Molecular Biology of the Cell click for ASCB 2009 Annual Meeting page

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E06-06-0557 on November 1, 2006

Vol. 18, Issue 1, 324-335, January 2007

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Material
Right arrow All Versions of this Article:
E06-06-0557v1
18/1/324    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, J.
Right arrow Articles by Piper, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, J.
Right arrow Articles by Piper, R. C.

Hse1, a Component of the Yeast Hrs-STAM Ubiquitin-sorting Complex, Associates with Ubiquitin Peptidases and a Ligase to Control Sorting Efficiency into Multivesicular BodiesFormula

Jihui Ren*, Younghoon Kee{dagger}, Jon M. Huibregtse{dagger}, and Robert C. Piper*

*Department of Physiology and Biophysics, University of Iowa, Iowa City, IA 52242; and {dagger}Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, TX 78712

Submitted June 26, 2006; Revised October 16, 2006; Accepted October 19, 2006
Monitoring Editor: Jeffrey Brodsky


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ubiquitinated integral membrane proteins are delivered to the interior of the lysosome/vacuole for degradation. This process relies on specific ubiquitination of potential cargo and recognition of that Ub-cargo by sorting receptors at multiple compartments. We show that the endosomal Hse1-Vps27 sorting receptor binds to ubiquitin peptidases and the ubiquitin ligase Rsp5. Hse1 is linked to Rsp5 directly via a PY element within its C-terminus and through a novel protein Hua1, which recruits a complex of Rsp5, Rup1, and Ubp2. The SH3 domain of Hse1 also binds to the deubiquitinating protein Ubp7. Functional analysis shows that when both modes of Rsp5 association with Hse1 are altered, sorting of cargo that requires efficient ubiquitination for entry into the MVB is blocked, whereas sorting of cargo containing an in-frame addition of ubiquitin is normal. Further deletion of Ubp7 restores sorting of cargo when the Rsp5:Hse1 interaction is compromised suggesting that both ubiquitin ligases and peptidases associate with the Hse1-Vps27 sorting complex to control the ubiquitination status and sorting efficiency of cargo proteins. Additionally, we find that disruption of UBP2 and RUP1 inhibits MVB sorting of some cargos suggesting that Rsp5 requires association with Ubp2 to properly ubiquitinate cargo for efficient MVB sorting.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Integral membrane proteins are sorted into intralumenal vesicles of endosomes before delivery and degradation in lysosomes (Gruenberg and Stenmark, 2004Go). One of the sorting signals for sending proteins into the endosomal lumen is ubiquitin (Ub; Katzmann et al., 2002Go; Hicke and Dunn, 2003Go). Many studies have demonstrated that monoubiquitination of cargo is sufficient for efficient sorting into the interior of multivesiculated endosomes/bodies (MVB). Ubiquitination works as an MVB-sorting signal for a variety of proteins, including those internalized from the cell surface as well as those delivered to endosomes from the Golgi apparatus via the biosynthetic pathway. Ub also serves as a sorting signal at other post-Golgi compartments with the cumulative effect of sending cargo toward the lysosome. Ub can serve as a signal for internalization, thus hastening the delivery of cell surface proteins to endosomes, and Ub addition can also sort membrane proteins at the trans-Golgi network (TGN), diverting them to endosomes and preventing their delivery to the cell surface (Staub and Rotin, 2006Go).

Ubiquitin works as a sorting signal by binding Ub-sorting receptors that recognize ubiquitinated cargo (Ub-cargo) and incorporate it into various transport intermediates (Staub and Rotin, 2006Go). At the MVB, proteins such as the Hrs-STAM (hepatocyte receptor substrate-signal transducing adaptor molecule) complex and the yeast Hse1-Vps27 complex bind Ub-cargo using multiple UIMs (ubiquitin interaction motifs) and help sort cargo into lumenal vesicles. At the TGN, the monomeric clathrin-associated GGA (Golgi-localized, gamma-ear containing, Arf-binding) proteins bind Ub via a GAT (GGA and TOM1) domain to facilitate cargo incorporation into transport vesicles targeted to endosomes. At the cell surface, Ub-binding proteins such as Epsin and Eps15, which also contain UIM motifs, participate in Ub-mediated internalization and may play a critical role in recognizing Ub-cargo for internalization (Hicke and Dunn, 2003Go).

The kinetics of lysosomal degradation of a particular membrane protein is tightly correlated with the extent of its ubiquitination (Hicke and Dunn, 2003Go). However, in some cases where a large proportion of a particular receptor undergoes lysosomal degradation, only a small proportion of the total receptor is ubiquitinated at any one time during its journey to the lysosome. One example is the degradation of the epidermal growth factor receptor (EGFR) via the ubiquitin ligase c-Cbl (Levkowitz et al., 1998Go; Lill et al., 2000Go). Accordingly, sustained ubiquitination coupled with the translocation of c-Cbl as it follows receptor from the cell surface to endosomes appears to be required for the efficient EGFR down-regulation (de Melker et al., 2001Go; Longva et al., 2002Go; Alwan et al., 2003Go). Together, these observations imply that although ubiquitination can initiate a sorting pathway to the lysosome at a variety of compartments, multiple rounds of ubiquitination must be sustained to efficiently commit a given cargo protein to the MVB/lysosomal degradation pathway. This model predicts that the competing actions of Ub peptidases and ligases would have ample opportunity to reverse or reinforce the decision to degrade a particular cargo protein as it progresses toward lysosomes (Urbe, 2005Go).

In yeast, the HECT-type Ub E3 Rsp5 is a broad specificity ligase required for ubiquitination of a variety of membrane protein cargo at multiple compartments. Loss of Rsp5 impairs ubiquitination of cell surface proteins and inhibits their internalization (Hicke and Dunn, 2003Go; Staub and Rotin, 2006Go). Rsp5 is also required for delivering proteins such as Cps1 to the vacuole interior via the MVB-sorting pathway and is required for sorting proteins such as Fur4 and Gap1 directly from the TGN to endosomes (Helliwell et al., 2001Go; Blondel et al., 2004Go; Dunn et al., 2004Go; Katzmann et al., 2004Go). Rsp5 belongs to the family of Nedd4-related E3 ligases that contain a number of domains that help adapt Rsp5 to a variety of ubiquitination roles. Rsp5 contains 3 WW domains, which can target Rsp5 to specific substrates or cofactors that contain a PY motif (Yashiroda et al., 1998Go; Wang et al., 1999Go; Hettema et al., 2004Go; Shcherbik et al., 2004Go). Rsp5 also contains an N-terminal C2 domain, which is required for proper ubiquitination of MVB cargo and likely facilitates association with Golgi and endosomal membranes that are enriched in phosphorylated phosphatidylinositols (Dunn et al., 2004Go). In addition, Rsp5 associates with other factors such as Bsd2 and Bul1/2 to facilitate ubiquitination of specific cargo proteins such as Cps1 or Gap1 (Helliwell et al., 2001Go; Soetens et al., 2001Go; Hettema et al., 2004Go). Recently, Rsp5 has been shown to interact with the Hse1-Vps27 complex and the mammalian Rsp5-related Itch ligase has been shown to interact with Hrs (Marchese et al., 2003Go; Bowers et al., 2004Go). The inferred function of these interactions is that they either foster ubiquitination of cargo or the Ub-recognition/sorting machinery, thus regulating its activity.

De-ubiquitinating peptidases (DUbs) have also been implicated in the process of Ub-dependent sorting of membrane proteins (Urbe, 2005Go; Millard and Wood, 2006Go). Specifically, Dubs have been found to associate with the Hrs-STAM Ub-sorting receptor complex, although the exact function of these associations remains to be fully deciphered. STAM associates with two DUbs via its SH3 domain: the UBP-family cysteine protease UBPY/USP8 and the JAMM-(JAB1/MPN/Mov34 metalloenzyme) domain metallo-protease AMSH (associated molecule with the SH3 domain of STAM; Tanaka et al., 1999Go; Kato et al., 2000Go). AMSH is activated upon binding the SH3 domain of STAM and shows preference for disassembling K63-linked Ub chains over K48-linked chains (McCullough et al., 2006Go). Depletion of AMSH accelerates degradation of EGFR, whereas overexpression of enzymatically inactive AMSH causes accumulation of ubiquitinated proteins on endosomes and the accumulation of ubiquitinated forms of STAM (McCullough et al., 2004Go). Depletion of UBPY also leads to accumulation of ubiquitinated proteins on endosomes as well as other changes to endosome morphology (Mizuno et al., 2005Go, 2006Go; Row et al., 2006Go). However, depletion of UBPY alters the trafficking of internalized EGFR and blocks its degradation, suggesting a potentially complex role for associated DUbs (Row et al., 2006Go; Mizuno et al., 2006Go).

In the present study, we find that Hse1, the yeast ortholog of STAM, associates with the E3 ligase Rsp5. Disrupting the interaction between Hse1 and Rsp5 impairs sorting of MVB cargo such as Cps1 to the vacuole interior without affecting the global function of Hse1. In contrast, Hse1 also associates with the counteracting DUb Ubp7, whose deletion increases the efficiency of Cps1 sorting. These data imply that the association of Hse1 with ligases and Dubs helps modify Ub-cargo in order to regulate its final disposition with respect to MVB sorting into the degradative pathway.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials, Yeast Strains, and Plasmids
Synthetic dextrose (SD) media was made using yeast nitrogen base containing ammonia and 2% glucose. Yeast nitrogen base was purchased from RPI Research Products International (Mt. Prospect, IL). Amino acid supplements were purchased from Bio101 (La Jolla, CA). Glutathione-agarose beads and calmodulin beads were purchased from Amersham Biosciences (Uppsala, Sweden). L-azetidine-2-carboxylic acid (ADCB), bathocuprione sulfonate (BCS), and cycloheximide was purchased from Sigma (St. Louis, MO). Zymolyase 100T was purchased from Seikagaku (East Falmouth, MA). Protease inhibitor mixture (complete) was purchased from Roche Molecular Biochemicals (Mannheim, Germany). The pCR2.1, pYES2.1, and pET151 TOPO cloning kits were purchased from Invitrogen (Carlsbad, CA). Ubiquitin derivatized with 7-amino-4-methylcoumarin (Ub-AMC) was purchased from Boston Biochemicals (Cambridge, MA). Anti-HA antibody was purchased from Covance Research Product (Berkeley, CA), anti-V5 from Invitrogen, and anti-6xHIS from Berkeley Antibody Company (Berkeley, CA), anti-green fluorescent protein (GFP) antibody from Clontech (Mountain View, CA), and HRP-linked secondary antibodies from Amersham Biosciences (Buckinghamshire, United Kingdom). Polyclonal antisera to Cps1 was kindly provided by D. Katzmann (Mayo Clinic, Rochester, MN). L-35S-methionine was purchased from PerkinElmer Life and Analytical Science (Boston, MA). The Saccharomyces cerevisiae Tandem Affinity Purification (TAP)-tagged and GFP-tagged collection (Ghaemmaghami et al., 2003Go) was obtained from Open Biosystems (Huntsville, AL).

S. cerevisiae strains used in this study are listed in Table 1. Gene disruptions were performed by replacing the entire open reading frame with the indicated selectable marker. For disruptions using the Kanr marker, the disruption cassette was amplified from the genomic DNA of the relevant strain from the yeast gene deletion project (Giaever et al., 2002Go). For disruptions using the URA3 marker, a disruption cassette was made by amplifying the URA3 gene from Kluyveromyces lactis using pUG72 (Gueldener et al., 2002Go) with oligos containing 50 base pairs of flanking DNA homologous to the insertion site. For disruptions using the his5+ marker, which is derived from Schizosaccharomyces pombe and complements the S. cerevisiae HIS3 gene, a disruption cassette was made by amplifying the His5 gene from K. lactis using pUG27 (Gueldener et al., 2002Go).


View this table:
[in this window]
[in a new window]

 
Table 1. Yeast strains used in this study

 
The hse1-{Delta}PY mutation was made by deleting the Hse1-C terminus Rsp5 binding motif PPPGYEQ within the HSE1 genomic locus. A HIS3-containing cassette was amplified from the plasmid pFA6a-GFP(S65T)-HIS3MX6 (Longtine et al., 1998Go) with oligos: ATACCCCACAATACGGTTATGATCTTGGATATTCAGTTGTTAGCCAATGAGGCGCGCCACTTCTAAA; CTTCGTAAAAATTAAAGATATGTAAAGGTGCTATATAAGTTGAAGGGGAATTCGAGCTCGTTTAAAC. The genomic DNA from transformants were then analyzed by PCR and sequencing to verify correct integration.

Plasmids used in this study are listed in Table 2. Plasmids expressing glutathione S-transferase (GST) fusion proteins of fragments of Hua1, Hse1, or Pex13 were made by subcloning an EcoRI-restricted PCR fragment into pGEX6p-1. For expression from the GAL1 promoter, PCR fragments of the open reading frames from Hua1, Ubp7, and Rup1 were subcloned into pYES2.1 TOPO (Invitrogen), which resulted in the introduction of a C-terminal V5 epitope. For expression in bacteria, gene fragments were subcloned into PET151D (Invitrogen) behind the T7 promoter and an N-terminal V5 epitope. The HA-Ub-GFP-Cps1 is composed of the RPL40B promoter followed by an HA epitope, Ub (residues 1–74) followed by the GFP-CPS1 fusion from pGO45.


View this table:
[in this window]
[in a new window]

 
Table 2. Plasmids used in this study

 
Deubiquitinating Enzyme Activity Assay by a Fluorogenic Substrate Ub-AMC
Bacterial lysate containing equal amount of recombinant Ubp7 fragments was diluted with reaction buffer (50 mM HEPES, 0.5 mM EDTA, pH 7.5, 0.1 mg/ml ovalbumin, and 1 mM DTT) and Ub-AMC (0.5 µM) was added to initiate the reaction. The enzyme activity was monitored as increased fluorescence at 460 nm using 380-nm excitation using a Hitachi 2000 Fluorescence Spectrophotometer (San Jose, CA).

Glutathione-Agarose Affinity Chromatography
GST-fusion proteins were isolated from bacteria using glutathione-Sepharose beads as previously described (Smith et al., 1988Go). Isolated GST fusion proteins, 250 µg of each, was bound to 50 µl of glutathione-Sepharose in phosphate-buffered saline (PBS) by rotation for 30 min at 25°C. Bound GST or GST fusion proteins were then pelleted and washed three times with PBS. Cell lysate was added to each protein/bead complex and incubated for 2 h at 4°C. Unbound proteins were removed from beads using four washes of IC buffer (100 mM KAc, 50 mM KCl, 200 mM sorbitol, 20 mM PIPES, pH 6.8), and the bound bead fraction was analyzed by SDS-PAGE and immunoblotting.

Calmodulin-Agarose Affinity Chromatography
Cells expressing TAP-tagged forms of Ubp2 or Hse1 were transformed with plasmids expressing epitope-tagged Hua1, Hse1, or Ubp7. Sorting defects were not evident in the Ubp2-Tap and Hse1-TAP strains, indicating that these tagged proteins were functional (data not shown). Nondenatured yeast lysates made from spheroplasts were with 50 µl of calmodulin beads in the presence of 2 mM CaCl2. Beads were washed four times in IC buffer and analyzed by immunoblot analysis.

Fluorescence Microscopy
Cells containing GFP-expressing plasmids were grown in SD media to midlog phase. Cells, 1 OD600, were pelleted and resuspended in 100 µl of KILL buffer (1 M Tris, pH 8.0, 5% sodium azide). Cells were viewed using an Olympus BX-60 microscope (Melville, NY) equipped with FITC filters and Nomarski optics. Images were captured with a Hamamatsu ORCA CCD camera (Bridgewater, NJ) as previously described (Urbanowski and Piper, 1999Go).

ADCB Sensitivity Assay
Yeast were first grown in SD media (ammonia) overnight, serially (1:5) diluted, and plated onto an SD plate containing 75 µg/ml ADCB as described previously (Scott et al., 2004Go).

Cell Labeling and Immunoprecipitation of Carboxypeptidase Y
Metabolic 35S-Met labeling and immunoprecipitation of carboxypeptidase Y (CPY) was performed as described previously (Cooper and Stevens, 1996Go).

Kinetics of Ste3-GFP Degradation
Cells were cultured to midlog phase and then adjusted to 100 µg/ml cycloheximide. Aliquots (4 OD600) were taken at various times after cycloheximide addition and stored on ice for up to 40 min in the presence of 0.2% NaAzide, 0.2% NaFluoride, 100 mM Tris, pH. 7.0. Proteins were then precipitated with in 10% TCA and analyzed by SDS-PAGE and immunoblotting with anti-GFP monoclonal antibodies.

Cell Labeling and Immunoprecipitation of Cps1
Yeast cells containing GFP-Cps1 were grown to midlog phase and labeled with [35S]methionine for 10 min. Denaturing immunoprecipitations were carried out as outlined previously (Katzmann et al., 2001Go). After labeling, yeast cultures were adjusted to 10 mM NEM and then precipitated by the addition of TCA (10% final). Protein pellets were resuspended in 6 M urea, 1% SDS, 50 mM Tris, pH 7.5, and 1 mM EDTA. Lysate was then diluted to a final composition of 0.6 M urea, 0.1% SDS, 1% Triton X-100, 50 mM Tris, pH 7.5, and 0.1 mM EDTA. Immunoprecipitation was performed as above for CPY except using anti-Cps1 polyclonal antibody. Immunoprecipitates were treated with endoglycosidase H before analysis by SDS-PAGE and autoradiography. Labeled proteins were detected on phosphorimaging screens (Packard Instruments, Meriden, CT).

Yeast Lysate Preparation
Yeast culture, 200 ml, was pelleted, washed in water, and resuspended in 5 ml of 0.1 M Tris-HCl, pH 9.4, 10 mM DTT for 5 min. Cells were pelleted and resuspended in 5 ml of spheroplast buffer (0.1x YPD, 1.0 M sorbitol, 25 mM Tris-HCl, pH 7.5, 250 µg of zymolyase 100T) for 30 min at 30°C. Spheroplasts were then layered onto a sucrose cushion (1.2 M sucrose, 20 mM HEPES, pH 7.2, 2 mM EDTA) and collected as a pellet after centrifugation at 7000 x g for 20 min. Cells were lysed in IC buffer with protease inhibitors and spun at 15,000 rpm for 15 min to collect the supernatant.

Bacterial Lysate Preparation
Bacteria cultures [500 ml; BL21(DE3)] were grown to exponential phase and induced with 1 mM IPTG for 4 h. Cells were pelleted and resuspended in 5 ml of PBS, pH 8.0, with protease inhibitors. Cells were then lysed by French Press lysis and followed by spinning down at 11,000 rpm for 20 min to remove the cell debris.

Ubiquitin-Vinyl-Methyl Ester Labeling
HA-tagged ubiquitin-vinyl-methyl-ester (HA-UbVME) was a kind gift from Hidde Ploegh (Whitehead Institute, Cambridge, MA). Lysates were made from yeast spheroplasts as above and labeled with HA-UbVME (2 µg/ml) for 30 min at 30°C and processed as described previously (Borodovsky et al., 2001Go, 2002Go).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Interactions of Hse1 with Peptidases and a Ubiquitin Ligase
The Hse1-Vps27 complex binds Ub and is required for sorting of ubiquitinated proteins into MVBs (Bilodeau et al., 2002Go). To better understand how this complex operates, we investigated the role of possible interactions between Hse1 and other proteins. One potential protein interaction site is the SH3 domain of Hse1, which is predicted to bind proteins with proline-rich motifs typical of SH3 interaction modules (Tong et al., 2002Go). We found that replacing the SH3 domain of Hse1 with that of Pex13 or mutation of the tryptophan residues that define the predicted hydrophobic binding face of the Hse1 SH3 domain (Yu et al., 1994Go) resulted in a complete loss of function (data not shown). Because these data indicated the SH3 domain performed a significant function, we sought to identify proteins that associate with Hse1. Previous large-scale protein interaction studies provided a list of candidate interacting proteins, among which were both Ub E3 ligases and DUbs (Tong et al., 2002Go; Bowers et al., 2004Go). These candidates were intriguing because their association with the Hse1-Vps27 complex indicated a potential mechanism to regulate the ubiquitination status of cargo. Using a series of protein-binding studies, we deduced a model for protein interactions shown in Figure 1a.


Figure 1
View larger version (46K):
[in this window]
[in a new window]

 
Figure 1. Interaction map of Hse1 with a ubiquitin ligase and ubiquitin peptidases. (a) Summary of interactions between Hse1, Ubp7, Hua1, and the Rsp5-Rup1-Ubp2 complex. (b) The SH3 domain of Hse1 binds Hua1 and Ubp7 in GST pulldown assays. GST fusion protein alone (Ø) or containing the wild-type Hse1 SH3 domain, a mutant (*) SH3 domain, or the SH3 domain from Pex13, were bound to GSH agarose and incubated with lysates from wild-type yeast (WT) expressing V5-epitope–tagged Ubp7 or V5-epitope–tagged Hua1. Bound fractions together with 10% of the input (lysate) were analyzed by immunoblotting. (c) Association of Hua1 with the Hse1-SH3 domain is direct and does not rely on the presence of Rup1. Hua1 from lysates of yeast lacking Rup1 (rup1{Delta}) or bacterial lysates expressing recombinant Hua1 was allowed to bind GST alone (Ø), GST-Hse1-SH3 domain, or GST fused to a mutant Hse1 SH3 domain. Bound fractions together with 10% of the input (lysate) were analyzed by immunoblotting. (d) Rsp5 and Rup1 interact with the C-terminal tail of Hse1 via a PY motif. A GST fusion protein containing the C-terminus of Hse1 (a.a. 275–452) or a truncated C-terminal fragment (*) lacking a the distal PPPGYEN (PY) motif (a.a. 275–445) were bound to GSH beads and incubated with lysates from wild-type (WT) yeast expressing HA-epitope–tagged Rsp5 or V5 epitope–tagged Rup1. Bound fractions together with 10% of the input lysate were analyzed by immunoblotting. (e) Interactions of Hua1. GST alone or GST fused to Hua1 were used in GST pulldown assays with lysates from yeast lacking Hse1 (hse1{Delta}) or both Hse1 and Rup1 (hse1{Delta} rup1{Delta}). Rup1 specifically bound GST-Hua1 independent of Hse1 while Rsp5 bound GST-Hua1 independent of Rup1 or Hse1. A recombinant Hse1 SH3 domain from bacterial lysates also bound to GST-Hua1. Shown is an immunoblot of bound fractions together with 10% of the input (lysate).

 
Hse1 Interacts with Ubp7
Because the mammalian Hse1 homolog STAM binds to two DUbs via its SH3 domain, we screened a subset of TAP-tagged DUb proteins for interaction with the Hse1 SH3 domain using GST pulldown assays (Rigaut et al., 1999Go). We found that Ubp7-TAP bound the Hse1 SH3 domain; however, Ubp7 is expressed at very low levels (Ghaemmaghami et al., 2003Go). Other DUbs such as Ubp6, Ubp1, and Doa4, which is localized with the class E Vps machinery, were not associated with Hse1 in our GST pulldown assays or immunoprecipitation assays (data not shown). To confirm the interaction between Ubp7 and the Hse1 SH3 domain, extracts from yeast expressing an epitope-tagged (V5) allele of UBP7 expressed via the GAL1 promoter were used in GST-SH3 pulldown experiments. Figure 1b shows that Ubp7-V5 specifically bound the SH3 domain of Hse1 but did not bind the SH3 domain of Pex13 nor the Hse1 SH3 domain containing mutations within the predicted ligand binding site (SH3*; Yu et al., 1994Go). To confirm that this interaction could occur in yeast lysates with full-length proteins, TAP-tagged Hse1 was isolated under nondenaturing conditions from lysates prepared from cells expressing Ubp7-V5. Figure 2 shows that Ubp7-V5 could specifically associate with Hse1-TAP, supporting the idea that these proteins associate in vivo.


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
Figure 2. Full-length Hse1 interacts with Ubp2 and Ubp7. Yeast strains expressing the indicated TAP-tag fusion proteins were transformed with plasmids expressing epitope-tagged Hse1, Hua1, or Ubp7 as indicated. Yeast lysates were made from spheroplasts and were passed over calmodulin Sepharose beads in the presence of 2 mM CaCl2. As a control for specificity, wild-type yeast that did not express a TAP-tagged fusion protein were used. Bound fractions were eluted and immunoblotted as indicated along with 10% equivalent of input lysate.

 
Using a series of recombinant protein fragments derived from Ubp7, we found that the Hse1-SH3 domain can bind directly to Ubp7 and requires a region from 487 to 600 that encompasses the putative SH3 ligand, K512RPPPPPPVS (Figure 3a). These results confirm previous predictions made from phage display and bioinformatics studies on all the SH3 domains in the yeast genome, which identified K512RPPPPPPVS as a likely binding peptide for the Hse1 SH3 domain (Tong et al., 2002Go). We also analyzed Ubp7 activity by covalently labeling yeast extracts with HA-UbVME, a chemical derivative of Ub that reacts with the active cysteine residue within papain-like Ub peptidases (Borodovsky et al., 2002Go). Previous experiments using this method have shown that the major DUbs labeled by this method are Ubp1, Ubp2, Ubp6, Ubp12, and Ubp15, and this labeling correlates with the estimated expression level of these DUbs (Borodovsky et al., 2001Go). In wild-type extracts, Ubp7, a ~125-kDa protein, is barely detectable, consistent with its estimated low level of expression (Ghaemmaghami et al., 2003Go). However, when Ubp7-V5 is overexpressed from the GAL1 promoter, a new band corresponding to Ubp7 was found labeled with HA-UbVME (Figure 3b). Inclusion of GST or the GST-Hse1-SH3 domain did not increase reactivity of Ubp7 to HA-UbVME, indicating that Ubp7 activity is not altered upon association with Hse1. The lack of enzyme activation differs to what is observed for the Hse1 homolog STAM and the AMSH Ub peptidase. In the latter case, AMSH is significantly activated once it is bound to the STAM SH3 domain (McCullough et al., 2006Go).


Figure 3
View larger version (45K):
[in this window]
[in a new window]

 
Figure 3. Direct binding of Ubp7 to the Hse1 SH3 domain does not alter activity. (a) V5-epitope tagged protein fragments of Ubp7 encompassing the designated residues made in E. coli were passed over GST fusion protein alone (Ø) or containing the wild-type Hse1 SH3 domain. Bound fractions were immunoblotted with anti-V5 along with a 10% equivalent of input lysate. At right is shown a schematic of Ubp7. The region that shares high homology to the catalytic domain of other Ubps is shown in white boxes. The putative SH3 ligand K512RPPPPPPVS is shown. (b) Ubp7 binds HA-UbVME. Yeast carrying vector plasmid or plasmid carrying UBP7 driven by the GAL1 promoter were grown in galactose and lysed. Lysates were preincubated with no additions or 100 µg/ml GST or GST-Hse1-SH3 fusion protein before labeling with HA-UbVME. Labeled extracts were analyzed by anti-HA immunoblotting. Arrows pointing to the positions of known DUbs are designated. A new band (*) corresponds to the predicted MW of Ubp7.

 
Hse1 Interacts with Rsp5
Previous interaction studies focused on the proteins involved in MVB sorting predicted that Hse1 associates with the Ub E3 ligase, Rsp5 (Bowers et al., 2004Go). Rsp5 contains an N-terminal lipid-binding C2 domain, three WW domains, and a C-terminal HECT ligase domain (Wang et al., 1999Go). We determined that there were two modes by which Hse1 could associate with Rsp5: first, by binding directly to a PY element within the Hse1 C-terminus, and second by binding to the novel Hua1 protein via the Hse1-SH3 domain (Figure 1a). Evidence that Rsp5 could bind directly to Hse1 came from attempts to identify yeast proteins that could interact with the WW domains of Rsp5 (J. Huibregste, unpublished data). A peptide library made of protein fragments encoded within the yeast genome that contained putative PY elements was screened for binding to a region of Rsp5 that encompassed its WW domains. This search identified a PY element within the extreme C-terminus of Hse1 (P446PPGYEQ) that could potentially interact with the Rsp5 WW domains. To confirm this interaction, extracts from cells expressing HA-epitope tagged Rsp5 were used in GST pulldown assays using a GST fusion to the C-terminal 179 residues (residues 275–453) of Hse1. Figure 1d shows that Rsp5-HA bound specifically to the C-terminus of Hse1 but not to the same fragment containing a deletion of the last seven residues that encode the PY element identified by the library screen. Figure 4a shows that a recombinant fragment encompassing the WW domains of Rsp5 was sufficient to bind the Hse1 C-terminus directly, whereas the HECT domain only bound very weakly.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
Figure 4. Hse1 interacts with Rsp5. (a) Binding of in vitro–translated Hse1 to GST-Rsp5 proteins. 35S-labeled Hse1 and Hse1 lacking the C-terminal Rsp5 binding PY element (Hse1-{Delta}PY) were translated in vitro using reticulocyte lysate and incubated with GST fusion proteins containing full-length Rsp5, a region containing the WW domains, or containing the HECT domain. Bound fractions were analyzed by SDS-PAGE and autoradiography together with 50% of the input reaction. (b) A schematic of the domain organization of Rsp5 and the regions corresponding to the recombinant protein fragments used. (c) V5-epitope tagged protein fragments of Rsp5 encompassing the designated residues made in E. coli were passed over GST fusion protein alone (Ø) or GST fused to Hua1. Bound fractions were immunoblotted with anti-V5 along with a 10% equivalent of input lysate.

 
Large-scale proteomic studies also indicated that Hse1 could interact with the Hua1 protein (Ito et al., 2001Go). HUA1 encodes an 22-kDa protein that contains a C-terminal Zn finger domain belonging to a subclass found within DnaJ proteins and that is thought to promote protein–protein interactions (Burri et al., 2004Go). Although there are no apparent Hua1 homologues in animal cells, Hua1-like genes are present in plants. Proteomic studies also indicated that Hua1 might interact with Rsp5 and Ubp2 (Ito et al., 2001Go). These proteins have recently been described in a novel complex that also contains Rup1, which mediates binding between Rsp5 and Ubp2 (Kee et al., 2005Go). Thus, we tested whether Hse1 could indeed associate with the Rsp5-Rup1-Ubp2 complex through Hua1. Using a series of Hse1 protein fragments, we found that Hua1 within yeast lysates readily bound the SH3 domain of Hse1 but not a mutant Hse1 SH3 domain with an alteration in the interaction surface (Figure 1b). Hua1 still bound the Hse1-SH3 domain in yeast lysates devoid Rup1, and we also found that recombinant Hua1 bound the Hse1-SH3 domain, indicating a direct interaction between these two components (Figure 1, d and e). A GST-Hua1 protein was able to bind Rsp5 from yeast lysates in the absence of Hse1 and Rup1, indicating that Hua1 associated with the Rsp5-Rup1-Ubp2 complex through binding Rsp5. Also, the C-terminal PY element of Hse1 not only bound Rsp5 but also retained Rup1 (Figure 1d). Both full-length Hua1 and Hse1 also associated with TAP-tagged Ubp2, indicating that these associations were relevant in vivo (Figure 2). We also found that GFP tagged Hua1, Rup1, and to some extent Ubp2 could accumulate on enlarged endosomal structures induced by dominant-negative VPS4, further supporting a role for these proteins on endosomes (Supplementary Data). We then confirmed a direct interaction of Hua1 with the region of Rsp5 containing the WW domains (residues 232-420; Figure 4c). These combined data showed that Hse1 has two interaction sites that are each independently capable of recruiting the Rsp5-Rup1-Ubp2 complex.

Function of the Hse1-Rsp5 Interaction
We hypothesized two potential roles for the interaction of Hse1 with the Rsp5 E3 ligase. One possibility is that this association helps modify ubiquitinated cargo, possibly reubiquitinating it to ensure efficient delivery of cargo into the degradative MVB-sorting pathway. This model predicts that perturbation of the Hse1-Rsp5 interaction will decrease the sorting efficiency of proteins that require ubiquitination into the MVB pathway but will not affect proteins that carry their own ubiquitination signal as an in-frame fusion or proteins that are very efficiently ubiquitinated and sorted to the vacuole interior. Alternatively, Rsp5 might regulate some general aspect of the Hse1-Vps27 sorting machinery, which could be required to sort a variety of Ub-dependent cargo proteins and possibly also be required for Hse1-Vps27 to mediate sorting of vacuolar hydrolases along the VPS (vacuolar protein sorting) pathway.

To functionally characterize the interaction of Hse1 with Rsp5, we first examined the sorting of GFP-Cps1 (Figure 5). GFP-Cps1 is transported along the biosynthetic pathway to the vacuolar lumen via the MVB-sorting pathway (Odorizzi et al., 1998Go). Sorting of GFP-Cps1 depends on proper ubiquitination of the lysine residues within its cytosolic N-terminal tail by Rsp5 (Katzmann et al., 2001Go, 2004Go). Sorting of GFP-Cps1 also depends on proper recognition and processing of that Ub-sorting signal by a host of proteins termed the class E Vps proteins, which are also required for the delivery of soluble hydrolases to the vacuole (Odorizzi et al., 1998Go). In cells that fail to properly ubiquitinate Cps1 or that lack proper class E Vps protein function, GFP-Cps1 accumulates on the limiting vacuolar membrane rather than within the vacuolar lumen. We found that cells containing an allele of HSE1 lacking the Rsp5-binding PY element (hse1-{Delta}PY) had only very minor defects in sorting GFP-Cps1. Likewise, disruption of the HUA1 gene (hua1{Delta}) also resulted in only minor defects in the sorting of GFP-Cps1. In contrast, GFP-Cps1 sorting was clearly defective when these mutations were combined (hua1{Delta} hse1-{Delta}PY double mutant), indicating that both modes of Hse1 interaction with Rsp5 contribute to proper sorting of Cps1 (Figure 5a).


Figure 5
View larger version (74K):
[in this window]
[in a new window]

 
Figure 5. Effect of disrupting association of Hse1 with Rsp5. (a) The extent of sorting of GFP-Cps1 to the vacuole interior was visualized in wild-type (WT) cells and the indicated mutant cells grown in SD media to midlog phase. Also shown is the corresponding DIC image. (b) Sorting of Fth1-GFP-Ub, Ste3-GFP, and Ub-GFP-Cps1 to the vacuole is normal in wild-type and mutant cells. Cells were transformed with Ste3-GFP– or Ub-GFP-Cps1–producing plasmid and grown in SD or Fth1-GFP-Ub–producing plasmid grown in SD media containing 100 µM BPS to midlog phase before photography. (c) Neither disrupting association of Hse1 with Rsp5 nor deletion of UBP2 or RUP1 results in secretion of vacuolar proteases. Wild-type and the indicated mutant cells were pulse labeled with 35S-Met for 10 min and chased with cold Met for 60 min. CPY was immunoprecipitated from intracellular (I) and extracellular/secreted (E) fractions and analyzed by SDS-PAGE and autoradiography. A CPY secretion phenotype was observed only for hse1{Delta}; all the other mutants analyzed sorted CPY normally. (d) Ste3-GFP degradation is delayed in ubp2{Delta} cells but not in hua1{Delta}hse1-{Delta}PY cells. Wild-type and ubp2{Delta} and hua1{Delta} hse1-{Delta}PY cells expressing Ste3-GFP were grown at 30°C to midlog phase in SD media. Cells were harvested at 0, 5, 10, and 30 min after cycloheximide addition. Samples were examined by SDS-PAGE and Western blotting with anti-GFP antibodies.

 
In contrast, MVB cargo that is sorted by virtue of an in-frame fusion of Ub, which does not rely on ligase-mediated ubiquitination for MVB sorting, was sorted correctly in hua1{Delta} hse1-{Delta}PY double mutant cells. Figure 5b shows that the Fth1-GFP-Ub fusion reporter, which is sorted into the vacuolar lumen via a C-terminal Ub fusion (Urbanowski and Piper, 2001Go), was found entirely within the vacuolar lumen. Ub-GFP-Cps1, in which Ub is fused to the N-terminus of GFP-Cps1, was also found entirely within the vacuolar lumen (Figure 5b). We also found that unlike hse1{Delta} cells, the hua1{Delta} hse1-{Delta}PY cells were able to properly sort CPY to the vacuole (Figure 5c). Finally, hua1{Delta} hse1-{Delta}PY cells did not accumulate an exaggerated "class E" endosomal compartment, which is observed in class E vps mutant strains including hse1{Delta} (Raymond et al., 1992Go; Bilodeau et al., 2002Go). Together, these data suggest that the defect incurred by the hua1{Delta} hse1-{Delta}PY mutant affected only the efficiency of GFP-Cps1 ubiquitination but not the downstream processes of recognizing and sorting Ub-cargo.

We also found that Ste3 (Ste3-GFP), a G-protein–coupled receptor that undergoes efficient internalization from the cell surface and delivery to the vacuole lumen (Davis et al., 1993Go), was also delivered to the vacuole lumen in hua1{Delta} hse1-{Delta}PY cells (Figure 5b). Even though vacuolar degradation of GPCRs Ste3 and Ste2 depend on proper Rsp5 function (Roth and Davis, 2000Go; Dunn and Hicke, 2001Go), the accumulation of Ste3-GFP in the vacuole that we observe in these mutants likely reflects a very high overall efficiency of Ste3 ubiquitination and MVB sorting, making their steady state accumulation in the vacuole lumen less sensitive to perturbations in the ubiquitination machinery or the Ub sorting machinery. Previous experiments have shown that although mutations in Rsp5 can result in the accumulation of Cps1 at the vacuole surface, those same mutations do not block accumulation of Ste2 (Dunn and Hicke, 2001Go; Dunn et al., 2004Go) or Ste3 (D. Katzmann, personal communication) in the vacuole. Likewise, mutations that partially block Ub-recognition by the Hse1-Vps27 complex or that compromise interactions among the class E Vps proteins can affect sorting of Cps1 and Fth1-GFP-Ub without being severe enough to alter the steady state distribution of Ste3 in the vacuole (Bilodeau et al., 2002Go, 2003Go). This could be due to fact that Ste3 is multiply ubiquitinated, which could carry it past a further requirement for additional ubiquitination at the endosomal Hse1-Vps27 sorting complex. In addition, Ste3 has been shown to recycle from endosomes, perhaps allowing underubiquitinated Ste3 to have repeated contact with the endosomal MVB machinery, whereas proteins such as Cps1 and Fth1-GFP-Ub are merely delivered to the vacuolar surface without the ability to be resurveyed by the MVB-sorting machinery.

We also found that sorting of GFP-Cps1 was affected in rup1{Delta} and ubp2{Delta} mutants, which would disrupt the function of the Rsp5-Rup1-Ubp2 complex recruited to Hse1 (Figure 5a). Although the steady state distribution of Ste3-GFP looked normal in ubp2{Delta} mutants, we did find that the kinetics of its delivery and degradation in the vacuole were slightly delayed (Figure 5d). This was measured using a cycloheximide chase to inhibit new synthesis of Ste3-GFP while measuring the depletion of existing Ste3-GFP over 15 min. In contrast, proteins such as Fth1-GFP-Ub and Ub-GFP-Cps1, which do not require cellular ubiquitination, still accumulated within the vacuolar lumen (Figure 5b). Furthermore, sorting of newly synthesized CPY to the vacuole measured by pulse/chase analysis was unaffected, again indicating that the Hse1-Vps27 machinery was functioning normally but that certain cargos such as Cps1 failed to be temporally or spatially ubiquitinated properly (Figure 5c). This was surprising in view of previous data suggesting that Ubp2 antagonized various aspects of Rsp5 activity (Kee et al., 2005Go). In particular, loss of Ubp2 enhanced the ability of Rsp5 to ubiquitinate and process the transcription factor Spt23. Our data indicated that loss of Ubp2 or Rup1 compromised Ub-dependent vacuolar sorting in a manner that mimicked loss of Rsp5 activity.

Ubp7 Counteracts Rsp5
The above data indicated that Rsp5 associates with Hse1 to help ubiquitinate cargo and thus increase the efficiency by which particular cargo proteins would undergo MVB sorting. Likewise, we wanted to determine whether Ubp7 acted in an opposing way, to perhaps deubiquitinate cargo, making sorting less efficient.

Disrupting UBP7 alone had no affect on the sorting of GFP-Cps1, Ste3-GFP, Fth1-GFP-Ub, or Ub-GFP-Cps1 (Figure 6 and data not shown). However, because these reporter proteins are already sorted efficiently in wild-type cells, any increase in sorting efficiency afforded by loss of Ubp7 would be undetected. Therefore, we analyzed the effect of Ubp7 in cells where the efficiency of GFP-Cps1 sorting had been compromised by mutations affecting the ligase machinery. Figure 6 shows that although ubp2{Delta} mutants are defective in sorting GFP-Cps1 to the vacuole interior, additional loss of Ubp7 (ubp2{Delta} ubp7{Delta}) restored efficient sorting. Furthermore, although the hua1{Delta} hse1-{Delta}PY mutant showed defects in GFP-Cps1 sorting, proper sorting of GFP-Cps1 was restored upon further deletion of UBP7.


Figure 6
View larger version (54K):
[in this window]
[in a new window]

 
Figure 6. Loss of Ubp7 increases efficiency of sorting GFP-Cps1 into the vacuole interior. Wild-type cells and the indicated mutants expressing GFP-Cps1 were grown to midlog phase in SD media and visualized for the extent of GFP-Cps1 sorting to the vacuole interior.

 
A Broader Role for Ubp2 in Ub-dependent Sorting
Experiments in Figures 5 and 6 showed the surprising result that Ubp2, which can antagonize some functions of Rsp5, actually boosts the efficiency of Cps1 sorting into the MVB. These results indicated that Ubp2 is somehow required for Rsp5 to be effective at ubiquitinating proteins for efficient entry into the MVB-sorting pathway. We next wanted to determine whether the effects of UBP2 deletion or the effects of perturbing the interaction of Rsp5 with Hse1 were specific for MVB sorting or whether there were consequences for other Ub-dependent sorting steps. One such step is the Ub-dependent sorting pathway from the Golgi to the endosome taken by ubiquitinated proteins such as Gap1, Fur4, Tat2, and mutant forms of Pma1 (Beck et al., 1999Go; Helliwell et al., 2001Go; Blondel et al., 2004Go; Pizzirusso and Chang, 2004Go). In poor nitrogen conditions, newly synthesized Gap1 is sorted to the plasma membrane where it stably resides to effect amino acid transport. In nitrogen-rich conditions, Gap1 is ubiquitinated and moves directly from the Golgi to endosomes where it is subsequently sorted into the MVB pathway (Roberg et al., 1997Go). The Ub-dependent Golgi-to-endosome routing of Gap1 depends on the GGA coat proteins, which are thought to recognize ubiquitinated cargo proteins at the TGN and package them into clathrin-coated vesicles targeted to endosomes (Bilodeau et al., 2004Go; Scott et al., 2004Go). To test whether the Ub-dependent targeting of Gap1 to endosomes was compromised, we first measured sensitivity to the toxic proline-like compound ADCB, a crude measure of how much Gap1 is on the cell surface (Figure 7a). ADCB is transported by Gap1 and sensitivity to ADCB correlates with the level of Gap1 at the cell surface (Hoshikawa et al., 2003Go; Andreasson et al., 2004Go). We found that that there was no difference in ADCB toxicity between wild-type cells and hse1-{Delta}PY hua1{Delta} double mutant cells, indicating that complex formation between Hse1 and Rsp5 was not required to prevent Gap1 sorting to the plasma membrane. These data indicate that the Hse1-Rsp5 interaction has a function restricted to endosomes, consistent with the localization of the Hse1-Vps27 complex and corresponding STAM-Hrs complex to endosomal compartments (Komada et al., 1997Go; Bache et al., 2003Go). We did observe a small increase in ADCB sensitivity in hse1{Delta} cells, a result expected because full disruption of HSE1 leads to a "class E" phenotype, which can foster recycling of transporters such as Gap1 and Fur4 back to the cell surface (Nikko et al., 2003Go; Bugnicourt et al., 2004Go). We also found that loss of Bsd2, which interacts with Rsp5 and helps direct ubiquitination of a variety of ubiquitinated cargo (Hettema et al., 2004Go; Stimpson et al., 2006Go), also was slightly sensitive to ADCB. In contrast, we saw marked sensitivity to ADCB in strains lacking Rup1 or Ubp2. The ADCB sensitivity in rup1{Delta} and ubp2{Delta} strains could be explained by a loss in Ub-dependent Golgi-to-endosome sorting of Gap1, resulting in more initial deposition of Gap1 at the cell surface. Alternatively, ADCB sensitivity could result from stabilization of the fraction of Gap1 transporters that are transported to the cell surface when cells are grown in SD media.


Figure 7
View larger version (64K):
[in this window]
[in a new window]

 
Figure 7. Rup1 and Ubp2 contribute to the ubiquitin-dependent trafficking of amino acid permeases. (a) Loss of Ubp2 or Rup1 renders cells sensitive to the proline analog ADCB. Wild-type (WT) and the indicated mutant cells were serially diluted and grown on plates containing SD alone or also containing 75 µg/ml ADCB. (b) Loss of UBP2 results in some rerouting of Gap1 from the Golgi to the cell surface in nitrogen-replete conditions. The indicated mutant cells were transformed with a plasmid expressing Gap1-GFP under the control of the CUP1 promoter. Cells were grown in YPD and induced for Gap1-GFP expression for 8 h with the addition of 100 µM CuSO4. The end3{Delta} ubp2{Delta} cells showed a fraction of the Gap1-GFP at the cell surface, whereas end3{Delta} mutants did not. (c) Mutant ubp2{Delta} cells are more sensitive to ADCB than end3{Delta} mutant cells. The indicated strains were grown on SD plates with or without 75 µg/ml ADCB. (d) Loss of Ubp7 does not suppress the ADCB sensitivity of ubp2{Delta} mutants. The indicated strains were grown on plates containing SD alone or also containing 75 µg/ml ADCB.

 
To determine whether the Golgi-to-endosome route was affected, we analyzed the distribution of Gap1-GFP in end3{Delta} cells, in which internalization from the cell surface is blocked, and end3{Delta} ubp2{Delta} double mutant cells (Figure 7b). Cells were grown in nitrogen-rich YPD media to maximize ubiquitination and delivery of Gap1-GFP to endosomes. Under these conditions, end3{Delta} cells showed low to undetectable levels of Gap1-GFP fluorescence at the cell surface, consistent with previous results (Bilodeau et al., 2004Go; Scott et al., 2004Go). Instead, all the Gap1-GFP was delivered to the vacuole lumen. However, in end3{Delta} ubp2{Delta} cells Gap1-GFP was clearly observed at the cell surface in addition to the intravacuolar compartment, indicating that a fraction of Gap1 was misrouted to the cell surface in the absence of Ubp2. As further evidence, we compared the ADCB sensitivity of wild-type and end3{Delta} and end3{Delta} ubp2{Delta} cells. If increased ADCB sensitivity from loss of Ubp2 was caused only by inhibiting internalization of Gap1 from the cell surface, then loss of Ubp2 should not increase sensitivity beyond that of an end3{Delta} single mutant where internalization is essentially blocked (Raths et al., 1993Go). Although the end3{Delta} mutation alone conferred some sensitivity to ADCB, both ubp2{Delta} and end3{Delta} ubp2{Delta} double mutants were far more sensitive to ADCB (Figure 7c). Thus, although collectively these results cannot eliminate the possibility that Ub-dependent internalization from the cell surface is also compromised by loss of Ubp2, they do show that at some level the Ub-dependent trafficking step from the Golgi to endosomes is less efficient in ubp2{Delta} and rup1{Delta} cells.

We also examined the effect of deleting UBP7 on ADCB sensitivity. We found that loss of Ubp7 did not increase resistance to ADCB in either cells that were otherwise wild-type or ubp2{Delta} (Figure 7d) or rup1{Delta} cells (data not shown). These results suggested that although Ubp2 functions broadly in the post-Golgi/endocytic system at a different Ub-dependent sorting steps, Ubp7 plays a much more restricted role perhaps limited only to the endosomal MVB-sorting step.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
One of the key steps in sorting ubiquitinated cargo proteins into the MVB lumen for degradation is their recognition by Ub-sorting receptors (Raiborg et al., 2003Go; Gruenberg and Stenmark, 2004Go). One such receptor complex is the Hse1-Vps27 complex, whose mammalian equivalent is the Hrs-STAM complex. Both complexes localize to endosomes and interact with clathrin and other "class E" Vps proteins to effect MVB formation and protein sorting (Komada and Kitamura, 2005Go). Our data indicate that the Hse1 subunit can associate with both a Ub ligase and Ub peptidases and that this association is primarily directed at regulating the ubiquitination of cargo. Importantly, none of the alterations we made in the ubiquitination/deubiquitination machinery affected the general properties of the sorting machinery with regard to its ability to sort "constitutively" ubiquitinated cargo or other functions required for correct sorting of CPY (vacuolar protein sorting). Thus, although ubiquitination of the sorting machinery could still exist as a form of regulation or as part of a cycle of reactions that drives MVB sorting as has been proposed by various models (Polo et al., 2002Go; Hicke and Dunn, 2003Go), we found no evidence that the ligase and DUb interactions described here contribute in such a manner. Rather, the association of the Hse1-Vps27 complex is important for a subset of cargo that requires ubiquitination and may serve to alter the ubiquitination status of cargo right at the site where it is recognized by the sorting receptor. This role for the DUbs studied here contrasts with that for Doa4, a endosome-associated deubiquitinating enzyme required to strip ubiquitin off of cargo after it has been recognized by Ub-sorting receptors and after it is committed to incorporation into the MVB lumen (Amerik et al., 2000Go). Our data are consistent with a broader notion that a single ubiquitination event is not sufficient to carry a substrate protein all the way through a series of Ub-dependent trafficking steps to the lysosome interior (Urbe, 2005Go). Rather, a particular cargo protein may have to be repeatedly ubiquitinated at multiple compartments in order to complete its designated itinerary to the lysosomal/vacuolar interior. Indeed, our attempt to measure the extent of ubiquitination of GFP-Cps1 using published methods did not show any differences in the level of ubiquitinated GFP-Cps1 in our mutant strains (Supplementary Data). However, these assays can only examine the ubiquitination of the bulk of newly synthesized GFP-Cps1, which can be generated well before Cps1 arrives at the endosome. Currently, the tools to specifically examine the smaller but functionally relevant pool of cargo that is undergoing sorting at the endosome surface remain to be developed. Thus, the total level of ubiquitinated protein measured may not reflect the active pool that is undergoing the sorting process and that would be acutely modified by ligases and DUbs under the model we propose here. Such a model also invokes that there would be counteracting Ub-peptidases at multiple compartments that would compete with ligase activity over the final ubiquitination status and thus targeting of cargo proteins.

The association of Hse1 with Rsp5 is mediated in part by a PY element in the C-terminus of Hse1 and by the novel protein Hua1, which can bind directly and simultaneously to the WW domains of Rsp5 and the SH3 domain of Hse1. Elimination of both connections to Rsp5 was required to see a significant sorting defect for the MVB cargo protein GFP-Cps1 but not the Ub-fusion reporter Fth1-GFP-Ub of Ub-GFP-Cps1. Proper sorting of GFP-Cps1 is sensitive to loss of function of either the machinery responsible for ubiquitinating GFP-Cps1 as well as the sorting machinery itself that recognizes Ub-cargo (Katzmann et al., 2001Go, 2004Go). In contrast, Fth1-GFP-Ub, which contains an in-frame fusion of ubiquitin is sensitive only to compromised sorting machinery and not loss of ubiquitination machinery (Bilodeau et al., 2002Go). The differential sensitivity of these two markers suggests that the association of Rsp5 with Hse1 helps promote ubiquitination of cargo at the correct time and place in the cell to increase the sorting efficiency of cargo into the MVB. These data imply that there is tight coupling between regulation of substrate ubiquitination and the recognition of ubiquitinated substrates, perhaps providing a failsafe mechanism for properly designating cargo for degradation.

Interestingly, Rsp5 is found heavily associated with clathrin (Kee et al., 2005Go). Rsp5 has also been shown to localize to endosomal compartments in wild-type cells and exaggerated endosomes that accumulate in class E vps mutants (Wang et al., 2001Go). We have found that the localization of Rsp5 to endosomes in class E mutants persists even in the absence of Hse1-Vps27 complex (data not shown). Thus, it may be that Rsp5 can associate with other endosomal proteins to affect specific ubiquitination events or be coupled directly with other clathrin-mediated Ub-dependent sorting events such as the GGA/clathrin-mediated sorting of Ub-cargo to endosomes directly from the TGN.

The association of Rsp5 with Hse1 may be functionally analogous to the association of other Nedd4-family ligases with the Hrs-STAM complex in animal cells (Marchese et al., 2003Go). Here, the E3 ligase Itch associates with Hrs on early endosomes and modifies both cargo, namely CXCR4, and also the sorting machinery such as Hrs. Conceivably, the latter action could regulate the activity of Hrs by promoting intra- or intermolecular interactions, as has been proposed by others (Polo et al., 2002Go; Hoeller et al., 2006Go). With respect to the Rsp5-Hse1 interaction, our data indicate that the general sorting functions of the Hse1-Vps27 complex is intact and capable of properly sorting proteins that are properly ubiquitinated. Furthermore, we have not been able to detect ubiquitinated forms of Hse1 or Vps27 in wild-type or ubp7{Delta} mutant strains (data not shown). Thus, the function Rsp5 association with Hse1 may be restricted to only modifying cargo.

The Hrs-STAM complex can also associate with two DUbs via the SH3 domain of STAM, AMSH, and UBPY/USP8 (Urbe, 2005Go). AMSH is activated when bound to the STAM SH3 domain, and loss of AMSH increases lysosomal degradation of EGFR by allowing c-Cbl to sustain higher levels of ubiquitinated EGFR. Ubp7 appears to function analogously by associating with the SH3 domain of Hse1 to antagonize MVB sorting of Cps1. Disruption of Ubp7 could increase Cps1 sorting to the vacuole interior when Rsp5 activity was otherwise compromised. Other functions such as Gap1 sorting as inferred from ADCB sensitivity and vacuolar protein sorting were unaltered by loss of Ubp7, suggesting that Ubp7 plays a restricted role at endosomes to modify ubiquitinated cargo before sorting. It may also be possible that loss of Ubp7 fosters the association of Rsp5 with some other DUb that would partly suppress loss of Ubp2 or loss of Hse1 association. STAM also associates with UBPY, yet the role of this DUb is complex because its loss destabilizes the Hrs-STAM sorting complex (Row et al., 2006Go; Mizuno et al., 2006Go). A similar role for Ubp7 is not supported by our data.

Together these results suggest that Rsp5 associates with the Hse1-Vps27 sorting complex in order to "reubiquitinate" cargo and increase its efficiency of sorting. This provides a potential mechanism whereby the degradation of specific cargos could be regulated or the overall sorting efficiency of the complex is controlled by modulating association of Ubp7 or Rsp5. Indeed, our data suggest that the DUb Ubp7- and Rsp5-associated Hua1 proteins bind to the same SH3 domain interface, suggesting these two competing activities can also compete for occupancy on Hse1. Determining how the balance between ubiquitination versus deubiquitination might be controlled and whether this balance influences the general throughput of the MVB-sorting process or is largely specific to particular cargo has yet to be resolved. Altered expression levels of either the DUbs (McCullough et al., 2004Go; Mizuno et al., 2005Go) or ligases (Dunn et al., 2004Go; Katzmann et al., 2004Go) do affect MVB sorting and could represent a bona fide mode of regulating the complex. Alternatively, Hrs and STAM are known to interact with various signaling pathways that results in their phosphorylation (Row et al., 2005Go) or association with G{alpha}s (Zheng et al., 2004Go), which could in turn affect their association with E3 ligases or DUbs.

Interestingly, we found that the complex between Rsp5, Rup1, and Ubp2 is required for efficient Ub-dependent trafficking of cargo not only at the MVB-sorting step but also at the Golgi. Because the sorting defects associated with loss of Rup1 or Ubp2 did not include a loss of sorting "constitutively" ubiquitinated cargo like Fth1-GFP-Ub or loss of vacuolar protein sorting, these results indicate that Ubp2 and Rup1 are required to properly ubiquitinate cargo before sorting. Thus, in contrast to its previously described role in antagonizing Rsp5 activity with regard to Ub-dependent processing of the Spt23 transcription factor (Kee et al., 2005Go), physical linkage of Ubp2 to Rsp5 accentuates Rsp5's ability to effect Ub-dependent trafficking steps throughout the TGN/Endocytic pathway.

How Ubp2 accentuates Rsp5 activity specifically with regard to sorting and not other events is unclear. Other complexes between Ub ligases and DUbs have been noted, some of which may function to destabilize the DUb or to rescue the ligase from the effects of autoubiqitination. These explanations, however, are neither unlikely to apply to the function of the Rsp5-Rup1-Ubp2 complex in sorting. Rsp5 levels are not affected by loss of Ubp2 nor is the stability of Rsp5 altered when its potential for self ubiquitination is removed by mutation of its active site (Wang et al., 1999Go; Kee et al., 2005Go). Another possibility is that loss of Ubp2 might also shift more of the Ub pool into conjugates that might then deplete free ubiquitin levels. Still, these scenarios would not explain the opposite effects of UBP2 deletion on Rsp5-dependent Spt23 processing and proteins sorting to the lysosome. We envisage three possibilities. One possibility would be that Rup1 and Ubp2 help recruit Rsp5 to a particular compartment, to a particular set of potential substrates, or to a particular sorting step. This model is similar to what has been proposed for other Rsp5-binding proteins such as Bsd2 complex, Bsd2-related proteins, and Tul1 (Reggiori and Pelham, 2002Go; Hettema et al., 2004Go). A second possibility is that proteins such as Bsd2 or Bul1/2, which specify Rsp5 activity, may require Ubp2 for stabilization against Rsp5-mediated ubiquitination that could alter their effectiveness or stability. Interestingly, Rsp5-interacting proteins such as the Tre1-Bsd2 complex are ubiquitinated and degraded through their association with Rsp5 (Stimpson et al., 2006Go). A third possibility may be that Ubp2 could specify how Rsp5 modifies its substrates. A similar model has been proposed for the Bul1/2 proteins that associate with Rsp5 to perhaps promote formation of polyubiquitin chains (Helliwell et al., 2001Go). Rsp5 and Ubp2 show specificity for polymerization and depolymerization of K63 polyUb chains in vitro (Kee et al., 2005Go). Furthermore, K63 linked ubiquitin chains have been found on a variety of ubiquitinated membrane proteins that undergo lysosomal degradation (Hicke and Dunn, 2003Go). Perhaps, Ubp2 might help trim K63-linked polyubiquitin chains on Ub-cargo to facilitate binding and processing by the Ub-recognition machinery at various sorting sites within the post-Golgi/endocytic pathway. Indeed, recent experiments have shown that loss of UBP2 results in aberrant accumulation of K63 polyubiquitin chains, which appear detrimental for proper sorting of Gap1 (Kee et al., 2006Go).


    ACKNOWLEDGMENTS
 
We thank Scott Moye-Rowley for helpful suggestions. This work was supported by National Institutes of Health (NIH) Grant R01 GM58202 to R.C.P., an American Heart Association predoctoral fellowship Grant 0515640Z to J.R., and NIH Grant R01 CA072943 to J.M.H.


    Footnotes
 
Formula The online version of this contains supplemental material at MBC Online (http://www.molbiolcell.org). Back

This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-06-0557) on November 1, 2006.

Address correspondence to: Robert C. Piper (Robert-Piper{at}uiowa.edu)


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Alwan, H. A., van Zoelen, E. J., van Leeuwen, J. E. (2003). Ligand-induced lysosomal epidermal growth factor receptor (EGFR) degradation is preceded by proteasome-dependent EGFR de-ubiquitination. J. Biol. Chem 278, 35781–35790.[Abstract/Free Full Text]

Andreasson, C., Neve, E. P., Ljungdahl, P. O. (2004). Four permeases import proline and the toxic proline analogue azetidine-2-carboxylate into yeast. Yeast 21, 193–199.[CrossRef][Medline]

Amerik, A. Y., Nowak, J., Swaminathan, S., Hochstrasser, M. (2000). The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol. Biol. Cell 10, 3365–3380.

Bache, K. G., Raiborg, C., Mehlum, A., Stenmark, H. (2003). STAM and Hrs are subunits of a multivalent ubiquitin-binding complex on early endosomes. J. Biol. Chem 278, 12513–12521.[Abstract/Free Full Text]

Beck, T., Schmidt, A., Hall, M. N. (1999). Starvation induces vacuolar targeting and degradation of the tryptophan permease in yeast. J. Cell Biol 146, 1227–1238.[Abstract/Free Full Text]

Bilodeau, P. S., Urbanowski, J. L., Winistorfer, S. C., Piper, R. C. (2002). The Vps27p Hse1p complex binds ubiquitin and mediates endosomal protein sorting. Nat. Cell Biol 4, 534–539.[Medline]

Bilodeau, P. S., Winistorfer, S. C., Allaman, M. M., Surendhran, K., Kearney, W. R., Robertson, A. D., Piper, R. C. (2004). The GAT domains of clathrin-associated GGA proteins have two ubiquitin binding motifs. J. Biol. Chem 279, 54808–54816.[Abstract/Free Full Text]

Bilodeau, P. S., Winistorfer, S. C., Kearney, W. R., Robertson, A. D., Piper, R. C. (2003). Vps27-Hse1 and ESCRT-I complexes cooperate to increase efficiency of sorting ubiquitinated proteins at the endosome. J. Cell Biol 163, 237–243.[Abstract/Free Full Text]

Blondel, M. O., Morvan, J., Dupre, S., Urban-Grimal, D., Haguenauer-Tsapis, R., Volland, C. (2004). Direct sorting of the yeast uracil permease to the endosomal system is controlled by uracil binding and Rsp5p-dependent ubiquitylation. Mol. Biol. Cell 15, 883–895.[Abstract/Free Full Text]

Borodovsky, A., Kessler, B. M., Casagrande, R., Overkleeft, H. S., Wilkinson, K. D., Ploegh, H. L. (2001). A novel active site-directed probe specific for deubiquitylating enzymes reveals proteasome association of USP14. EMBO J 20, 5187–5196.[CrossRef][Medline]

Borodovsky, A., Ovaa, H., Kolli, N., Gan-Erdene, T., Wilkinson, K. D., Ploegh, H. L., Kessler, B. M. (2002). Chemistry-based functional proteomics reveals novel members of the deubiquitinating enzyme family. Chem. Biol 9, 1149–1159.[CrossRef][Medline]

Bowers, K., Lottridge, J., Helliwell, S. B., Goldthwaite, L. M., Luzio, J. P., Stevens, T. H. (2004). Protein-protein interactions of ESCRT complexes in the yeast Saccharomyces cerevisiae. Traffic 5, 194–210.[CrossRef][Medline]

Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115–132.[CrossRef][Medline]

Bugnicourt, A., Froissard, M., Sereti, K., Ulrich, H. D., Haguenauer-Tsapis, R., Galan, J. M. (2004). Antagonistic roles of ESCRT and Vps class C/HOPS complexes in the recycling of yeast membrane proteins. Mol. Biol. Cell 15, 4203–4214.[Abstract/Free Full Text]

Burri, L., Vascotto, K., Fredersdorf, S., Tiedt, R., Hall, M. N., Lithgow, T. (2004). Zim17, a novel zinc finger protein essential for protein import into mitochondria. J. Biol. Chem 279, 50243–50249.[Abstract/Free Full Text]

Cooper, A. A. and Stevens, T. H. (1996). Vps10p cycles between the late-Golgi and prevacuolar compartments in its function as the sorting receptor for multiple yeast vacuolar hydrolases. J. Cell Biol 133, 529–541.[Abstract/Free Full Text]

Davis, N. G., Horecka, J. L., Sprague, G. F. Jr. (1993). Cis- and trans-acting functions required for endocytosis of the yeast pheromone receptors. J. Cell Biol 122, 53–65.[Abstract/Free Full Text]

de Melker, A. A., van der Horst, G., Calafat, J., Jansen, H., Borst, J. (2001). c-Cbl ubiquitinates the EGF receptor at the plasma membrane and remains receptor associated throughout the endocytic route. J. Cell Sci 114, 2167–2178.[Abstract/Free Full Text]

Dunn, R. and Hicke, L. (2001). Domains of the Rsp5 ubiquitin-protein ligase required for receptor-mediated and fluid-phase endocytosis. Mol. Biol. Cell 12, 421–435.[Abstract/Free Full Text]

Dunn, R., Klos, D. A., Adler, A. S., Hicke, L. (2004). The C2 domain of the Rsp5 ubiquitin ligase binds membrane phosphoinositides and directs ubiquitination of endosomal cargo. J. Cell Biol 165, 135–144.[Abstract/Free Full Text]

Gajewska, B., Kaminska, J., Jesionowska, A., Martin, N. C., Hopper, A. K., Zoladek, T. (2001). WW domains of Rsp5p define different functions: determination of roles in fluid phase and uracil permease endocytosis in Saccharomyces cerevisiae. Genetics 157, 91–101.[Abstract/Free Full Text]

Ghaemmaghami, S., Huh, W. K., Bower, K., Howson, R. W., Belle, A., Dephoure, N., O'Shea, E. K., Weissman, J. S. (2003). Global analysis of protein expression in yeast. Nature 425, 737–741.[CrossRef][Medline]

Giaever, G., et al. (2002). Functional profiling of the Saccharomyces cerevisiae genome. Nature 418, 387–391.[CrossRef][Medline]

Gruenberg, J. and Stenmark, H. (2004). The biogenesis of multivesicular endosomes. Nat. Rev. Mol. Cell Biol 5, 317–323.[CrossRef][Medline]

Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D., Hegemann, J. H. (2002). A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res 30, e23.[Abstract/Free Full Text]

Helliwell, S. B., Losko, S., Kaiser, C. A. (2001). Components of a ubiquitin ligase complex specify polyubiquitination and intracellular trafficking of the general amino acid permease. J. Cell Biol 153, 649–662.[Abstract/Free Full Text]

Hettema, E. H., Valdez-Taubas, J., Pelham, H. R. (2004). Bsd2 binds the ubiquitin ligase Rsp5 and mediates the ubiquitination of transmembrane proteins. EMBO J 23, 1279–1288.[CrossRef][Medline]

Hicke, L. and Dunn, R. (2003). Regulation of membrane protein transport by ubiquitin and ubiquitin–binding proteins. Annu. Rev. Cell Dev. Biol 19, 141–172.[CrossRef][Medline]

Hoeller, D., et al. (2006). Regulation of ubiquitin-binding proteins by monoubiquitination. Nat. Cell Biol 8, 163–169.[CrossRef][Medline]

Hoshikawa, C., Shichiri, M., Nakamori, S., Takagi, H. (2003). A nonconserved Ala401 in the yeast Rsp5 ubiquitin ligase is involved in degradation of Gap1 permease and stress-induced abnormal proteins. Proc. Natl. Acad. Sci. USA 100, 11505–11510.[Abstract/Free Full Text]

Ito, T., Chiba, T., Ozawa, R., Yoshida, M., Hattori, M., Sakaki, Y. (2001). A comprehensive two-hybrid analysis to explore the yeast protein interactome. Proc. Natl. Acad. Sci. USA 98, 4569–4574.[Abstract/Free Full Text]

Kaelin, W. G. Jr, et al. (1992). Expression cloning of a cDNA encoding a retinoblastoma-binding protein with E2F-like properties. Cell 70, 351–364.[CrossRef][Medline]

Kato, M., Miyazawa, K., Kitamura, N. (2000). A deubiquitinating enzyme UBPY interacts with the Src homology 3 domain of Hrs-binding protein via a novel binding motif PX(V/I)(D/N)RXXKP. J. Biol. Chem 275, 37481–37487.[Abstract/Free Full Text]

Katzmann, D. J., Babst, M., Emr, S. D. (2001). Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell 106, 145–155.[CrossRef][Medline]

Katzmann, D. J., Odorizzi, G., Emr, S. D. (2002). Receptor downregulation and multivesicular-body sorting. Nat. Rev. Mol. Cell Biol 3, 893–905.[CrossRef][Medline]

Katzmann, D. J., Sarkar, S., Chu, T., Audhya, A., Emr, S. D. (2004). Multivesicular body sorting: ubiquitin ligase Rsp5 is required for the modification and sorting of carboxypeptidase S. Mol. Biol. Cell 15, 468–480.[Abstract/Free Full Text]

Kee, Y., Lyon, N., Huibregtse, J. M. (2005). The Rsp5 ubiquitin ligase is coupled to and antagonized by the Ubp2 deubiquitinating enzyme. EMBO J 24, 2414–2424.[CrossRef][Medline]

Kee, Y., Munoz, W., Lyon, N., Huibregtse, J. M. (2006). The Ubp2 deubiquitinating enzyme modulates Rsp5-dependent K63-linked polyubiquitin conjugates in Saccharomyces cerevisiae. J. Biol. Chem in press.

Komada, M. and Kitamura, N. (2005). The Hrs/STAM complex in the downregulation of receptor tyrosine kinases. J. Biochem. (Tokyo) 137, 1–8.[Abstract/Free Full Text]

Komada, M., Masaki, R., Yamamoto, A., Kitamura, N. (1997). Hrs, a tyrosine kinase substrate with a conserved double zinc finger domain, is localized to the cytoplasmic surface of early endosomes. J. Biol. Chem 272, 20538–20544.[Abstract/Free Full Text]

Levkowitz, G., Waterman, H., Zamir, E., Kam, Z., Oved, S., Langdon, W. Y., Beguinot, L., Geiger, B., Yarden, Y. (1998). c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev 12, 3663–3674.[Abstract/Free Full Text]

Lill, N. L., Douillard, P., Awwad, R. A., Ota, S., Lupher, M. L. Jr, Miyake, S., Meissner-Lula, N., Hsu, V. W., Band, H. (2000). The evolutionarily conserved N-terminal region of Cbl is sufficient to enhance down-regulation of the epidermal growth factor receptor. J. Biol. Chem 275, 367–377.[Abstract/Free Full Text]

Longtine, M. S., McKenzie, A. 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., Pringle, J. R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961.[CrossRef][Medline]

Longva, K. E., Blystad, F. D., Stang, E., Larsen, A. M., Johannessen, L. E., Madshus, I. H. (2002). Ubiquitination and proteasomal activity is required for transport of the EGF receptor to inner membranes of multivesicular bodies. J. Cell Biol 156, 843–854.[Abstract/Free Full Text]

Marchese, A., Raiborg, C., Santini, F., Keen, J. H., Stenmark, H., Benovic, J. L. (2003). The E3 ubiquitin ligase AIP4 mediates ubiquitination and sorting of the G protein-coupled receptor CXCR4. Dev. Cell 5, 709–722.[CrossRef][Medline]

McCullough, J., Clague, M. J., Urbe, S. (2004). AMSH is an endosome-associated ubiquitin isopeptidase. J. Cell Biol 166, 487–492.[Abstract/Free Full Text]

McCullough, J., Row, P. E., Lorenzo, O., Doherty, M., Beynon, R., Clague, M. J., Urbe, S. (2006). Activation of the endosome-associated ubiquitin isopeptidase AMSH by STAM, a component of the multivesicular body-sorting machinery. Curr. Biol 16, 160–165.[CrossRef][Medline]

Millard, S. M. and Wood, S. A. (2006). Riding the DUBway: regulation of protein trafficking by deubiquitylating enzymes. J. Cell Biol 173, 463–468.[Abstract/Free Full Text]

Mizuno, E., Iura, T., Mukai, A., Yoshimori, T., Kitamura, N., Komada, M. (2005). Regulation of epidermal growth factor receptor down-regulation by UBPY-mediated deubiquitination at endosomes. Mol. Biol. Cell 16, 5163–5174.[Abstract/Free Full Text]

Mizuno, E., Kobayashi, K., Yamamoto, A., Kitamura, N., Komada, M. (2006). A deubiquitinating enzyme UBPY regulates the level of protein ubiquitination on endosomes. Traffic 7, 1017–1031.[CrossRef][Medline]

Nikko, E., Marini, A. M., Andre, B. (2003). Permease recycling and ubiquitination status reveal a particular role for Bro1 in the multivesicular body pathway. J. Biol. Chem 278, 50732–50743.[Abstract/Free Full Text]

Odorizzi, G., Babst, M., Emr, S. D. (1998). Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell 95, 847–858.[CrossRef][Medline]

Pizzirusso, M. and Chang, A. (2004). Ubiquitin-mediated targeting of a mutant plasma membrane ATPase, Pma1–7, to the endosomal/vacuolar system in yeast. Mol. Biol. Cell 15, 2401–2409.[Abstract/Free Full Text]

Polo, S., Sigismund, S., Faretta, M., Guidi, M., Capua, M. R., Bossi, G., Chen, H., De Camilli, P., Di Fiore, P. P. (2002). A single motif responsible for ubiquitin recognition and monoubiquitination in endocytic proteins. Nature 416, 451–455.[CrossRef][Medline]

Raiborg, C., Rusten, T. E., Stenmark, H. (2003). Protein sorting into multivesicular endosomes. Curr. Opin. Cell Biol 15, 446–455.[CrossRef][Medline]

Raths, S., Rohrer, J., Crausaz, F., Riezman, H. (1993). end3 and end4, two mutants defective in receptor-mediated and fluid-phase endocytosis in Saccharomyces cerevisiae. J. Cell Biol 120, 55–65.[Abstract/Free Full Text]

Raymond, C. K., Howald-Stevenson, I., Vater, C. A., Stevens, T. H. (1992). Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell 3, 1389–1402.[Abstract]

Reggiori, F. and Pelham, H. R. (2002). A transmembrane ubiquitin ligase required to sort membrane proteins into multivesicular bodies. Nat. Cell Biol 4, 117–123.[CrossRef][Medline]

Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., Seraphin, B. (1999). A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol 17, 1030–1032.[CrossRef][Medline]

Roberg, K. J., Rowley, N., Kaiser, C. A. (1997). Physiological regulation of membrane protein sorting late in the secretory pathway of Saccharomyces cerevisiae. J. Cell Biol 137, 1469–1482.[Abstract/Free Full Text]

Roth, A. F. and Davis, N. G. (2000). Ubiquitination of the PEST-like endocytosis signal of the yeast a-factor receptor. J. Biol. Chem 275, 8143–8153.[Abstract/Free Full Text]

Row, P. E., Clague, M. J., Urbe, S. (2005). Growth factors induce differential phosphorylation profiles of the Hrs-STAM complex: a common node in signalling networks with signal-specific properties. Biochem. J 389, 629–636.[CrossRef][Medline]

Row, P. E., Prior, I. A., McCullough, J., Clague, M. J., Urbe, S. (2006). The ubiquitin isopeptidase UBPY regulates endosomal ubiquitin dynamics and is essential for receptor down-regulation. J. Biol. Chem 281, 12618–12624.[Abstract/Free Full Text]

Scott, P. M., Bilodeau, P. S., Zhdankina, O., Winistorfer, S. C., Hauglund, M. J., Allaman, M. M., Kearney, W. R., Robertson, A. D., Boman, A. L., Piper, R. C. (2004). GGA proteins bind ubiquitin to facilitate sorting at the trans-Golgi network. Nat. Cell Biol 6, 252–259.[Medline]

Shcherbik, N., Kee, Y., Lyon, N., Huibregtse, J. M., Haines, D. S. (2004). A single PXY motif located within the carboxyl terminus of Spt23p and Mga2p mediates a physical and functional interaction with ubiquitin ligase Rsp5p. J. Biol. Chem 279, 53892–53898.[Abstract/Free Full Text]

Smith, D. B., Rubira, M. R., Simpson, R. J., Davern, K. M., Tiu, W. U., Board, P. G., Mitchell, G. F. (1988). Expression of an enzymatically active parasite molecule in Escherichia coli: Schistosoma japonicum glutathione S-transferase. Mol. Biochem. Parasitol 27, 249–256.[CrossRef][Medline]

Soetens, O., De Craene, J. O., Andre, B. (2001). Ubiquitin is required for sorting to the vacuole of the yeast general amino acid permease, Gap1. J. Biol. Chem 276, 43949–43957.[Abstract/Free Full Text]

Staub, O. and Rotin, D. (2006). Role of ubiquitylation in cellular membrane transport. Physiol. Rev 86, 669–707.[Abstract/Free Full Text]

Stimpson, H. E., Lewis, M. J., Pelham, H. R. (2006). Transferrin receptor-like proteins control the degradation of a yeast metal transporter. EMBO J 25, 662–672.[CrossRef][Medline]

Tanaka, N., Kaneko, K., Asao, H., Kasai, H., Endo, Y., Fujita, T., Takeshita, T., Sugamura, K. (1999). Possible involvement of a novel STAM-associated molecule "AMSH" in intracellular signal transduction mediated by cytokines. J. Biol. Chem 274, 19129–19135.[Abstract/Free Full Text]

Tong, A. H., et al. (2002). A combined experimental and computational strategy to define protein interaction networks for peptide recognition modules. Science 295, 321–324.[Abstract/Free Full Text]

Urbanowski, J. L. and Piper, R. C. (1999). The iron transporter Fth1p forms a complex with the Fet5 iron oxidase and resides on the vacuolar membrane. J. Biol. Chem 274, 38061–38070.[Abstract/Free Full Text]

Urbanowski, J. L. and Piper, R. C. (2001). Ubiquitin sorts proteins into the intralumenal degradative compartment of the late-endosome/vacuole. Traffic 2, 622–630.[CrossRef][Medline]

Urbe, S. (2005). Ubiquitin and endocytic protein sorting. Essays Biochem 41, 81–98.[Medline]

Wang, G., McCaffery, J. M., Wendland, B., Dupre, S., Haguenauer-Tsapis, R., Huibregtse, J. M. (2001). Localization of the Rsp5p ubiquitin-protein ligase at multiple sites within the endocytic pathway. Mol. Cell. Biol 21, 3564–3575.[Abstract/Free Full Text]

Wang, G., Yang, J., Huibregtse, J. M. (1999). Functional domains of the Rsp5 ubiquitin-protein ligase. Mol. Cell. Biol 19, 342–352.[Abstract/Free Full Text]

Yashiroda, H., Kaida, D., Toh-e, A., Kikuchi, Y. (1998). The PY-motif of Bul1 protein is essential for growth of Saccharomyces cerevisiae under various stress conditions. Gene 225, 39–46.[CrossRef][Medline]

Yu, H., Chen, J. K., Feng, S., Dalgarno, D. C., Brauer, A. W., Schreiber, S. L. (1994). Structural basis for the binding of proline-rich peptides to SH3 domains. Cell 76, 933–945.[CrossRef][Medline]

Zheng, B., Lavoie, C., Tang, T. D., Ma, P., Meerloo, T., Beas, A., Farquhar, M. G. (2004). Regulation of epidermal growth factor receptor degradation by heterotrimeric Galphas protein. Mol. Biol. Cell 15, 5538–5550.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
JCBHome page
S. B. Shields, A. J. Oestreich, S. Winistorfer, D. Nguyen, J. A. Payne, D. J. Katzmann, and R. Piper
ESCRT ubiquitin-binding domains function cooperatively during MVB cargo sorting
J. Cell Biol., April 20, 2009; 185(2): 213 - 224.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ren, N. Pashkova, S. Winistorfer, and R. C. Piper
DOA1/UFD3 Plays a Role in Sorting Ubiquitinated Membrane Proteins into Multivesicular Bodies
J. Biol. Chem., August 1, 2008; 283(31): 21599 - 21611.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Barriere, C. Nemes, K. Du, and G. L. Lukacs
Plasticity of Polyubiquitin Recognition as Lysosomal Targeting Signals by the Endosomal Sorting Machinery
Mol. Biol. Cell, October 1, 2007; 18(10): 3952 - 3965.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Material
Right arrow All Versions of this Article:
E06-06-0557v1
18/1/324    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, J.
Right arrow Articles by Piper, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, J.
Right arrow Articles by Piper, R. C.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2007 by The American Society for Cell Biology. Terms of copyright protection, warranties, and disclaimers.