appropriate effectors.
Gab1 becomes tyrosine phosphorylated upon the activation of several RTKs that stimulate cell proliferation, and overexpression of Gab1 has been shown to enhance cell growth and transformation of NIH3T3 cells downstream of the epidermal growth factor receptor (Holgado-Madruga et al., 1996
). Because we demonstrate that the engagement of Gab1-dependent signals is required for FGFR-mediated cell cycle progression in Xenopus oocytes, and for the oncogenic activity of the Met receptor in fibroblasts (Figures 7
9), we predict that cell proliferation and transformation promoted by several RTKs may also be dependent on the engagement of Gab1-dependent signals. Significantly, our results identify Gab1 and/or Gab1-dependent signals as potential therapeutic targets to impair proliferation and/or transformation of cancer cells harboring a deregulated Met receptor.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Address correspondence to: Ira O. Daar (daar{at}ncifcrf.gov)
Abbreviations used: Gab1, Grb2-associated binder 1; GVBD, germinal vesicle breakdown; MBD, Met-binding domain; MBM, Met-binding motif; RTK, receptor tyrosine kinase.
| REFERENCES |
|---|
|
|
|---|
Bardelli, A., Longati, P., Gramaglia, D., Stella, M. C., Comoglio, P. M. (1997). Gab1 coupling to the HGF/Met receptor multifunctional docking site requires binding of Grb2 and correlates with the transforming potential. Oncogene 15, 31033111.[CrossRef][Medline]
Birchmeier, C., Birchmeier, W., Gherardi, E., Vande Woude, G. F. (2003). Met, metastasis, motility and more. Nat. Rev. Mol. Cell Biol 4, 915925.[CrossRef][Medline]
Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., Birchmeier, C. (1995). Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature 376, 768771.[CrossRef][Medline]
Browaeys-Poly, E., Cailliau, K., Vilain, J. P. (2000). Signal transduction pathways triggered by fibroblast growth factor receptor 1 expressed in Xenopus laevis oocytes after fibroblast growth factor 1 addition. Role of Grb2, phosphatidylinositol 3-kinase, Src tyrosine kinase, and phospholipase Cgamma. Eur. J. Biochem 267, 62566263.[Medline]
Carballada, R., Yasuo, H., Lemaire, P. (2001). Phosphatidylinositol-3 kinase acts in parallel to the ERK MAP kinase in the FGF pathway during Xenopus mesoderm induction. Development 128, 3544.[Abstract]
Cooper, C. S., Park, M., Blair, D. G., Tainsky, M. A., Huebner, K., Croce, C. M., Vande Woude, G. F. (1984). Molecular cloning of a new transforming gene from a chemically transformed human cell line. Nature 311, 2933.[CrossRef][Medline]
Cunnick, J. M., Meng, S., Ren, Y., Desponts, C., Wang, H. G., Djeu, J. Y., Wu, J. (2002). Regulation of the mitogen-activated protein kinase signaling pathway by SHP2. J. Biol. Chem 277, 94989504.
Fabian, J. R., Morrison, D. K., Daar, I. O. (1993). Requirement for Raf and MAP kinase function during the meiotic maturation of Xenopus oocytes. J. Cell Biol 122, 645652.
Ferrell, J. E. Jr. (1999). Xenopus oocyte maturation: new lessons from a good egg. Bioessays 21, 833842.[CrossRef][Medline]
Fixman, E. D., Fournier, T. M., Kamikura, D. M., Naujokas, M. A., Park, M. (1996). Pathways downstream of Shc and Grb2 are required for cell transformation by the Tpr-Met oncoprotein. J. Biol. Chem 271, 1311613122.
Fixman, E. D., Holgado-Madruga, M., Nguyen, L., Kamikura, D. M., Fournier, T. M., Wong, A. J., Park, M. (1997). Efficient cellular transformation by the Met oncoprotein requires a functional Grb2 binding site and correlates with phosphorylation of the Grb2-associated proteins, Cbl and Gab1. J. Biol. Chem 272, 2016720172.
Fournier, T. M., Kamikura, D., Teng, K., Park, M. (1996). Branching tubulogenesis but not scatter of Madin-Darby canine kidney cells requires a functional Grb2 binding site in the Met receptor tyrosine kinase. J. Biol. Chem 271, 2221122217.
Garcia-Guzman, M., Dolfi, F., Zeh, K., Vuor, K. (1999). Met-induced JNK activation is mediated by the adapter protein Crk and correlates with the Gab1-Crk signaling complex formation. Oncogene 18, 77757786.[CrossRef][Medline]
Gu, H. and Neel, B. G. (2003). The "Gab" in signal transduction. Trends Cell Biol 13, 122130.[CrossRef][Medline]
Gual, P., Giordano, S., Williams, T. A., Rocchi, S., Van Obberghen, E., Comoglio, P. M. (2000). Sustained recruitment of phospholipase C-gamma to Gab1 is required for HGF-induced branching tubulogenesis. Oncogene 19, 15091518.[CrossRef][Medline]
Holgado-Madruga, M., Emlet, D. R., Moscatello, D. K., Godwin, A. K., Wong, A. J. (1996). A Grb2-associated docking protein in EGF- and insulin-receptor signalling. Nature 379, 560564.[CrossRef][Medline]
Holgado-Madruga, M., Moscatello, D. K., Emlet, D. R., Dieterich, R., Wong, A. J. (1997). Grb2-associated binder-1 mediates phosphatidylinositol 3-kinase activation and the promotion of cell survival by nerve growth factor. Proc. Natl. Acad. Sci. USA 94, 1241912424.
Horiguchi, N., Takayama, H., Toyoda, M., Otsuka, T., Fukusato, T., Merlino, G., Takagi, H., Mori, M. (2002). Hepatocyte growth factor promotes hepatocarcinogenesis through c-Met autocrine activation and enhanced angiogenesis in transgenic mice treated with diethylnitrosamine. Oncogene 21, 17911799.[CrossRef][Medline]
Jeffers, M., Schmidt, L., Nakaigawa, N., Webb, C. P., Weirich, G., Kishida, T., Zbar, B., Vande Woude, G. F. (1997). Activating mutations for the met tyrosine kinase receptor in human cancer. Proc. Natl. Acad. Sci. USA 94, 1144511450.
Kamikura, D. M., Naujokas, M. A., Park, M. (1996). Identification of tyrosine 489 in the carboxy terminus of the Tpr-Met oncoprotein as a major site of autophosphorylation. Biochemistry 35, 10101017.[CrossRef][Medline]
Katso, R., Okkenhaug, K., Ahmadi, K., White, S., Timms, J., Waterfield, M. D. (2001). Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu. Rev. Cell Dev. Biol 17, 615675.[CrossRef][Medline]
Klein, S. L., Strausberg, R. L., Wagner, L., Pontius, J., Clifton, S. W., Richardson, P. (2002). Genetic and genomic tools for Xenopus research: the NIH Xenopus initiative. Dev. Dyn 225, 384391.[CrossRef][Medline]
Koibuchi, N., Kaneda, Y., Taniyama, Y., Matsumoto, K., Nakamura, T., Ogihara, T., Morishita, R. (2004). Essential role of HGF (hepatocyte growth factor) in blood formation in Xenopus. Blood 103, 33203325.
Lamorte, L., Kamikura, D. M., Park, M. (2000). A switch from p130Cas/Crk to Gab1/Crk signaling correlates with anchorage independent growth and JNK activation in cells transformed by the Met receptor oncoprotein. Oncogene 19, 59735981.[CrossRef][Medline]
Lamorte, L., Rodrigues, S., Naujokas, M., Park, M. (2002a). Crk synergizes with epidermal growth factor for epithelial invasion and morphogenesis and is required for the met morphogenic program. J. Biol. Chem 277, 3790437911.