![]() |
|
|
Vol. 17, Issue 9, 4027-4038, September 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




*Department of Human Genetics, University of California, Los Angeles, CA 90095;
Institut Curie, Centre National de la Recherche Scientifique-Unité Mixte de Recherche 144, Paris 75248, France; and
Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104
Submitted May 3, 2006;
Revised June 26, 2006;
Accepted July 5, 2006
Monitoring Editor: Sandra Schmid
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
A relevant example is that of the heterotetrameric adaptor protein (AP)-3 complex. In fibroblasts, AP-3 serves in a route for trafficking of lysosome-associated membrane proteins (LAMPs) from early endosome-associated tubules to late endosomes and lysosomes (Peden et al., 2004
and references therein), whereas in melanocytes it mediates the trafficking of the key melanogenic enzyme, tyrosinase, to maturing melanosomes (Huizing et al., 2001
; Theos et al., 2005
). Consistent with a role for AP-3 in the sorting of proteins to melanosomes and other lysosome-related organelles (e.g., platelet dense granules, azurophil, and lytic granules), mutations in the human gene encoding the
3A subunit of the complex underlie Hermansky-Pudlak syndrome (HPS) type 2, a recessive disorder characterized by albinism, prolonged bleeding, and innate immune defects (DellAngelica et al., 1999b
; Clark et al., 2003
; Fontana et al., 2006
). Some components of the ubiquitous "AP-3dependent pathway" have been identified, including ARF1 and its GTPase-activating protein, AGAP1, clathrin, and phosphatidylinositol-4-kinase type II
(DellAngelica et al., 1998
; Faúndez et al., 1998
; Ooi et al., 1998
; Nie et al., 2003
; Salazar et al., 2005b
). However, published evidence suggests that AP-3 may also function independently of clathrin (Faúndez et al., 1998
; Peden et al., 2002
), and the significance of ARF1, AGAP1, and phosphatidylinositol-4-kinase type II
for AP-3dependent trafficking to melanosomes and other lysosome-related organelles remains to be ascertained. Moreover, an alternative route for AP-3independent trafficking of tyrosinase from endosomes to melanosomes has been described (Theos et al., 2005
) and the trafficking of tyrosinase-related protein 1 (Tyrp1) to melanosomes has been proposed to be entirely independent of AP-3 function (Huizing et al., 2001
). Consequently, additional components of AP-3dependent and independent trafficking pathways to melanosomes are likely to exist.
Obvious candidate components of the machinery that mediates sorting to melanosomes are the products of genes associated with other forms of HPS. At least seven types of HPS besides type 2 have been described in humans, each of them caused by recessive mutations in the gene encoding a subunit of any of three stable protein complexes, named biogenesis of lysosome-related organelles complex (BLOC)-1, -2, and -3 (for a recent review, see Wei, 2006
). Thus, the genes defective in HPS types 7 and 8 (the dysbindin and BLOS3 proteins, respectively) encode two of the eight known subunits of BLOC-1, the products of the genes mutated in HPS types 3, 5, and 6 are components of BLOC-2, and the products of the genes defective in HPS types 1 and 4 are subunits of BLOC-3 (Table 1). Intriguingly, the DTNBP1 gene defective in HPS type 7 and encoding the dysbindin subunit of BLOC-1 is also considered a promising candidate susceptibility gene for schizophrenia, a severe psychiatric disease with significant, but complex, genetic involvement (reviewed by Harrison and Weinberger, 2005
; Norton et al., 2006
). Like AP-3, all of the BLOCs are expressed in a wide variety of cell types (including fibroblasts and melanocytes) and exist in both soluble and peripheral membrane protein forms (reviewed by DellAngelica, 2004
; Li et al., 2004
; Wei, 2006
).
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
3 and
3A (DellAngelica et al., 1997a
(DellAngelica et al., 1999a
subunit of AP-3 (Peden et al., 2004
-tubulin (from Sigma-Aldrich, St. Louis, MO), anti-
clone 18, anti-early endosome antigen 1 (EEA1) and anti-p47A/µ3A (BD Transduction Laboratories, Lexington, KY), anti-Rab5 (Synaptic Systems, Göttingen, Germany), MEL-5 anti-Tyrp1 (Signet Laboratories, Dedham, MA), B3/25 against human transferrin receptor (TfR; Boehringer Ingelheim, Ridgefield, CT), and FITC-conjugated anti-CD63 and anti-CD71/TfR (Beckman Coulter, Fullerton, CA). The rat hybridoma against mouse TfR was from American Type Culture Collection (Manassas, VA), and the rabbit polyclonal antibodies to PMP70 and biotin were from Zymed Laboratories and Polysciences (Warrington, PA), respectively. Control rabbit IgG was from Southern Biotechnology (Birmingham, AL). Alexa 488-, Cy3-, and horseradish peroxidase (HRP)-conjugated secondary antibodies were from Molecular Probes (Eugene, OR), Jackson ImmunoResearch (West Grove, PA), and GE Healthcare (Waukesha, WI), respectively.
Animals
Breeding pairs of the homozygous mutant strains pearl (B6.C3-Ap3b1pe/J), pallid (B6.Cg-Pldnpa/J), cocoa (B6.B10-Hps3coa/J), and pale ear (B6.C3Fe-Hps1ep/J) were kindly provided by Juan S. Bonifacino and Richard T. Swank. C57BL/6J mice were used as wild-type controls. Homozygous pallid/pale ear double mutant mice were described previously (Nazarian et al., 2003
). Other homozygous double mutant strains were generated by following a breeding scheme analogous to that described by Meisler et al. (1984)
, which consisted of first obtaining a breeding pair of mice homozygous for one mutation (typically the one causing the less severe coat pigmentation defect) and heterozygous for the other and then identifying among the progeny the homozygous double mutants by either coat color or, if necessary, by test crosses or genotyping.
Cell Culture
Human HeLa, M1, and MNT-1 cell lines and immortalized mouse fibroblasts were obtained and cultured as described (DellAngelica et al., 2000
). Primary melanocyte cultures were obtained from the epidermis of <3-d-old mice as described by Wu et al. (2001)
. Cells were allowed to attach to gelatin-coated glass coverslips and cultured in TAV medium (Hams F10 medium supplemented with 10% [vol/vol] horse serum, 2% [vol/vol] fetal calf serum, 100 U/ml penicillin, 0.1 g/l streptomycin, 100 nM dibutyryl-cAMP, 85 nM phorbol myristate 13-acetate) and used for analysis with no passages. In some experiments, cells were incubated for 6 h in TAV medium containing 1 mg/ml leupeptin before fixation.
Small Interference RNA Treatment and Flow Cytometry
M1 fibroblasts were seeded at a density of 3 x 105 cells per 9-cm dish and 12 h and 3 d later were subjected to transfection with small interference RNA (siRNA) duplexes (Dharmacon, Boulder, CO), as described by Motley et al. (2003)
. The following mRNA sequences were selected as targets: GCGAGAAACUGCCUAUUCA and UCUGCAAGCUGACGUAUUU (
subunit of AP-3), AAGGAUUGCUUUCUCAUUAUU and GAAGGAGUUUGAAAGAGAA (pallidin subunit of BLOC-1), ACGAGAGAGGAUUAAUCUUU (HPS3 subunit of BLOC-2), and GAACUCGACUUGUCUGAAA (HPS4 subunit of BLOC-3). Three days after the second transfection, cells were either fixed for immunofluorescence staining or harvested for biochemical or flow cytometric analyses. Estimation of surface expression levels of CD63 and TfR by analytical flow cytometry was performed as described (DellAngelica et al., 1999b
).
Biochemical Procedures
Cytosolic and membrane fractions of HeLa cells or mouse liver were prepared by homogenization in buffer A (20 mM HEPES, pH 7.4, 50 mM KCl, 1 mM dithiothreitol, 1 mM EGTA, 0.5 mM MgCl2, 0.25 mM GTP
S) containing a protease inhibitors mixture (Di Pietro et al., 2004
), followed by centrifugation at 15,000x g for 10 min and then ultracentrifugation at 120,000x g for 90 min, at 4°C. The final membrane pellet was solubilized in 1 ml of buffer A containing protease inhibitors mixture and 1% (wt/vol) Triton X-100. Triton X-100 was added to the cytosolic fraction to match the detergent concentration. Both fractions were cleared by centrifugation for 10 min at 15,000x g before immunoprecipitation, which was performed as described above (Di Pietro et al., 2004
) except for the use of buffer A in all washing steps.
For membrane association experiments, cytosol and membrane fractions were obtained from fibroblasts by homogenization in buffer B (10 mM HEPES, pH 7.4, 250 mM sucrose, 1 mM dithiothreitol, 1 mM EGTA, 0.5 mM MgCl2, 0.25 mM GTP
S, and protease inhibitors mixture), followed by centrifugation for 5 min at 15,000x g and for 15 min at 400,000x g, at 4°C.
Immunoblotting was performed as described (Nazarian et al., 2006
).
Immunofluorescence Staining and Antibody Internalization Assay
Immunofluorescence staining and internalization of antibodies by cells grown on glass coverslips were performed as described (DellAngelica et al., 1997a
, 1999b
). Samples were examined at room temperature on a Zeiss Axioskop 2 fluorescence microscope (Carl Zeiss, Thornwood, NY), using 40x and 63x objectives for M1 cells and melanocytes, respectively. Digital images were acquired using an Orca-ER digital camera and the AxioVision software (Carl Zeiss), under conditions optimized to prevent signal saturation. To quantify the fluorescence signal of stained melanocytes, digital images of randomly selected cells were saved using coded file names and subsequently were imported into NIH Image 1.62 for analysis by following a "blinded" approach, i.e., by an operator who was unaware of the identity of the samples. For colocalization experiments, stained samples were examined on a Leica TCS SP confocal microscope (Leica, Deerfield, IL).
Electron Microscopy
Internalization of conjugated transferrin (Tf) by MNT-1 cells, fixation and ultracryomicrotomy, whole-mount electron microscopy, immunogold labeling, and analysis were carried out as previously described (Theos et al., 2005
), except that Tf-biotin (Invitrogen, Carlsbad, CA) was used instead of Tf-FITC to label endosomes.
Quantification of Hair Melanin
The melanin content of mouse hair samples was estimated by the spectrophotometric method of Ozeki et al. (1995)
, using purified Sepia officinalis melanin (Sigma-Aldrich) as a standard.
Statistical Analyses
All statistical tests were performed using GraphPad Prism 4.0 (GraphPad Software, San Diego, CA). Data groups were first analyzed using the DAgostino and Pearson omnibus normality test and, if no significant deviations from Gaussian distributions were found, subsequently analyzed by one-sample t test (for comparison of one data group vs. a reference number) or one-way ANOVA followed by Dunnetts multiple comparison test (for comparison of several data groups vs. a control group). Comparisons between data groups with significant divergence from Gaussian distributions were carried out using the nonparametric Mann-Whitney test.
| RESULTS |
|---|
|
|
|---|
S. Although comparable amounts of BLOC-2 were associated to BLOC-1 immunoprecipitates regardless of the guanosine nucleotide used, the association of AP-3 to BLOC-1 was significantly compromised, albeit not completely disrupted, upon substitution of GDP for GTP
S (Figure 1B). Therefore, these results suggest that BLOC-1 interacts, either directly or indirectly, with AP-3 and BLOC-2, and that the two interactions may be differentially regulated.
|
3 (Figure 1C), implying that the observed coimmunoprecipitation was not due to antibody cross-reactivity during the immunoprecipitation step. Similarly, control immunoprecipitations performed in extracts prepared from BLOC-1 or BLOC-2deficient mice yielded the expected negative results for the BLOC-1·BLOC-2 interaction (unpublished data). Interestingly, the association between BLOC-1 and AP-3 was observed in liver membrane extracts prepared from BLOC-2deficient mice, and that between BLOC-1 and -2 was observed in extracts prepared from AP-3deficient mice (Figure 1C and unpublished data). Together, these results provide support to the idea that the interactions between BLOC-1 and BLOC-2 or AP-3 are specific and suggest that BLOC-1 can associate with BLOC-2 independently of AP-3, and likewise, it can associate with AP-3 independently of BLOC-2 function.
Genetic Interactions Between BLOC-1, BLOC-2, and AP-3
As a complementary approach to understand the functional relationships between AP-3 and the BLOCs, we tested for epistatic interactions through generation of homozygous double mutant mice simultaneously deficient in pairs of these protein complexes. Although the coat color phenotype of mice simultaneously deficient in BLOC-1 and BLOC-2 (pallid/cocoa) was virtually indistinguishable from that of single mutant mice deficient in BLOC-1, that of mice simultaneously deficient in BLOC-1 and AP-3 (pearl/pallid) was more severe than that of age-matched single mutants (Supplementary Figure 1). In addition, mice simultaneously deficient in AP-3 and BLOC-1 were very difficult to breed as double homozygous, unlike the corresponding single mutants or mice simultaneously deficient in BLOC-1 and BLOC-2 (unpublished data). Strikingly, the coat color phenotype of double mutant mice deficient in AP-3 and BLOC-2 was not only more severe than that of the corresponding single mutants but highly similar to that of BLOC-1deficient mice (Supplementary Figure 1). The simplest interpretation of these results is that AP-3 and BLOC-2 can function independently of each other and that the impact of BLOC-1 deficiency on pigmentation can be mimicked by simultaneous deficiencies in AP-3 and BLOC-2.
Functional Interactions between BLOC-1, BLOC-2, and AP-3 as Evidenced by Regulation of Membrane Association
As a first step to address the biological significance of the observed interactions between BLOC-1, BLOC-2, and AP-3, we tested whether membrane association of each complex was affected by deficiencies in its interacting partner(s). To this end, cytosolic and membrane fractions were obtained from skin fibroblast lines derived from wild-type and mutant mice, and the relative amounts of each complex in the membrane fraction were estimated by quantitative immunoblotting. In an attempt to minimize dissociation from membranes during the fractionation procedure, we used a sucrose-containing buffer that had been shown to help stabilize the membrane-associated forms of the three complexes (DellAngelica et al., 1997a
; Falcón-Pérez et al., 2002
; Di Pietro et al., 2004
) and we significantly reduced the duration of the ultracentrifugation step (see Materials and Methods). Under these conditions, about half of BLOC-1,
20% of BLOC-2, and
40% of AP-3 were recovered from the membrane fractions obtained from wild-type mouse fibroblast lines (Figure 2, A and B). Interestingly, the relative amounts of BLOC-1 recovered from membranes were reduced to <20% in AP-3deficient cells (or in cells simultaneously deficient in AP-3 and BLOC-2), and those of BLOC-2 and AP-3 were increased in BLOC-1deficient cells (Figure 2). Membranes isolated from BLOC-2deficient fibroblasts contained relative amounts of BLOC-1 and AP-3 that were comparable to those of wild-type cells, and membranes isolated from AP-3deficient fibroblasts contained normal amounts of BLOC-2 (Figure 2). In another set of experiments, knockdown of AP-3 expression by siRNA treatment of human M1 cells (see below) resulted in a
40% decrease in the relative amount of membrane-associated BLOC-1 without affecting the membrane-associated pool of BLOC-2 (unpublished data), thus in agreement with the results obtained using immortalized fibroblasts from mutant mice. As judged from immunofluorescence analysis of fixed/permeabilized fibroblasts, neither the overall distribution of AP-3 nor its degree of colocalization with TfR was noticeably affected by deficiencies in BLOC-1 or -2 (Supplementary Figure 2). Together, these results suggest that AP-3 and BLOC-1 can regulate the membrane association/dissociation of each other, albeit without significantly altering AP-3 distribution, and that BLOC-1 can also regulate membrane association/dissociation of BLOC-2.
|
|
|
Knockdown of BLOC-1 from Human Fibroblasts Leads to Cell Surface Accumulation of CD63
The observed interaction between AP-3 and BLOC-1 was surprising given previous data that had suggested that mutant mouse fibroblasts deficient in BLOC-1 do not display a characteristic phenotype of AP-3deficient cells, i.e., enhanced trafficking of LAMP1 through the cell surface (DellAngelica et al., 2000
; Gwynn et al., 2000
; Martina et al., 2003
). We first attempted to address this issue by performing flow cytometric analyses of LAMP1 surface levels and internalization, using several independent lines of immortalized fibroblasts derived from mutant mice deficient in each complex. Although our results were suggestive of enhanced LAMP1 trafficking through the surface of mutant fibroblasts deficient in BLOC-1, they failed to reach statistical significance owing to high variability in the results obtained using different cell lines derived from each mouse strain (unpublished data). Similar experiments performed by Salazar et al. (2006)
, however, succeeded in demonstrating enhanced surface levels of endogenous LAMP1 is BLOC-1deficient mouse fibroblasts, notwithstanding the variability between cell lines. Here, we adopted an alternative experimental approach that was based on acute knockdown of BLOC-1 expression in the human M1 fibroblastoid cell line by siRNA, followed by analysis of the endogenous CD63/LAMP3 protein by indirect immunofluorescence and flow cytometry. Among the advantages of this approach were the use of a single immortalized cell line analyzed in parallel upon different siRNA treatments, as opposed to a comparison between independent mutant cell lines, and the use of endogenous CD63 as a marker for AP-3dependent trafficking, which facilitated quantitative analyses with improved signal-to-noise ratio (DellAngelica et al., 1999b
; Janvier and Bonifacino, 2005
). We identified two independent siRNA duplexes that were able to significantly knockdown expression of BLOC-1, two for efficient knockdown of AP-3, and one siRNA duplex to knockdown expression of each of BLOC-2 and -3 (Figure 5A). In agreement with published data (Janvier and Bonifacino, 2005
), knockdown of AP-3 led to a significant accumulation of CD63 at the cell surface, which was readily detected by indirect immunofluorescence (Figure 5D) and flow cytometry (Figure 5E). Interestingly, knockdown of BLOC-1 with either siRNA duplex elicited a similar effect, albeit to a lesser extent, as judged by both methods (Figure 5, C, E, and G). On the other hand, the surface levels of CD63 were not noticeably affected upon knockdown of BLOC-2 or -3 (Figure 5G). Like in AP-3deficient cells, the surface levels of TfR were not affected by knockdown of BLOC-1 (Figure 5F). These observations suggest that BLOC-1 plays a role in the trafficking of CD63/LAMP3, a well-known AP-3 cargo.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
3A subunit of AP-3 (DellAngelica et al., 1999b
We show that endogenous BLOC-1 from human cells or mouse tissue can associate with BLOC-2 or AP-3 into macromolecular assemblies that are stable enough to allow detection by coimmunoprecipitation. Stability of the BLOC-1·AP-3 assembly in vitro was dependent on the presence of GTP
S, suggesting the possible involvement of a GTPase in regulating its association/dissociation. It is likely that we (Falcón-Pérez et al., 2002
) and others (Moriyama and Bonifacino, 2002
) had previously failed to detect the BLOC-1·AP-3 interaction owing to enhanced dissociation in the absence of GTP
S and presence of salt at high concentrations. Our results imply that interactions between BLOC-1 and either BLOC-2 or AP-3 occur on membranes and, in turn, regulate their membrane association/dissociation. Thus, the pool of membrane associated BLOC-1 was reduced in cells deficient in AP-3, whereas those of AP-3 and BLOC-2 were increased in BLOC-1deficient cells. The simplest interpretation of these results is that AP-3 facilitates membrane recruitment of BLOC-1, which in turn facilitates AP-3 (and BLOC-2) dissociation. We speculate that BLOC-1 might play a role downstream of AP-3mediated vesicle formation, such as serving as a tethering factor, which would be also consistent with our finding of a small pool of BLOC-1 associated with the melanosomal membrane as well as previous reports on the ability of BLOC-1 subunits to bind SNARE proteins (e.g., Huang et al., 1999
) and the detection of BLOC-1 subunits in AP-3derived vesicles isolated from PC12 cells (Salazar et al., 2005b
, 2006
). Alternatively, AP-3 and BLOC-1 might interact to delineate the boundaries of two membrane domains on early endosomes, such that a deficiency in one complex could have an indirect impact on the membrane-associated pool of the other. Despite the localization of both complexes to early endosome-associated tubules, it is noteworthy that not much BLOC-1 immunoreactivity was detected on AP-3containing buds emanating from these tubules. Here, several possible explanations must be considered, namely, 1) that BLOC-1 could be associated with AP-3containing buds but with epitopes not accessible for recognition by our antibodies upon whole-mount immunoelectron microscopy, 2) that BLOC-1 could be recruited to AP-3 vesicles only subsequently to budding, and 3) that BLOC-1 could be associated with a pool of AP-3positive, clathrin-negative endosomal membrane profiles that had previously been noted in MNT-1 and other cell types (Peden et al., 2004
; Theos et al., 2005
).
In support of the idea that the BLOC-1·AP-3 interaction is biologically significant, we show that knockdown of BLOC-1 expression in human fibroblasts elicits surface accumulation of a well-established AP-3 cargo, CD63, and not TfR, and that melanocytes deficient in AP-3 display abnormal trafficking of Tyrp1, which is severely affected in BLOC-1deficient melanocytes. The conclusion that Tyrp1 trafficking is not entirely independent of AP-3 function is at variance with that of a previous article by Huizing et al. (2001)
, although we note that the immunofluorescence staining shown in that article for Tyrp1 in AP-3deficient human melanocytes appears to be significantly less intense than in normal melanocytes, thus in agreement with our results. We also demonstrate that trafficking of Tyrp1, but apparently not CD63, also depends in part on BLOC-2 function. Together, our biochemical, genetic, and functional data are most consistent with a model in which BLOC-1 functions in two apparently distinct mechanisms for trafficking of Tyrp1 from endosomes to melanosomes, one of them dependent on AP-3 and the other on BLOC-2 (Figure 8). Such a model provides a satisfactory explanation for our observation that the Tyrp1 trafficking phenotype of BLOC-1deficient melanocytes is more severe than those of cells deficient in either BLOC-2 or AP-3 but it can be mimicked by the combined deficiency in the last two complexes. This observation is in turn consistent with our results on the coat color phenotypes of double mutant mice. The fact that AP-3 can still function independently of BLOC-1, as suggested by the more severe phenotype of AP-3/BLOC-1 double mutant mice compared with that of BLOC-1deficient mice, indicates the existence of AP-3dependent trafficking mechanisms that are independent of BLOC-1, of which tyrosinase (Huizing et al., 2001
; Theos et al., 2005
) is a likely cargo (Figure 8). The model implies that defective function in any of these complexes would result in missorting of Tyrp1 from early endosomes to the plasma membrane, thus explaining the observed increase in anti-Tyrp1 internalized over a time period, as well as possible missorting into the degradative pathway in lysosomes, consistent with the observed decrease in steady state Tyrp1 levels and its rescue upon leupeptin treatment. Interestingly, the idea that AP-3 deficiency can lead to missorting of some of its cargo into intralumenal vesicles for degradation in lysosomes would provide an attractive explanation to previous reports of decreased immunoreactivity of zinc transporter 3 (Kantheti et al., 1998
) and vesicular
-aminobutyric acid transporter (Nakatsu et al., 2004
) in AP-3deficient mouse brain.
|
-aminobutyric acid transporter; see Nakatsu et al., 2004
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-05-0379) on July 12, 2006.
Address correspondence to: Esteban C. DellAngelica (Edellangelica{at}mednet.ucla.edu)
Abbreviations used: AP, adaptor protein; BLOC, biogenesis of lysosome-related organelles complex; EEA1, early endosome antigen 1; HPS, Hermansky-Pudlak syndrome; HRP, horseradish peroxidase; LAMP, lysosome-associated membrane protein; mAb, monoclonal antibody; siRNA, small interference RNA; Tf, transferrin; TfR, transferrin receptor; Tyrp1, tyrosinase-related protein 1.
| REFERENCES |
|---|
|
|
|---|
DellAngelica, E. C., Ohno, H., Ooi, C. E., Rabinovich, E., Roche, K. W., Bonifacino, J. S. (1997a). AP-3, an adaptor-like protein complex with ubiquitous expression. EMBO J 16, 917928.[CrossRef][Medline]
DellAngelica, E. C., Ooi, C. E., Bonifacino, J. S. (1997b).
3a-adaptin, a subunit of the adaptor-like complex AP-3. J. Biol. Chem 272, 1507815084.
DellAngelica, E. C., Klumperman, J., Stoorvogel, W., Bonifacino, J. S. (1998). Association of the AP-3 adaptor complex with clathrin. Science 280, 431434.
DellAngelica, E. C., Mullins, C., Bonifacino, J. S. (1999a). AP-4, a novel protein complex related to clathrin adaptors. J. Biol. Chem 274, 72787285.
DellAngelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A., Bonifacino, J. S. (1999b). Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the
3A subunit of the AP-3 adaptor. Mol. Cell 3, 1121.[CrossRef][Medline]
DellAngelica, E. C., Aguilar, R. C., Wolins, N., Hazelwood, S., Gahl, W. A., Bonifacino, J. S. (2000). Molecular characterization of the protein encoded by the Hermansky-Pudlak syndrome type 1 gene. J. Biol. Chem 275, 13001306.
DellAngelica, E. C. (2004). The building BLOC(k)s of lysosomes and related organelles. Curr. Opin. Cell Biol 16, 458464.[CrossRef][Medline]
Di Pietro, S. M., Falcón-Pérez, J. M., DellAngelica, E. C. (2004). Characterization of BLOC-2, a complex containing the Hermansky-Pudlak syndrome proteins HPS3, HPS5 and HPS6. Traffic 5, 276283.[CrossRef][Medline]
Falcón-Pérez, J. M., Starcevic, M., Gautam, R., DellAngelica, E. C. (2002). BLOC-1, a novel complex containing the pallidin and muted proteins involved in the biogenesis of melanosomes and platelet dense granules. J. Biol. Chem 277, 2819128199.
Faúndez, V., Horng, J.-T., Kelly, R. B. (1998). A function for the AP3 coat complex in synaptic vesicle formation from endosomes. Cell 93, 423432.[CrossRef][Medline]
Feng, L., Novak, E. K., Hartnell, L. M., Bonifacino, J. S., Collinson, L. M., Swank, R. T. (2002). The Hermansky-Pudlak syndrome 1 (HPS1) and HPS2 genes independently contribute to the production and function of platelet dense granules, melanosomes, and lysosomes. Blood 99, 16511658.
Fontana, S., et al. (2006). Innate immunity defects in Hermansky-Pudlak type 2 syndrome. Blood 107, 48574864.
Gautam, R., Chintala, S., Li, W., Zhang, Q., Tan, J., Novak, E. K., Di Pietro, S. M., DellAngelica, E. C., Swank, R. T. (2004). The Hermansky-Pudlak syndrome 3 (cocoa) protein is a component of the biogenesis of lysosome-related organelles complex-2 (BLOC-2). J. Biol. Chem 279, 1293512942.
Gwynn, B., et al. (2000). Defects in the cappuccino (cno) gene on mouse chromosome 5 and human 4p cause Hermansky-Pudlak syndrome by an AP-3-independent mechanism. Blood 96, 42274235.
Gruenberg, J. and Stenmark, H. (2004). The biogenesis of multivesicular endosomes. Nat. Rev. Mol. Cell Biol 5, 317323.[CrossRef][Medline]
Harrison, P. J. and Weinberger, D. R. (2005). Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Mol. Psychiatry 10, 4068.[CrossRef][Medline]
Huang, L., Kuo, Y.-M., Gitschier, J. (1999). The pallid gene encodes a novel, syntaxin 13-interacting protein involved in platelet storage pool deficiency. Nat. Genet 23, 329332.[CrossRef][Medline]
Huizing, M., Sarangarajan, R., Strovel, E., Zhao, Y., Gahl, W. A., Boissy, R. E. (2001). AP-3 mediates tyrosinase but not TRP-1 trafficking in human melanocytes. Mol. Biol. Cell 12, 20752085.
Janvier, K. and Bonifacino, J. S. (2005). Role of the endocytic machinery in the sorting of lysosome-associated membrane proteins. Mol. Biol. Cell 16, 42314242.
Kantheti, P., et al. (1998). Mutations in AP-3
in the mocha mouse links endosomal transport to storage deficiency in platelets, melanosomes, and synaptic vesicles. Neuron 21, 111122.[CrossRef][Medline]
Li, W., Rusiniak, M. E., Chintala, S., Gautam, R., Novak, E. K., Swank, R. T. (2004). Murine Hermansky-Pudlak syndrome genes: regulators of lysosome-related organelles. Bioessays 26, 616628.[CrossRef][Medline]
Martina, J. A., Moriyama, K., Bonifacino, J. S. (2003). BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4. J. Biol. Chem 278, 2937629384.
Meisler, M. H., Wanner, L., Strahler, J. (1984). Pigmentation and lysosomal phenotypes in mice doubly homozygous for both light-ear and pale-ear mutant alleles. J. Hered 75, 103106.
Mills, I. G., Jones, A. T., Clague, M. J. (1998). Involvement of the endosomal autoantigen EEA1 in homotypic fusion of early endosomes. Curr. Biol 8, 881884.[CrossRef][Medline]
Moriyama, K. and Bonifacino, J. S. (2002). Pallidin is a component of a multi-protein complex involved in the biogenesis of lysosome-related organelles. Traffic 3, 666677.[CrossRef][Medline]
Motley, A., Bright, N. A., Seaman, M. N. J., Robinson, M. S. (2003). Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol 162, 909918.
Nakatsu, F., et al. (2004). Defective function of GABA-containing synaptic vesicles in mice lacking the AP-3B clathrin adaptor. J. Cell Biol 167, 293302.
Nazarian, R., Falcón-Pérez, J. M., DellAngelica, E. C. (2003). Biogenesis of lysosome-related organelles complex 3 (BLOC-3): a complex containing the Hermansky-Pudlak syndrome (HPS) proteins HPS1 and HPS4. Proc. Natl. Acad. Sci. USA 100, 87708775.
Nazarian, R., Starcevic, M., Spencer, M. J., DellAngelica, E. C. (2006). Reinvestigation of the dysbindin subunit of BLOC-1 (biogenesis of lysosome-related organelles complex-1) as a dystrobrevin-binding protein. Biochem. J 395, 587598.[CrossRef][Medline]
Nie, Z., Boehm, M., Boja, E. S., Vass, W. C., Bonifacino, J. S., Fales, H. M., Randazzo, P. A. (2003). Specific regulation of the adaptor protein complex AP-3 by the Arf GAP AGAP1. Dev. Cell 5, 513521.[CrossRef][Medline]
Norton, N., Williams, H. J., Owen, M. J. (2006). An update on the genetics of schizophrenia. Curr. Opin. Psychiatry 19, 158164.[Medline]
Ooi, C. E., DellAngelica, E. C., Bonifacino, J. S. (1998). ADP-ribosylation factor 1 (ARF1) regulates recruitment of the AP-3 adaptor complex to membranes. J. Cell Biol 142, 391402.
Ozeki, H., Ito, S., Wakamatsu, K., Hirobe, T. (1995). Chemical characterization of hair melanins in various coat-color mutants of mice. J. Invest. Dermatol 105, 361366.[CrossRef][Medline]
Peden, A. A., Rudge, R. E., Lui, W. W. Y., Robinson, M. S. (2002). Assembly and function of AP-3 complexes in cells expressing mutant subunits. J. Cell Biol 156, 327336.
Peden, A. A., Oorschot, V., Hesser, B. A., Austin, C. D., Scheller, R. H., Klumperman, J. (2004). Localization of the AP-3 adaptor complex defines a novel endosomal exit site for lysosomal membrane proteins. J. Cell Biol 164, 10651076.
Perret, E., Lakkaraju, A., Deborde, S., Schreiner, R., Rodriguez-Boulan, E. (2005). Evolving endosomes: how many varieties and why? Curr. Opin. Cell Biol 17, 423434.[CrossRef][Medline]
Raposo, G., Tenza, D., Murphy, D. M., Berson, J. F., Marks, M. S. (2001). Distinct protein sorting and localization to premelanosomes, melanosomes, and lysosomes in pigmented melanocytic cells. J. Cell Biol 152, 809823.
Raposo, G., Fevrier, B., Stoorvogel, W., Marks, M. S. (2002). Lysosome-related organelles: a view from immunity and pigmentation. Cell Struct. Funct 27, 443456.[CrossRef][Medline]
Salazar, G., Craige, B., Love, R., Kalman, D., Faundez, V. (2005a). Vglut1 and Znt3 co-targeting mechanisms regulate vesicular zinc stores in PC12 cells. J. Cell Sci 118, 19111921.
Salazar, G., Craige, B., Wainer, B. H., Guo, J., De Camilli, P., Faundez, V. (2005b). Phosphatidylinositol-4-kinase type II
is a component of adaptor protein-3-derived vesicles. Mol. Biol. Cell 16, 36923704.
Salazar, G., et al. (2006). BLOC-1 complex deficiency alters the targeting of adaptor protein complex-3 cargoes. Mol. Biol. Cell 17, 40144026.
Starcevic, M. and DellAngelica, E. C. (2004). Identification of snapin and three novel proteins (BLOS1, BLOS2 and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles protein complex-1 (BLOC-1). J. Biol. Chem 279, 2839328401.
Stoorvogel, W., Oorschot, V., Geuze, H. J. (1996). A novel class of clathrin-coated vesicles budding from endosomes. J. Cell Biol 132, 2133.
Straub, R. E., Mayhew, M. B., Vakkalanka, R. K., Kolachana, B., Goldberg, T. E., Egan, M. F., Weinberger, D. R. (2005). MUTED, a protein that binds to dysbindin (DTNBP1), is associated with schizophrenia. Am. J. Med. Genet 138B, 136 (abstract).
Talbot, K., et al. (2004). Dysbindin-1 is reduced in intrinsic, glutamatergic terminals of the hippocampal formation in schizophrenia. J. Clin. Invest 113, 13531363.[CrossRef][Medline]
Theos, A. C., et al. (2005). Functions of adaptor protein (AP)-3 and AP-1 in tyrosinase sorting from endosomes to melanosomes. Mol. Biol. Cell 16, 53565372.
Wei, M. L. (2006). Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function. Pigment Cell Res 19, 1942.[CrossRef][Medline]
Wu, X., Rao, K., Bowers, M. B., Copeland, N. G., Jenkins, N. A., Hammer, J. A. III. (2001). Rab27a enables myosin Va-dependent melanosome capture by recruiting the myosin to the organelle. J. Cell Sci 114, 10911100.[Abstract]
This article has been cited by other articles:
![]() |
V. T. Cheli, R. W. Daniels, R. Godoy, D. J. Hoyle, V. Kandachar, M. Starcevic, J. A. Martinez-Agosto, S. Poole, A. DiAntonio, V. K. Lloyd, et al. Genetic modifiers of abnormal organelle biogenesis in a Drosophila model of BLOC-1 deficiency Hum. Mol. Genet., March 1, 2010; 19(5): 861 - 878. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Newell-Litwa, S. Chintala, S. Jenkins, J.-F. Pare, L. McGaha, Y. Smith, and V. Faundez Hermansky-Pudlak Protein Complexes, AP-3 and BLOC-1, Differentially Regulate Presynaptic Composition in the Striatum and Hippocampus J. Neurosci., January 20, 2010; 30(3): 820 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T.-T. Tang, F. Yang, B.-S. Chen, Y. Lu, Y. Ji, K. W. Roche, and B. Lu Dysbindin regulates hippocampal LTP by controlling NMDA receptor surface expression PNAS, December 15, 2009; 106(50): 21395 - 21400. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Huizing, B Pederson, R A Hess, A Griffin, A Helip-Wooley, W Westbroek, H Dorward, K J O'Brien, G Golas, E Tsilou, et al. Clinical and cellular characterisation of Hermansky-Pudlak syndrome type 6 J. Med. Genet., December 1, 2009; 46(12): 803 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ji, F. Yang, F. Papaleo, H.-X. Wang, W.-J. Gao, D. R. Weinberger, and B. Lu Role of dysbindin in dopamine receptor trafficking and cortical GABA function PNAS, November 17, 2009; 106(46): 19593 - 19598. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. V. Ryder and V. Faundez Schizophrenia: The "BLOC" May Be in the Endosomes Sci. Signal., October 20, 2009; 2(93): pe66 - pe66. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Delevoye, I. Hurbain, D. Tenza, J.-B. Sibarita, S. Uzan-Gafsou, H. Ohno, W. J.C. Geerts, A. J. Verkleij, J. Salamero, M. S. Marks, et al. AP-1 and KIF13A coordinate endosomal sorting and positioning during melanosome biogenesis J. Cell Biol., October 19, 2009; 187(2): 247 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sitaram, R. Piccirillo, I. Palmisano, D. C. Harper, E. C. Dell'Angelica, M. V. Schiaffino, and M. S. Marks Localization to Mature Melanosomes by Virtue of Cytoplasmic Dileucine Motifs Is Required for Human OCA2 Function Mol. Biol. Cell, March 1, 2009; 20(5): 1464 - 1477. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Newell-Litwa, G. Salazar, Y. Smith, and V. Faundez Roles of BLOC-1 and Adaptor Protein-3 Complexes in Cargo Sorting to Synaptic Vesicles Mol. Biol. Cell, March 1, 2009; 20(5): 1441 - 1453. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Xie, T. Nguyen, M. Hupe, and M. L. Wei Multidrug Resistance Decreases with Mutations of Melanosomal Regulatory Genes Cancer Res., February 1, 2009; 69(3): 992 - 999. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Salazar, S. Zlatic, B. Craige, A. A. Peden, J. Pohl, and V. Faundez Hermansky-Pudlak Syndrome Protein Complexes Associate with Phosphatidylinositol 4-Kinase Type II {alpha} in Neuronal and Non-neuronal Cells J. Biol. Chem., January 16, 2009; 284(3): 1790 - 1802. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wasmeier, A. N. Hume, G. Bolasco, and M. C. Seabra Melanosomes at a glance J. Cell Sci., December 15, 2008; 121(24): 3995 - 3999. [Full Text] [PDF] |
||||
![]() |
V. Robila, M. Ostankovitch, M. L. Altrich-VanLith, A. C. Theos, S. Drover, M. S. Marks, N. Restifo, and V. H. Engelhard MHC Class II Presentation of gp100 Epitopes in Melanoma Cells Requires the Function of Conventional Endosomes and Is Influenced by Melanosomes J. Immunol., December 1, 2008; 181(11): 7843 - 7852. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Craige, G. Salazar, and V. Faundez Phosphatidylinositol-4-Kinase Type II Alpha Contains an AP-3-sorting Motif and a Kinase Domain That Are Both Required for Endosome Traffic Mol. Biol. Cell, April 1, 2008; 19(4): 1415 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kouloumenta, M. Mavroidis, and Y. Capetanaki Proper Perinuclear Localization of the TRIM-like Protein Myospryn Requires Its Binding Partner Desmin J. Biol. Chem., November 30, 2007; 282(48): 35211 - 35221. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Berger, G. Salazar, M. L. Styers, K. A. Newell-Litwa, E. Werner, R. A. Maue, A. H. Corbett, and V. Faundez The subcellular localization of the Niemann-Pick Type C proteins depends on the adaptor complex AP-3 J. Cell Sci., October 15, 2007; 120(20): 3640 - 3652. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. G. Setty, D. Tenza, S. T. Truschel, E. Chou, E. V. Sviderskaya, A. C. Theos, M. L. Lamoreux, S. M. Di Pietro, M. Starcevic, D. C. Bennett, et al. BLOC-1 Is Required for Cargo-specific Sorting from Vacuolar Early Endosomes toward Lysosome-related Organelles Mol. Biol. Cell, March 1, 2007; 18(3): 768 - 780. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Newell-Litwa, E. Seong, M. Burmeister, and V. Faundez Neuronal and non-neuronal functions of the AP-3 sorting machinery J. Cell Sci., February 15, 2007; 120(4): 531 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. H.H. Borner, M. Harbour, S. Hester, K. S. Lilley, and M. S. Robinson Comparative proteomics of clathrin-coated vesicles J. Cell Biol., November 20, 2006; 175(4): 571 - 578. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||