QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 17, Issue 9, 3832-3847, September 2006

This Article Abstract Full Text (PDF) Supplemental Material All Versions of this Article: E06-02-0144v1 17/9/3832    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mercer, K. B. Articles by Benian, G. M. Search for Related Content PubMed PubMed Citation Articles by Mercer, K. B. Articles by Benian, G. M.

Caenorhabditis elegans UNC-96 Is a New Component of M-Lines That Interacts with UNC-98 and Paramyosin and Is Required in Adult Muscle for Assembly and/or Maintenance of Thick Filaments

Kristina B. Mercer^*, Rachel K. Miller^*,, Tina L. Tinley^*,, Seema Sheth^*, Hiroshi Qadota^*, and Guy M. Benian^*

*Department of Pathology and Graduate Division of Biological and Biomedical Sciences, Emory University, Atlanta, GA 30322

Submitted February 17, 2006; Revised May 11, 2006; Accepted June 9, 2006
Monitoring Editor: Thomas Pollard

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
To gain further insight into the molecular architecture, assembly, and maintenance of the sarcomere, we have carried out a molecular analysis of the UNC-96 protein in the muscle of Caenorhabditis elegans. By polarized light microscopy of body wall muscle, unc-96 mutants display reduced myofibrillar organization and characteristic birefringent "needles." By immunofluorescent staining of known myofibril components, unc-96 mutants show major defects in the organization of M-lines and in the localization of a major thick filament component, paramyosin. In unc-96 mutants, the birefringent needles, which contain both UNC-98 and paramyosin, can be suppressed by starvation or by exposure to reduced temperature. UNC-96 is a novel 47-kDa polypeptide that has no recognizable domains. Antibodies generated to UNC-96 localize the protein to the M-line, a region of the sarcomere in which thick filaments are cross-linked. By genetic and biochemical criteria, UNC-96 interacts with UNC-98, a previously described component of M-lines, and paramyosin. Additionally, UNC-96 copurifies with native thick filaments. A model is presented in which UNC-96 is required in adult muscle to promote thick filament assembly and/or maintenance.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The myofibril is a complex assemblage of many proteins, with new components being discovered each year. Despite this growing understanding about myofibrillar components, their interactions, and individual functions, we still know little about the assembly of this precise structure (Gregorio and Antin, 2000). Additionally, it is unclear how this structure is maintained in the face of repeated contraction and relaxation. The need to understand the mechanisms in charge of myofibrillar maintenance is underscored by the clinical significance of degenerative muscular atrophies and myopathies. Caenorhabditis elegans is a particularly attractive organism in which to address these problems (Waterston, 1988; Moerman and Fire, 1997; Moerman and Williams, 2006). We are able to view the muscle in a whole animal system, allowing us to focus on the true, extracellular matrix (ECM) attachment properties of the muscle cell, an evaluation not possible with tissue culture. Because of the optical transparency of the worm, we are able to visualize the myofibrillar structure by polarized light and localize green fluorescent protein (GFP)-tagged proteins in live worms. A major strength of C. elegans lies in its ability to grow quickly and reproduce in large numbers, allowing genetic analyses in a timely and efficient manner. Last, its usual self-fertilization permits propagation of muscle mutants that would otherwise be unable to mate.

In the nematode, most of the muscle is located in the body wall and is used for locomotion. Throughout the muscle cell, the thin filament attachment structures, called dense bodies (analogous to the Z-discs in vertebrate muscle) and the thick filament cross-linking structures, the M-lines, are anchored to the muscle cell membrane. This permits the force of contraction to be transmitted through the cell membrane, the basement membrane, and hypodermis to the overlying cuticle, resulting in movement of the whole animal. Thus, in addition to their roles in attaching thin filaments and cross-linking thick filaments, nematode dense bodies and M-lines are analogous to vertebrate focal adhesion plaques because of their membrane anchorage and composition.

Studies during the past 30 years in over a dozen laboratories have defined many components of C. elegans myofibrils and their membrane–ECM attachment structures. Most of these proteins were first defined through mutations, most falling into one of two phenotypic classes. The first class, the uncoordinated or "Unc" class, has slow moving or paralyzed adults. The second class of mutants, paralyzed arrested at two-fold ("Pat"), has a characteristic embryonic lethality in which embryos do not move within the eggshell and stop development at the twofold stage (Williams and Waterston, 1994). A model for myofibril assembly has been proposed (Williams and Waterston, 1994; Moerman and Williams, 2005) in which assembly is initiated or directed by signals first laid down in the ECM and muscle cell membrane. This is supported by the observation that the Pat mutants showing the greatest degree of disorganization define genes that encode components of the ECM (e.g., UNC-52 [perlecan]) and muscle cell membrane (e.g., PAT-3 [-integrin] and PAT-2 [-integrin]). This model is further supported by immunolocalization studies revealing when and where these proteins are localized in embryonic muscles (Hresko et al., 1994). It has become clear that proteins at the base of dense bodies, that is, at or near the cell membrane, are the same as proteins found at the base of M-lines. However, protein components, specific to each structure, reside more internally (further away from the cell membrane). Thus, in the extracellular matrix, concentrated beneath both dense bodies and M-lines is the nematode homologue of perlecan, UNC-52 (Rogalski et al., 1993). Within the muscle cell membrane, localized at the bases of both dense bodies and M-lines, are the integrins, including PAT-3--integrin (Williams and Waterston, 1994; Gettner et al., 1995) and PAT-2--integrin (Williams, personal communication). Traveling further internally, both dense bodies and M-lines contain talin (Moulder et al., 1996), UNC-97 (mammalian PINCH; Hobert et al., 1999), UNC-112 (Mig-2; Rogalski et al., 2000), PAT-4 (integrin-linked kinase; Mackinnon et al., 2002), PAT-6 (actopaxin; Lin et al., 2003), UNC-98 (Mercer et al., 2003), and UNC-95 (Broday et al., 2004). Vinculin (DEB-1; Barstead and Waterston, 1991) and -actinin (Francis and Waterston, 1985) are found specifically in the dense bodies, whereas UNC-89 is found only in the M-lines (Small et al., 2004). UNC-98 seems to be enriched at the M-lines. Although UNC-98::GFP can be found at both M-lines and dense bodies, anti-UNC-98 antibodies only label the M-lines, unless UNC-98 is overexpressed (Mercer et al., 2003). Most mutants in unc-89 or unc-98 show either a lack of M-lines or short or broken M-lines (Benian et al., 1996; Mercer et al., 2003).

In C. elegans adult body wall muscle, thick filaments are 10 µm in length and are organized around an M-line (Waterston, 1988). The three major components of these thick filaments are myosin heavy chain A (MHC A), myosin heavy chain B (MHC B) and paramyosin, encoded by the genes myo-3, unc-54, and unc-15, respectively (Epstein et al., 1974; Miller et al., 1986; Kagawa et al., 1989). Homodimers of the two myosin heavy chains (Schachat et al., 1978) are differentially localized: MHC A in the center and MHC B in the polar regions (Miller et al., 1983). Paramyosin is primarily an -helical coiled-coil rod and is 38% identical in amino acid sequence to the rod domains of myosin heavy chains. The myosins and a subpopulation of paramyosin are organized around a tubular core (Deitiker and Epstein, 1993). The cores are composed of a distinct subpopulation of paramyosin together with the , , and -filagenins, in a specific geometry (Epstein et al., 1995; Muller et al., 2001). Because myo-3 null mutants do not form thick filaments and are Pat embryonic lethal (Waterston, 1989), MHC A is required for either the initiation or stabilization of thick filament assembly. unc-15 mutants lacking paramyosin have myosin aggregates and form very thin, abnormal filaments, resulting in a severely paralyzed adult animal (Waterston et al., 1977). MHC B is nonessential for thick filament assembly, because unc-54 (MHC B) null mutants can be suppressed by twofold overexpression of MHC A (Riddle and Brenner, 1978; Maruyama et al., 1989). During development, the differential expression of the different filagenin genes seems to be important for the assembly of thick filaments of distinct lengths (Liu et al., 2000). Other components of nematode thick filaments likely include twitchin and UNC-45. Twitchin is a 754,000-Da polypeptide related to mammalian titin and is encoded by the unc-22 gene (Benian et al., 1989, 1993). unc-22 mutants have a characteristic "twitching" phenotype and variably disorganized muscle structure in which thick filaments are present but not organized into A-bands (Waterston et al., 1980; Moerman et al., 1988). Twitchin is localized to the outer portions of A-bands, colocalizing with MHC B (Moerman et al., 1988). Although null mutations of unc-45 result in Pat embryonic lethality, temperature-sensitive missense mutations are Unc adults and show decreased accumulation of thick filaments (Barral et al., 1998). Moreover, in these unc-45 temperature-sensitive mutants, the differential localization of MHC A and B is lost. Biochemically, UNC-45 is a conserved protein that interacts with both Hsp90 and myosin head domains and acts as a chaperone for myosin assembly into thick filaments (Barral et al., 2002). For UNC-45 to function normally, its level has to be tightly regulated by E3/E4 multiubiquitylation (Hoppe et al., 2004).

Here, we report the molecular genetic analysis of UNC-96, a protein required for maintenance of myofibril structure even after myofibrils have been assembled. Specifically, we have found that UNC-96 localizes to the M-line where it is likely to play an important role in A-band integrity. This result is supported by data revealing that UNC-96 interacts with UNC-98 (another M-line component) and paramyosin (a thick filament component) and is present in a preparation of purified thick filaments. We present a model in which UNC-96 is required in adult muscle and acts as both an M-line structural component and as a facilitator of thick filament assembly and/or turnover, through its association with unincorporated paramyosin and UNC-98.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Strains and Genetics
There are three mutant alleles of unc-96: 1) The original allele su151 was described by Zengel and Epstein (1980) and was recovered by a motility selection. When we first obtained unc-96(su151) from the Caenorhabditis Genetics Center, we noted that these worms were obviously slow moving by casual observation. However, after outcrossing twice to wild type, the polarized light defect was retained, but the motility defect was not. Presumably, the original su151 strain had an additional mutation, which caused the slow motility. 2) r291 was isolated by P. Anderson as a suppressor of unc-105 and was kindly sent to us as a presumed allele of unc-89. However, by examining its muscle by polarized light and by complementation testing, we found that r291 is an allele of unc-96. 3) In a polarized light F1 noncomplementation screen using deficiency meDf6, we recovered sf18 by ethyl methanesulfonate (EMS) mutagenesis. All three unc-96 mutant alleles were outcrossed three or more times to wild type before our analysis. To create the trans-heterozygotes between su151 and sf18, or r291 and sf18, we used the sf18 marked in cis- with unc-1(e538). unc-96(sf18) unc-1(e538) animals are easily identified by the "kinker" phenotype of unc-1. Some experiments used unc-98(sf19) (Mercer et al., 2003). unc-98(RNAi) animals and unc-98::gfp translational fusion transgenic animals were also used (described in Mercer et al., 2003). RNA interference (RNAi) by feeding for predicted genes in cosmid F13C5 (see below) was performed in the RNAi-hypersensitive strain rrf-3(pk1426) (Simmer et al., 2002). To generate trans-heterozygotes and double homozygotes between unc-15 and unc-96, we used the following scheme. To follow the unc-96(sf18) phenotype with a dissecting microscope, we used unc-96(sf18) unc-1(e538), as described above. We confirmed that unc-1 has no effect on the muscle phenotype of unc-15(e1215): unc-15(e1215); unc-1(e538) doubles move slowly like unc-15(e1215) and kink like unc-1(e538). Trans-heterozygous unc-15(e1215)/+; unc-96(sf18) unc-1(e538)/+ animals were generated by crossing unc-15(e1215)/+ males with unc-96(sf18) unc-1(e538) homozygous hermaphrodites. One-half of the resulting non-unc-1 progeny are trans-heterozygotes. The unc-1 progeny from the same cross were allowed to self, producing one-quarter unc-15(e1215); unc-96(sf18) unc-1(e538) homozygotes.

Polarized Light Microscopy, Motility Assays, and Electron Microscopy
These were performed as described in Mercer et al. (2003). Polarized light images were obtained with a Zeiss Axioskop microscope (Carl Zeiss, Jena, Germany) on Kodak BW400CN print film, scanned, and processed with Adobe Photoshop (Adobe Systems, Mountain View, CA).

Characterization of the Unc-96 Mutant Phenotype by Using Antibodies to Known Myofibril Components
For most experiments, we used the procedure described in Mercer et al. (2003). The following antibodies were used: monoclonal antibodies (mAbs) (Miller et al., 1983) to myosin heavy chain A (5-6), myosin heavy chain B (5-8), and paramyosin (5-23); a second mAb to paramyosin, Mab 5B5 (Gengyo-Ando and Kagawa, 1991); affinity-purified rat antibodies to UNC-89 (EU133; Small et al., 2004); and affinity-purified rabbit antibodies to UNC-98 (EU131; Mercer et al., 2003). In the anti-UNC-96 staining of unc-98(sf19), we used the immunostaining method of Nonet et al. (1993). Thin filaments were visualized by tetramethylrhodamine-phalloidin staining as described in Ono (2001). Nearly all images were obtained with a Zeiss Axioskop microscope using Fuji Sensia 100 slide film and scanned and processed with Adobe Photoshop. For determining the dependence of UNC-96 localization on the presence of paramyosin, we costained either wild-type or unc-15(e1214) null animals with anti-UNC-96 (EU148 at 1:100) and anti--actinin (MH35 at 1:200; Francis and Waterston, 1985). Images depicting dual antibody localization were captured with a scientific-grade cooled charge-coupled device (Cool-Snap HQ with ORCA-ER chip) on a multiwavelength, wide-field, three-dimensional microscopy system (Intelligent Imaging Innovations, Denver, CO). Samples were imaged in successive 0.2-µm focal planes, and out-of-focus light was removed using the constrained iterative deconvolution algorithm (Weiner et al., 1999). Images were processed using Adobe Photoshop software.

Method of Starvation
Escherichia coli strain OP50 seeded NGM plates, containing nearly starved sf18 and r291 adult animals, were rinsed three times with M9 buffer. Worms were then transferred to an unseeded NGM plate for 24 or more hours, before being viewed by polarized light. For the motility assays of starved sf18 and N2, similarly staged animals (young adults) were picked to a small unseeded NGM plate, rinsed three times in M9, and transferred to new unseeded NGM plate. A chunk of NGM plus OP50 was placed on the lid of the Petri dish to prevent the worms from crawling off the plate or under the agar.

Genetic Mapping and Molecular Cloning of unc-96
By three-factor mapping with unc-1(e1598n1201) and dpy-3(e27), we were able to place unc-96 to the left of unc-1. Although we were never able to definitively determine the left/right positioning of unc-96 relative to egl-17, recombinant data suggested that unc-96 resides in a cosmid close to F38G1 (containing egl-17). We used single nucleotide polymorphism (SNP) mapping (Hill et al., 2000) to narrow down a region of more than 20 overlapping cosmid clones lying to the right of F38G1. Mating of the C. elegans Hawaiian strain to an unc-96 unc-1 dpy-3 triple resulted in a number of non-Unc-96, non-Unc-1 Dpy-3 recombinants. Sequencing of confirmed SNPs lying to the left of dpy-3, revealed that unc-96 lies within or to the left of cosmid F02G3. We then tested several cosmids lying to the left of F02G3 for their ability to rescue the Unc-96 phenotype in transgenic animals. (Cosmid DNAs were prepared using a QIAGEN Plasmid Maxiprep kit; QIAGEN, Valencia, CA). Cosmid F13C5 gave transgenic rescue. RNAi was then performed for all six predicted genes in F13C5 using clones from the Ahringer library (available from GeneService, Cambridge, United Kingdom) and a feeding procedure essentially as described in Kamath and Ahringer (2003). Worms fed bacteria producing double-stranded RNA (dsRNA) for F13C5.6 resulted in the Unc-96 polarized light phenotype.

Sequencing of unc-96 Mutants and cDNAs, and Production of Recombinant UNC-96 Protein
To determine the mutation sites, we first prepared genomic DNA from each of the three mutant alleles (by phenol/chloroform extraction). We designed primers to amplify genomic sequence of less than or equal to 1 kb that included exonic sequences and 50–100 base pairs of flanking intronic sequences. In most cases, the primers used to amplify were also used as sequencing primers. All mutation sites were confirmed by a second, opposite direction read.

Forward primer ACTGGTCGACTGATGAGTGAAACTGAAGATGTG and reverse primer TTATGCGGCCGCGTCATCTAATGGGTCTTCATA were used to amplify full-length unc-96 cDNAs (using Triple Master; Eppendorf, Westbury, NY), beginning with a cDNA pool as template. The resulting PCR products were digested with restriction enzymes SalI and NotI and ligated into pET24a (Novagen/EMD Biosciences, San Diego, CA). Multiple clones were sequenced, verifying the presence of two isoforms and cDNA sequence as predicted by WormBase. An error-free clone containing cDNA sequence from the shorter isoform (WormBase, F13C5.6a) was transformed into BL21 codon plus (DE3) RIL competent cells (Stratagene, La Jolla, CA). Expression and purification of His-tagged UNC-96 was accomplished by using the His bind column system (Novagen/EMD Biosciences).

Generation of Transgenic Lines Carrying unc-96::gfp
To obtain full-length, genomic sequence for unc-96, two PCR products were created and ligated within intronic sequence, resulting in a final, 11.8-kb fragment of DNA. Product 1 containing 2 kb of presumed promoter sequence upstream of the initiator methionine and the 5' half of unc-96 coding sequence (5.8 kb) was created using forward primer ATCAGTCGACTTGGAGCCTTATGAAGCTAAAATG and reverse primer TAATGCGGCCGCTTATCTTAGTTGGTAGTGGTCAG. Product 2 containing the 3' half of unc-96 (6 kb), including the last codon before the unc-96 stop codon, was created using forward primer ATTAGCGGCCGCAAACAATGTTGCCAAACTATAGTG and reverse primer TGATGGATCCGTCATCTAATGGGTCTTCATAATC. The PCR products were digested with restriction enzyme pairs SalI/NotI and NotI/BamHI, respectively. Both fragments were placed together in a ligation reaction with promotorless vector pPD95.77 (kindly provided by Andy Fire, Stanford University, Stanford, CA), and transformed into E. coli strain XL1 Blue. Plasmid clones were sequenced at their ends to verify proper left/right positioning of the insert within the vector. The resulting construct is expected to express, using the normal unc-96 promoter, a full-length UNC-96 protein, with GFP fused at its C terminus. A single clone was injected (10–40 ng/µl) along with rol-6 (80 ng/µl), resulting in three transgenic lines. The same injection mix was injected into unc-96(sf18), and the resulting transgenic lines were rescued for the Unc-96 phenotype. An independent construct was also able to rescue unc-96. Images of GFP fluorescence in adult body wall and pharyngeal muscle were obtained with a Zeiss Axioskop microscope on Fuji Sensia 100 slide film, scanned, and processed using Adobe Photoshop. Polarized light images of the rescued animals were obtained as described above.

Analysis of UNC-96 Protein Sequence
The full-length protein sequence for both forms of UNC-96 (418 and 408 aa) were analyzed using programs for domain prediction and sequence similarities available at the following Web sites: 1) Pfam, http://www.sanger.ac.uk/Software/Pfam/; 2) BLAST, http://www.ncbi.nlm.nih.gov/BLAST/using blastp and search for short, nearly exact matches; and 3) Motif Scan http://myhits.isb-sib.ch/cgi-bin/motif_scan. The amino acid composition of UNC-96 was compared with the "average" amino acid composition of the entire C. elegans proteome as calculated by Ter-Hovhannisyan and Borodovsky (personal communication).

Generation of anti-UNC-96 antibodies, Western Blots, and Immunofluorescence Microscopy
Polyacrylamide gel slices containing the 6His-tagged UNC-96 protein were supplied to Spring Valley Laboratories (Woodbine, MD) for generation of rabbit antibodies (EU148). Resulting antibodies were affinity purified using an Affigel (Bio-Rad, Hercules, CA) matrix to which the His-tagged UNC-96 protein had been covalently coupled. Extracts of Laemmli-soluble proteins from wild type and the three unc-96 mutant alleles were prepared by the method of Hannak et al. (2002). The protein concentrations of these extracts were determined by the filter paper dye-binding method of Minamide and Bamburg (1990). A Western blot was reacted with affinity-purified anti-UNC-96 at a 1:200 dilution and visualized by enhanced chemiluminescence (ECL) (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom). These same antibodies were used to localize UNC-96 in both embryonic and adult muscle. For localization in embryos, we used the method described in Soto et al. (2002) with the following modifications: after methanol/acetone fixation, the embryos were gradually rehydrated through a series of solutions of decreasing acetone concentration, and phosphate-buffered saline was substituted for Tris buffer throughout the procedure. Anti-UNC-96 was used at 1:100 dilution and costained with anti-MHC A 5-6 at 1:400 dilution. Images were captured with a Bio-Rad Radiance model 2100 confocal microscopy system and displayed using LaserSharp2000 software. For localization in adult muscles, we used the method described in Mercer et al. (2003). Anti-UNC-96 was used at 1:100 dilution and costained with monoclonal antibodies (MH42; Benian et al., 1996) to UNC-89 at 1:200 dilution. Images were acquired with a scientific-grade cooled charge-coupled device (Cool-Snap HQ with ORCA-ER chip) on a multiwavelength, wide-field, three-dimensional microscopy system (Intelligent Imaging Innovation).

Detection of UNC-96 within Thick Filaments
Thick filament preparations from wild-type strain N2 animals were performed as described previously (Epstein et al., 1988; Deitiker and Epstein, 1993). Proteins isolated at each step of the thick filament purification (Figure 12A) were separated on a 4–15% gradient SDS-PAGE gel and transferred to nitrocellulose membrane. The immunoblot was exposed to anti-UNC-96 antibodies (affinity-purified EU148) at a dilution of 1:100. The reaction was detected by ECL Advanced (GE Healthcare). The supernatant from the 5000 x g spin of the thick filament preparation was loaded on an 18-ml 19–38% sucrose gradient in a 1 x 3.5-in., 38.5-ml Beckman polyallomer centrifuge tube. The gradient was centrifuged at 6150 x g in a SW28 rotor for 16 h 20 min at 4°C. Fractions were collected from the bottom of the gradient. Sucrose gradient fractions were pooled as follows: S1-5, S6-10, and S11-14. These pooled fractions were dialyzed against 10 mM NaPO₄, pH 6.36. One volume of ice-cold 95% ethanol was added to each fraction pool. Precipitated proteins were pelleted by centrifuging at 12,000 x g at 4°C for 20 min. The pellets were air-dried at room temperature and suspended in 200 µl of 2x Laemmli sample buffer. The proteins of the fractions were then separated on two 4–15% SDS-PAGE gels. One gel was Coomassie stained. The other was immunoblotted. UNC-96 was detected with anti-UNC-96 antibodies as described above.

Two-Hybrid Experiments
The UNC-96 cDNA fragments were cloned into pGBDU vectors (James et al., 1996), resulting in plasmids expressing UNC-96 fused to the DNA binding domain of Gal4 (bait). The UNC-98 cDNA fragments (described in Mercer et al., 2003) were cloned into pGAD vectors (James et al., 1996), resulting in plasmids expressing UNC-98 fused to activator domain of Gal4 (prey). The UNC-96 bait and UNC-98 prey plasmids were transformed into PJ69-4A yeast cells (James et al., 1996) using the lithium acetate method (Ito et al., 1983). Yeast two-hybrid assays were performed as described in Mackinnon et al. (2002).

The UNC-96 (1-200 aa) and UNC-96 (201-418 aa) cDNA fragments were amplified by using the following combination of primers: U96-1 (CGCGCCCCGGGATGAGTGAAACTGAAGATGTG) and U96-4 (GCGCGGTCGACTTAAGAACCAGCATTAAACATATT) for 1–200 aa and U96-6 (CGCGCCCCGGGGGTCCATATGCAGCGCCTGCA) and U96–2 (GCGCGGTCGACTTAGTCATCTAATGGGTCTTC) for 201-418 aa. Error-free cDNAs were cloned into pGBDU-C1 using SmaI and SalI sites, resulting in pGBDU96-14 and pGBDU96-62, respectively. To clone UNC-96 (45-418 aa) cDNA fragments, the XhoI fragment of H11-10 (Tsuboi et al., 2002) was cloned into pGBDU-C2.

Far Western
A far Western was conducted as follows. To prepare a maltose binding protein (MBP) fusion protein for the C-terminal half of UNC-96, the clone insert from pGBDU96-62 (described above) was excised and cloned into pMAL-KK1 vector (kindly provided by Dr. K. Kaibuchi, Nagoya University, Nagoya, Japan) (resulting protein named 96MBP). pMAL-KK1 with no insert was used to make MBP alone. Full-length UNC-98 with a 6His tag (98His) was made using full-length unc-98 cDNA cloned into pET-24a (Novagen); construction details to be described elsewhere. The clones were transformed into BL21 codon plus (DE3) RIL cells (Stratagene), and protein expression was induced with isopropyl -D-thiogalactoside (1 mM final). The proteins were isolated by cell lysis (described above). Both MBP and 96MBP were dialyzed overnight in 20 mM Tris, pH 7.4, and 100 µM ZnSO₄. ZnSO₄ was found to reduce the degradation of 96MBP. 98His was dialyzed overnight in 50 mM Tris, pH 7.5. Then, 5 µg of 98His was run per lane on a 10% acrylamide SDS gel and transferred to nitrocellulose. Strips containing the 98His were blocked in milk Tris-buffered saline (TBS)-T for 1 h and then soaked with either MBP (5 µg/ml in milk TBS-T) or 96MBP (5 µg/ml in milk TBS-T) overnight at 4°C. After rinsing in TBS-T, the blots were incubated for 40 min with horseradish peroxidase (HRP)-conjugated anti-MBP (1:5000; New England Biolabs, Beverly, MA), and the reactions were visualized by ECL (GE Healthcare). 2.5 µg of 98His, MBP, and 96MBP were run on a 10% acrylamide and stained with Coomassie.

Enzyme-linked Immunosorbent Assay (ELISA) Showing Binding between Paramyosin and UNC-96
Paramyosin was purified from a population of wild-type worms of mixed developmental stages using the method of Waterston et al. (1974). His-tagged UNC-96 was prepared as described above. The Bio-Rad Bradford-based protein assay was used to determine the concentrations of His-tagged UNC-96 and paramyosin. The following steps were followed in performing an ELISA: 1) Paramyosin was coated on Corning polystyrene microtiter plates (catalog no. 3591; Corning Life Sciences, Acton, MA) at a concentration of 0.5 µM, at 100 µl per well in 10 mM NaPO₄, pH 7.6, 0.6 M NaCl, and incubated at 4°C overnight. 2) Wells were coated with blocking buffer (0.2% bovine serum albumin [BSA], 100 mM KCl, 10 mM Tris, pH 8.0, and 0.05% Tween 20) for 1.5 h at room temperature. 3) Wells were washed three times with wash buffer (the same as blocking buffer, without BSA) and vacuum aspirated. 4) One hundred microliters of His-tagged UNC-96 protein was added to the wells at concentrations between 0 and 0.5 µM and incubated for 1 h at room temperature. 5) The washing procedure was repeated. 6) The wells were coated with 75 µl of anti-6His antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:200 dilution in blocking buffer for 45 min at 37°C. 7) The washing procedure was repeated. 8) The wells were incubated with 50 µl of donkey anti-rabbit-HRP antibody (GE Healthcare) at a 1:1000 dilution for 45 min at 37°C. (9) The washing procedure was repeated. 10) Wells were coated with 100 µl of mixed TMB solution (BD Biosciences, San Jose, CA), and the plate was incubated in the dark at room temperature for 20 min. 11) The absorbances were recorded at 650 nm using a Synergy (Reading, PA) HT multi-detection microplate reader with KC4 data analysis software. A control for nonspecific binding of UNC-96 to BSA was performed. The best fit ligand binding curves were determined by plotting means and standard deviations of absorbance values (Sigma Plot 9.0; SPSS, Chicago, IL).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The unc-96 Mutant Phenotype
Because of the optical transparency and anatomical simplicity of C. elegans, polarized light microscopy is a convenient means of assessing the organization of the myofilament lattice of body wall muscle cells. As shown in Figure 1A, polarized light reveals wild-type muscle to be a highly organized structure in which bright A-bands alternate with dark I-bands. As first reported in Zengel and Epstein (1980), unc-96(su151) has a much less regular pattern of A- and I-bands and "discrete birefringent needles near the ends of the body wall muscle cells." To gain further understanding about the unc-96 mutant phenotype, we identified two additional unc-96 mutant alleles, r291 and sf18. r291 was isolated as a suppressor of unc-105 by Anderson (personal communication), and by complementation testing we found that r291 is an allele of unc-96. We recovered sf18 after EMS mutagenesis by a polarized light F1 noncomplementation screen using a deficiency (meDf6). Both unc-96(r291) and unc-96(sf18) have a polarized light appearance identical to that of the original allele, su151 (Figure 1A).

View larger version (62K): [in this window] [in a new window]   Figure 1. unc-96 mutants are defective in muscle structure and motility. (A) Polarized light microscopy of adult body wall muscle. In muscle from wild type, note the regular striated pattern of bright A-bands alternating with dark I-bands. In muscle from the three unc-96 mutants and the F13C5.6 (RNAi) animals, note the reduced level of organization and appearance of birefringent needles at the ends of the muscle cells. The Unc-96 phenotype can be seen in the young adult worms (P0) fed F13C5.6 (unc-96) dsRNA for 48 h, indicating a requirement for new UNC-96 synthesis in adult worms. Rescue of the Unc-96 phenotype is achieved using an extrachromosomal array containing the putative promotor sequence and complete coding sequence of F13C5.6 (unc-96) translationally fused to GFP. Bar, 20 µm. (B) Motility assays on adult worms of the indicated genotypes. Data are shown as means and SEs with n = 25–50.

To further characterize the structural defect in adult unc-96 mutant muscle, we used immunofluorescent microscopy to localize a number of known myofibril components. We obtained similar results with all three mutant alleles. As shown in Figure 2, unc-96 mutants display only slight abnormalities in the organization of myosin heavy chains A and B (MHC A and MHC B) and F-actin, but they display significant abnormalities in the organization of UNC-89 and paramyosin. UNC-89 is actually a set of six different polypeptides all localized to the M-line region (Small et al., 2004; Ferrara et al., 2005). Paramyosin is an invertebrate-specific coiled-coil rod protein, similar to the rod portion of myosin heavy chains, and is located in the center of thick filaments (Epstein et al., 1985; Kagawa et al., 1989). Instead of the regular, continuous and linear localization in wild type, in unc-96, UNC-89 localizes to noticeably shorter, discontinuous lines. In unc-96 mutants, paramyosin not only localizes normally to A-bands but also localizes abnormally as accumulations at the ends of the muscle cells. Presumably, these accumulations correspond to the birefringent needles observed by polarized light. Identical anti-paramyosin localization was found with two, independently generated monoclonal antibodies, 5-23 (Miller et al., 1983) and Mab 5B5 (Gengyo-Ando and Kagawa, 1991); in Figure 2, results of 5-23 staining are shown. Immunostaining of unc-96 mutants for vinculin and -actinin, major components of dense bodies, also reveals a somewhat abnormal staining pattern with -actinin being more strongly affected (our unpublished data). Thus, the unc-96 phenotype involves major disruptions of M-lines and the localization of paramyosin and also minor abnormalities in dense bodies, I-bands, and A-bands.

View larger version (97K): [in this window] [in a new window]   Figure 2. Immunofluorescent localization of myofibril components in wild-type and unc-96 mutant muscle. Antibodies for thick filament proteins (MHC A, MHC B, and paramyosin), an M-line protein (UNC-89), or phalloidin for staining the F-actin in thin filaments were used. unc-96 mutants show minor disruptions in the organization of MHC A, MHC B, and F-actin but severe disorganization of UNC-89. unc-96 mutants also display an abnormal staining pattern with antibodies to paramyosin: although some paramyosin is normally localized to A-bands, much paramyosin is found in accumulations located at the ends of the muscle cells. Bar, 10 µm.

View larger version (115K): [in this window] [in a new window]   Figure 3. Myofibrillar structure but not motility of unc-96 mutants is suppressed by lower temperature, and both myofibrillar structure and motility of unc-96 mutants are suppressed by starvation. (A and B) Polarized light microscopy of body wall muscle of adult unc-96 mutants of the indicated genotypes at the indicated growth conditions. Notice that at the standard growth temperature for C. elegans in the laboratory, 20°C, the typical phenotype of reduced myofibrillar organization and birefringent needles is evident. However, when grown from the embryonic stage at the reduced temperature, 15°C, there are fewer needles, and those that are present, are thinner. When r291 was grown at this temperature, there is almost a complete loss of needles. This suppression of the needle phenotype is found even when the shift to lower temperature (for 24 h) is delayed until the young adult (YA) stage. Greater improvement in muscle structure is obtained if young adults are deprived of E. coli food (starve) for 24 h (at 20°C). Similar results from reduced temperature or starvation were obtained with the third allele, su151 (our unpublished data). (C) Motility assays on adult worms of unc-96(sf18) and wild type (wt) under the indicated growth conditions (standard, 20°C; growth at 15°C from the embryonic stage; food deprivation for 24 h beginning as young adults). Note that lower temperature does not improve the motility of sf18 animals to wild-type levels. Significantly, starvation improves the motility of both wild-type and sf18 animals. Numbers are expressed as means with SEs and n = 20–50 for all genotypes and experiments. (D) Colabeling of anti-UNC-89 and anti-paramyosin antibodies in body wall muscle of a young adult unc-96(sf18) that had been deprived of food (starve) for the prior 24 h. Note the greatly improved muscle structure, including more organized M-lines (UNC-89) and the absence of abnormally localized paramyosin in distinct accumulations. (E) Polarized light microscopy demonstrating that previously starved unc-96(sf18) animals show restoration of the Unc-96 needle phenotype upon reexposure to food.

Molecular Cloning of the unc-96 Gene
A combination of three factor and SNP mapping was used to limit unc-96 to a set of eight overlapping cosmids and one short YAC clone spanning from F38G1 on the left to F02G3 on the right (Figure 4 and Materials and Methods for details). We then tested for the ability of these cosmids to rescue the Unc-96 phenotype when carried as transgenic arrays. One of these eight cosmids, F13C5, gave phenotypic rescue. Next, RNAi was performed for each of the six genes predicted on WormBase as being encoded by the F13C5 sequence. RNAi for one of these genes, F13C5.6, phenocopied the distinctive polarized light "needle phenotype" of an unc-96 mutant (Figure 1A). This single gene, fused at its 3' end to the coding sequence of GFP, also rescued the Unc-96 mutant phenotype (Figure 1A).

View larger version (18K): [in this window] [in a new window]   Figure 4. Molecular cloning of unc-96 and the sequence alterations in three unc-96 mutants. Genetic and physical map of the unc-96 region on the left arm of linkage group X. Three factor mapping placed unc-96 to the left of unc-1. SNP mapping placed unc-96 further to the left, within or to the left of cosmid F02G3. DNA from cosmids lying to the left of F02G3 and right of egl-17 were injected into unc-96(sf18) animals, and this resulted in identifying a single cosmid, F13C5, capable of rescuing the Unc-96 mutant phenotype. The six predicted genes in this cosmid sequence were tested by feeding RNAi. F13C5.6 (RNAi) gave a polarized light phenotype similar to that of unc-96(sf18). Sequencing of the three alleles revealed that r291 and su151 have GT to AT changes that disrupt normal splice donor sites and that sf18 has a nonsense codon in exon 9.

During the course of our RNAi experiments, we noticed that the Unc-96 phenotype could be seen in the P₀ animals that were fed bacteria producing unc-96 dsRNA. As shown in Figure 1A, young adult animals feeding on the unc-96 RNAi bacteria for 48 h show the characteristic needles of unc-96 mutants. During this 48-h period, the young adult matures into an older adult, its body mass increases, and the length and size of its myofibrils increase. Because we observe the unc-96 mutant phenotype, we know that unc-96 mRNAs are being degraded. Thus, we conclude that newly synthesized unc-96 mRNA and protein are required for myofibril assembly in adults.

UNC-96 Exists in Two Isoforms, 408 or 418 Residues, and Has No Recognizable Domains
As predicted on WormBase, and confirmed by our cDNA sequence analysis, there are at least two mRNAs from the unc-96 gene, designated unc-96A and unc-96B. These are generated by exclusion or inclusion, respectively, of an alternative exon near the 3' end of the gene, which encodes 10 amino acid residues (Figure 5). The largest UNC-96 polypeptide is 418 amino acids long (Figure 5) and has a calculated molecular mass of 47,886 Da, and a calculated pI of 5.86. The sequence has a reduced percentage of hydrophobic residues (25.6% compared with the average C. elegans protein, which is 33.1%) and has an increased percentage of charged residues (35.7% compared with 31.3%). The sequence is particularly enriched for aspartate at 8.4%, proline at 7.9%, arginine at 9.6%, and serine at 11.5%, compared with the average C. elegans protein, which has aspartate at 5.4%, proline at 5.0%, arginine at 5.3%, and serine at 8.1%. Computer programs have failed to reveal any recognizable protein domains in the UNC-96 sequence. Nevertheless, BLAST searches have revealed high level, nearly exact matches, spanning 13 or 14 residues between UNC-96 and two mammalian proteins of yet unknown function (Figure 5). Similarity spans across species, especially for the sequence similar to the human sequence Hs FLJ00128, which is found in five other mammals. Perhaps these short stretches of homology reflect conserved structures, or binding sites, not yet assigned functional significance.

View larger version (65K): [in this window] [in a new window]   Figure 5. Amino acid sequence of UNC-96. High-level, nearly exact matches spanning 13 or 14 residues were found to two mammalian proteins of unknown function (Hs FLJ00128, accession no. BAB84883 and Hs ZNF480, accession no. AAR97581). Note that two isoforms of UNC-96, A and B, differ by 10 residues, boxed in red, and are encoded by an alternatively spliced exon (confirmed by cDNA sequences). Highlighted are residues each of which are represented 3–4% higher than in the average C. elegans protein (D, P, R, and S).

View larger version (40K): [in this window] [in a new window]   Figure 6. By Western blot, anti-UNC-96 antibodies detect a polypeptide of expected size from wild type (wt), which is absent or in reduced amounts from unc-96 mutants. Western blot of whole worm extracts from wild type (wt), r291, su151, and sf18 reacted with affinity-purified antibodies to UNC-96 shows an 47-kDa polypeptide (expected size) from wild type only. The black horizontal lines with numbers denote the positions of molecular weight markers of the indicated sizes in kilodaltons. The lane to the left of the marker lane depicts results from unc-96(r291) after a longer exposure to film; note the presence of a band at the same size as detected from wild type. This is interpreted as a small amount of full length UNC-96 protein expressed in this splice donor mutant, r291. The other bands are presumed to be cross-reacting, because they are also seen in wt, su151, and sf18 at this longer exposure (our unpublished data).

View larger version (55K): [in this window] [in a new window]   Figure 7. Localization of anti-UNC-96 antibodies and UNC-96::GFP in adult muscles. (A) Localization of anti-UNC-96 antibodies in adult body wall and pharyngeal and anal depressor muscle. The top three panels show portions of two body wall muscle cells simultaneously stained with anti-UNC-96 and a known marker of M-lines, anti-UNC-89. UNC-96 resides in M-lines, but it does not seem to completely colocalize with UNC-89. The fourth panel shows that UNC-96 is expressed in the pharyngeal muscles (anterior, right; posterior, left). The fifth panel shows optical cross sections through a worm at the level of the terminal bulb of the pharynx stained with anti-UNC-96 and anti-UNC-89. The outer ring of staining is from the four body wall muscle quadrants, and the inner ring of staining is from the terminal bulb muscles. As shown previously for UNC-89, UNC-96 also localizes to the middle of the single sarcomere pharyngeal muscles. The sixth panel shows the tail region of a worm costained with antibodies to UNC-96 and UNC-89. UNC-96 resides in the middle of the single sarcomere anal depressor muscles (one dorsal, one ventral). (B) Localization of UNC-96::GFP. Top, body wall muscle; bottom, pharyngeal muscle. In body wall muscles, UNC-96::GFP is located at M-lines, like the antibodies, but, in addition, is also located at dense bodies. In pharyngeal muscles, UNC-96::GFP is localized similarly to the localization of UNC-96 antibodies.

UNC-96 Is Expressed in Embryonic Body Wall and Pharyngeal Muscle
Embryos were costained with anti-UNC-96 and anti-MHC A. As shown in Figure 8, UNC-96 is first detectable at the 1.5-fold stage, in which UNC-96, like MHC A, is diffusely localized in the cytoplasm of body wall muscle cells. It has been established that at the 1.5-fold stage, nascent linear structures containing MHC A, MHC B, and paramyosin are present, but myofibrils have not yet formed (Epstein et al., 1993). By the threefold stage, UNC-96, with the use of our antibodies, is undetectable in body wall muscle, but it can be seen very prominently in embryonic pharyngeal muscle (Figure 8).

View larger version (59K): [in this window] [in a new window]   Figure 8. Localization of anti-UNC-96 antibodies in embryonic muscles. Embryos were costained with anti-UNC-96 and anti-MHC A. As shown in the top panel, UNC-96 is first detectable at the 1.5-fold embryonic stage, in which UNC-96, like myosin heavy chain A, is localized to the cytoplasm of body wall muscle cells. As shown in the bottom panel, by the threefold stage, UNC-96 is almost undetectable in body wall muscle cells, but it is prominently found in the pharyngeal muscles.

View larger version (94K): [in this window] [in a new window]   Figure 9. Genetic interaction between unc-96 and unc-98. (A) Polarized light microscopy of body wall muscle from animals with the indicated genotypes. The top panel shows muscle from an animal that has undergone RNAi for unc-96. The second panel shows muscle from unc-98(sf19). Loss of function for unc-98 results in a phenotype nearly identical to unc-96. The third panel shows an unc-98(sf19) worm that has undergone RNAi for unc-96. Note that in this animal, there is no worsening in phenotype as compared with loss-of-function for unc-96 or unc-98, alone. The fourth panel shows an unc-96(sf18) animal that is expressing UNC-98::GFP from a transgene. The fifth panel shows an unc-98(sf19) worm that is expressing UNC-96::GFP from a transgene. Note that there is worsening of phenotype (greater degree of myofibril disorganization, larger and brighter needles) in either unc-96(sf18) animals with increased expression of UNC-98, or unc-98(sf19) animals with increased expression of UNC-96. (B) Immunofluorescence localization of UNC-98 and UNC-96. Distinct accumulations at the ends of muscle cells in unc-96 mutants contain UNC-98 protein (top). Similarly, accumulations in unc-98 mutants contain UNC-96 protein (bottom).

Consistent with the idea that unc-96 and unc-98 interact genetically, we found that, antibodies against UNC-98 stain distinct accumulations in unc-96 mutants, and antibodies against UNC-96 stain accumulations in unc-98 mutants (Figure 9B). In each case, the location (ends of muscle cells) and shape of these accumulations is similar to the birefringent needles seen by polarized light in each mutant.

UNC-96 Interacts with UNC-98 by Yeast Two-Hybrid Assay and In Vitro
Because unc-96 and unc-98 interact genetically, we sought to determine whether the two proteins are able to interact biochemically. We performed a yeast two-hybrid assay by using varying length constructs of UNC-96 as bait to evaluate the ability of the truncated proteins to interact with full-length UNC-98 (as the prey). We found that the C-terminal half of UNC-96 (201-418 aa) was capable of an interaction with full-length UNC-98. A nearly full-length product of UNC-96 (45-418 aa), which contains the aforementioned C-terminal region, was unable to interact with full-length UNC-98 (Figure 10A). This suggests that the N-terminal half of UNC-96 may inhibit the interaction between UNC-96 and UNC-98, in this assay. Next, we investigated which portions of UNC-98 were important for this protein–protein interaction. The data suggest that all four zinc fingers of UNC-98 are necessary and sufficient for the strongest interaction between UNC-98 and UNC-96 (201-418 aa) (Figure 10B, construct A). Additionally, the nonzinc finger N-terminal region of UNC-98 is not necessary for interaction. The last three zinc fingers were sufficient for a weaker level interaction (as evident by low-level yeast growth, construct B). However, loss of either zinc finger 2 (construct C) or zinc finger 4 (construct D), independently, resulted in a lack of interaction. Because neither zinc finger alone was sufficient for an interaction, the results underline the importance of having both, and possibly the third, zinc fingers to obtain an interaction between the two proteins.

View larger version (29K): [in this window] [in a new window]   Figure 10. UNC-96 interacts with UNC-98 by yeast two-hybrid and far Western assays. (A) Mapping of the binding site in UNC-96 for UNC-98. The UNC-96 protein is represented as a long yellow colored rectangle with amino acid numbers beneath. The three rows of rectangles represent the portions of UNC-96 that were tested for binding to UNC-98 (full-length) by the two-hybrid assay. The green colored rectangle represents the smallest fragment that showed binding to UNC-98. "Binding to UNC-98 (full-length)" columns show results of binding. A + means growth on the selection media, and – means no growth on the selection media. (B) Mapping of the binding site in UNC-98 for UNC-96. The UNC-98 protein is represented as a long rectangle with amino acid numbers beneath. The red and orange boxes denote the C2H2 zinc fingers, green boxes denote predicted NLS, and blue boxes denote predicted nuclear export signal sequences (one lies within the first zinc finger). The five rows of rectangles represent the portions of UNC-98 (Mercer et al., 2003) that were tested for binding to UNC-96 (201-418) by the two-hybrid assay. The green-colored rectangles represent the fragments that showed strong binding to UNC-96 (201-418), and yellow-green–colored rectangle represents the fragment that showed weak binding to UNC-96 (201-418). The "Binding to UNC-96 (201-418)" columns show results of binding. A + means growth on the selection media, ± means weak growth on the selection media, and – means no growth on the selection media. Photos of yeast cells show growth on selection media (three independent colonies are shown for each). (C) The C-terminal half of UNC-96 interacts with UNC-98 by the far Western assay. On the right is a Coomassie-stained SDS-PAGE of the starting materials, full-length UNC-98 with a 6His tag (98His), MBP, and UNC-96 (201-418) fused to MBP (96MBP). On the left is the far Western: a gel similar to the one on the right was used to separate 98His, and the protein was transferred to a membrane. Next, one blot strip was incubated with MBP, and another was incubated with 96MBP, washed, and each was incubated with antibodies to MBP conjugated to horseradish peroxidase (anti-MBP/HRP). Reactions were visualized by ECL. Note that 96MBP but not MBP interacts with 98His.

unc-96 and unc-15 Interact Genetically; UNC-96 and Paramyosin Interact Biochemically
Given the localization of paramyosin to accumulations in unc-96 mutants (Figure 2), we sought to determine whether UNC-96 and paramyosin interact. We found that unc-96 and unc-15, the structural gene for paramyosin, interact genetically both as trans-heterozygotes and as double homozygotes. For this purpose, we used a mild allele of unc-15, e1215. Although unc-96(sf18)/+ has a normal muscle structure by polarized light, and unc-15(e1215)/+ has only a mildly disorganized muscle structure by polarized light, the compound heterozygote, unc-15(e1215)/+; unc-96(sf18)/+, displays enhanced disorganization of muscle structure, similar to that of the unc-96(sf18) homozygote (Supplemental Figure 2). unc-15(e1215) homozygotes are significantly slower than wild type but show normal posture. unc-96(sf18) homozygotes are slightly slower than wild type and also show normal posture. However, the double mutant, unc-15(e1215); unc-96(sf18) is completely paralyzed and has an abnormal "folded-up" posture (Figure 11A). This folded paralysis is seen beginning at the L1 larval stage, but growth continues in the same paralyzed state until adulthood. We next reasoned that if UNC-96 normally interacts with paramyosin, then in the absence of paramyosin, UNC-96 localization should be disrupted. As shown in Figure 11B, in muscle from the unc-15 null allele, e1214, UNC-96 is not localized to the M-lines and is present, diffusely, at low levels in the muscle cells. Because of our results showing an interaction between paramyosin and UNC-96 in vivo, we wondered whether a direct interaction could be demonstrated in vitro. For this purpose, we purified paramyosin from wild-type worms and expressed full-length UNC-96 as a His-tagged protein (Figure 11C, left). In an ELISA experiment, we could demonstrate saturable binding of UNC-96 to paramyosin but not to BSA (Figure 11C, right).

View larger version (73K): [in this window] [in a new window]   Figure 11. unc-96 and unc-15 interact genetically. UNC-96 and paramyosin interact biochemically. (A) The homozygous mutant, unc-15(e1215); unc-96(sf18) unc-1(e538) shows an enhanced phenotype compared with the single mutants, unc-15(e1215), unc-96(sf18) unc-1(e538), and unc-15(e1215); unc-1(e538). unc-15(e1215), unc-96(sf18) unc-1(e538), and unc-15(e1215); unc-1(e538) are slightly slower than wild type. As shown in panel 2, the double mutant unc-15(e1215); unc-96(sf18) unc-1(e538) is completely paralyzed in an unusually folded posture. Bar, 0.1 mm. (B) UNC-96 is mislocalized in body wall muscle cells lacking paramyosin. The top panel shows the localization of UNC-96 to M-lines in wild-type muscle. The bottom panel shows that UNC-96 is weak and diffuse in muscle from the paramyosin null mutant unc-15(e1214). Staining of -actinin, a major component of dense bodies, was used to locate muscle cells due to the very weak staining of anti-UNC-96 in the paramyosin null. Some secondary disorganization of dense bodies can be seen in unc-15(e1214). Bar, 5 µm. (C) By ELISA, UNC-96 binds to paramyosin in a saturable manner. The left two panels show a Coomassie-stained SDS-PAGE of purified paramyosin (PM) and bacterially expressed His-tagged UNC-96 with Western blotting. On the right is a plot of the ELISA. Because paramyosin was exposed to higher concentrations of UNC-96, from 0 to 0.5 µM, it bound increasingly until it reached near saturation. UNC-96 did not bind BSA within this concentration range.

View larger version (45K): [in this window] [in a new window]   Figure 12. UNC-96 copurifies with nematode thick filaments. (A) As shown in the schematic diagram, the process of thick filament purification involves Triton X-100 extractions, Dounce homogenization, and differential centrifugation. Fractions were collected throughout the purification process (F1-14). (B) The fractions (F1-14) were separated on SDS-PAGE, blotted, and reacted to anti-UNC-96 antibody. Notice that UNC-96 copurifies with thick filaments in fraction F14. (C) Fraction F11 was further separated on a sucrose gradient. Fractions from this gradient (S1-14, from bottom to top) were pooled: S1-5, S6-10, and S11-14. Portions of each pool were separated on two gels, one gel for Coomassie staining, and the other gel for Western blotting. Coomassie staining of the pooled proteins shows that fractions S1-5 contain myosin (MHC) and PM, fractions S6-10 contain a small amount of actin (ACT) and tropomyosin (TM), and fractions S11-14 contain ACT and TM. Reaction of the UNC-96 antibody against a Western blot shows that UNC-96 is present in the fractions containing both myosin and paramyosin. Given myosin and paramyosin are the primary components of thick filaments, this indicates that UNC-96 copurifies with thick filaments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Several pieces of intriguing data indicate that UNC-96 has a role in adult muscle: 1) The suppressive effect of starvation on the Unc-96 mutant phenotype is reversible upon reexposing adults to plentiful food. 2) The Unc-96 phenotype can be observed in young adult animals fed with unc-96 RNAi bacteria for 48 h. 3) The suppressive effect of reduced temperature (15°C) on the Unc-96 mutant phenotype can be observed even when the exposure to lower temperature begins at the young adult stage. This suggests that UNC-96 is continuously required in adult muscle for the final stages of sarcomere assembly and possibly maintenance of already established myofibrils.

Antibodies generated to UNC-96 show that the protein is located at the M-lines in adult body wall muscle and in the middle of A-bands in the single sarcomere pharyngeal and anal depressor muscles. An unc-96::gfp fusion that rescues unc-96 mutants is expresse