![]() |
|
|
Vol. 18, Issue 1, 76-83, January 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Forschungszentrum Karlsruhe, Institute of Toxicology and Genetics, 76021 Karlsruhe, Germany
Submitted August 4, 2006;
Revised September 27, 2006;
Accepted October 13, 2006
Monitoring Editor: Carl-Henrik Heldin
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
CD44 proteins play important roles in various cellular processes such as growth regulation, survival, differentiation, and motility. Consequently, their altered expression or dysfunction contributes to numerous pathological situations, which can give rise, in the worst cases, to metastatic spreading of tumor cells (for reviews, see Naor et al., 1997
; Ponta et al., 2003
). A CD44 variant containing exon v6 sequences has been shown to be required and is even sufficient for the metastatic spreading of a rat pancreatic tumor cell line: The metastatic spreading of these tumor cells could be inhibited by treatment of tumor-bearing animals with CD44v6-specific antibodies (Seiter et al., 1993
). Expression of a v6 containing CD44 isoform conferred the metastatic potential to otherwise nonmetastatic cells (Günthert et al., 1991
). Furthermore, CD44 variants have been detected in a variety of human tumors and their expression has been correlated with poor prognosis (for review, see Naor et al., 2002
).
In addition to cancer, CD44 proteins play essential roles in a variety of other physiological and pathological processes, including tissue development, neuronal axon guidance, hematopoiesis, numerous immune functions, and autoimmune diseases (for reviews, see Naor et al., 1997
; Ponta et al., 2003
).
A striking evidence for the role of CD44 variants in embryogenesis has been found during limb development in that CD44 variant-specific antibodies blocked limb outgrowth. CD44 variants are located on the apical ectodermal ridge where they act as coreceptors in trans for fibroblast growth factor receptors located on underlying mesenchymal cells (Sherman et al., 1998
). The coreceptor function of CD44 was dependent on modification by heparan sulfate on sequences encoded by exon v3.
Based on the work on CD44 function in limb development, we investigated whether CD44 isoforms might take part in the metastatic process also through the activation of receptor tyrosine kinases (RTK). A promising candidate seemed to be the RTK c-Met and its ligand hepatocyte growth factor or scatter factor (designated as HGF throughout the article) for several reasons. First, the activation of c-Met triggers various effects that are also related to metastasis such as migration, proliferation, or differentiation (Bardelli et al., 1997
). Second, c-Met is often up-regulated or amplified in human tumors such as colorectal and pancreatic cancers (Di Renzo et al., 1995a
,b
) in which also CD44v6 is often up-regulated. Third, the introduction of c-Met into NIH3T3 cells rendered the cells metastatic (Giordano et al., 1993
; Jeffers et al., 1996
).
We have shown that the activation of c-Met and the downstream signaling to extracellular signal-regulated kinase (Erk) in response to HGF in fact requires the presence of CD44 v6-containing isoforms (Orian-Rousseau et al., 2002
). Antibodies against CD44v6 blocked c-Met activation in several cell lines as well as in primary cells. The physiological processes triggered by c-Met activation were also inhibited. Interestingly, one of these CD44v6-specific antibodies had been used previously to inhibit the metastatic spreading of a rat pancreatic tumor cell line (Seiter et al., 1993
).
In a cell line that did not express CD44 variant isoforms but the c-Met receptor, c-Met activation by HGF was restored by transfection of CD44 variant isoforms with v6 sequences (Orian-Rousseau et al., 2002
). The precise amino acids in the exon v6 that are required for c-Met activation had been identified by linker scan mutagenesis, being EWQ in rat and RWH in human. Peptides making up these three amino acids (the smallest being a 5mer) competed with the function of endogenous CD44v6 and blocked c-Met phosphorylation, downstream signaling, and HGF-induced invasion and scattering (Matzke et al., 2005
).
For the activation of c-Met, the extracellular part containing the exon v6 sequence and the transmembrane domain of CD44 were sufficient. Removal of the cytoplasmic tail of CD44, however, had an unexpected effect. Such a truncated mutant still allowed activation of c-Met, but signaling emanating from c-Met to Erk was completely blocked (Orian-Rousseau et al., 2002
). Activation of signaling components that directly bind to c-Met was still possible. Competition experiments by overexpressing intracellularly the cytoplasmic tail of CD44 also abrogated downstream signaling (Orian-Rousseau et al., 2002
), suggesting that proteins have to bind to the cytoplasmic tail to promote signaling. Candidates are ezrin, radixin and moesin (ERM) proteins, the main representative in the cells used being ezrin. This has been confirmed by the overexpression of CD44 cytoplasmic tails point-mutated in the ezrin binding site that did not interfere with signaling.
ERM proteins belong to a superfamily of proteins that link the cytoskeleton to the cell membrane (for reviews, see Arpin et al., 1994
; Tsukita and Yonemura, 1997
). Ezrin, for example, can associate with various membrane proteins such as CD44 (Tsukita et al., 1994
), intercellular adhesion molecule-1,2 (Helander et al., 1996
), Na-H exchanger (Denker et al., 2000
), and type II c-AMPdependent protein kinases (Dransfield et al., 1997
). These interactions are established via its N terminus, whereas its C-terminal domain binds to F-actin in vitro (Turunen et al., 1994
) and in vivo (Algrain et al., 1993
).
Here, we address two main questions. First, at which step in the Ras/mitogen-activated protein kinase (MAPK) pathway is the cytoplasmic tail of CD44v6 and the binding of ERM proteins required for signaling from the c-Met receptor? Second, is the binding of ERM proteins to F-actin necessary for signaling thus organizing the downstream signaling cascade?
| MATERIALS AND METHODS |
|---|
|
|
|---|
cyt cells, and ASv6 cells have been described previously (Orian-Rousseau et al., 2002
Constructs
Expression vectors containing rat CD44v6 fused to full-length or truncated rat ezrin: The CD44 part was amplified by polymerase chain reaction (PCR) covering the 5'-untranslated region to the transmembrane domain from the pGKs6 vector (Sleeman et al., 1997
). The primers used were CGCGACCCTTTTCCAGAGGCTACTAGATCCTTTGG TTTCATCCTGCACATCATGG and GTCTGCATTGCTGTCAACAGTAGGAGG AAGCAGACGTAACGACAGTTGTCATCCTCCTTCCTTTGGAAAC.
Note that we have included in the forward primer an EcoRI restriction site and in the reverse primer a HindIII and an EcoRI restriction site. The PCR product was cloned into the Topo-pCRII vector (Invitrogen).
For the ezrin part, rat ezrin was amplified from a pCDNA3.1 vector containing full-length ezrin (our unpublished data) by using the following primers: CTCGGAAGCTTAGCCACCAACCAGCCAAGATGCC and CAAAGCTTGAATT CCTACTTGCCCAGCCGGTTCATCTCGATGTCGGTGTATGGCCTCAAAC. A vesicular stomatitis virus G (VSV-G) sequence was included in the reverse primer. The PCR product was also cloned in a Topo pCRII vector.
The Topo pCRII vector containing CD44v6 was then linearized with HindIII, and the HindIII fragment from the Topo pCRII vector containing ezrin sequences was inserted. The CD44v6ezrin fusion was excised by EcoRI and cloned into a pCDNA3.1 vector (Invitrogen). The point mutation in ezrin at T566D (Bretscher et al., 2002
) in the CD44v6ezrin fusion was introduced using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The removal of the last 34 Aas in ezrin in the CD44v6ezrin fusion was performed by at first insertion of two MluI sites by mutagenesis followed by excision of the MluI fragment.
The fusion protein between CD44v6 and the ezrin C terminus was made out of the CD44v6 fusion with full-length rat ezrin (see above). The N-terminal part of ezrin was deleted after insertion of two MluI restriction sites by QuickChange mutagenesis. The primers used for insertion of the MluI sites at the ezrin N-terminal start site were as follows: 5'-TGCCCAAGCCAATCAACACGCGTGTGACCACCATGGATGC-3' and 5'-GCATCCATGGTGGTCACACGCGTGTTGATTGGCTTGGGCA-3'.
Into the mutated CD44v6-ezrin fusion a second MluI site was introduced into the ezrin N-terminal end: 5'-CCTGACTTCGTGTTCTACACGCGTCGCCTGAGAATTAACAAGCG-3' and 5'-CGCTTGTTAATTCTCAGGCGACGCGTGTAGAACACGAAGTCAGG-3'.
An ezrin wild type and a construct, in which the sequences encoding the last 29 amino acids are deleted, both tagged with VSV-G, were kindly provided by Monique Arpin (Institut Pasteur, Paris, France). The hemagglutinin (HA)-tagged Erk2 plasmid was a gift from A. Ulrich (Martinsried, Germany), and the mitogen-activated protein kinase kinase (MEK)-glutathione S-transferase (GST) construct was provided by A. Cato (FZ Karlsruhe, Stutensee, Germany).
Antibodies and Other Reagents
Antibodies directed against c-Met, Erk, Shp2, and green fluorescent protein (GFP) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); antibodies against phospho-Akt, phospho-phospholipase C (PLC)
, phospho-Erk, and phospho-MEK as well as the Akt antibodies from Cell Signaling Technology (Beverly, MA). Gab1, PLC
, Ras, Raf, and anti-phospho-tyrosine (4G10) antibodies were purchased from BIOMOL Research Laboratories (Plymouth Meeting, PA), and the antibody against ezrin was from Dunn Labortechnik (Asbach, Germany). Rabbit IgG was from Dianova (Hamburg, Germany), the HA antibody was from Roche Diagnostics (Mannheim, Germany), and the VSV-G antibody was from Stressgen/Biomol (Hamburg, Germany). HGF was either obtained from R&D Systems (Minneapolis, MN) or kindly provided by George Vande Woude (Van Andel Institute), and it was preactivated with 5% FCS overnight at 37°C. 12-O-tetradecanoyl-phorbol-13-acetate (TPA), lysophosphatidic acid (LPA), Triton X-100, latrunculin B, and cytochalasin D were from Sigma (Taufkirchen, Germany).
Immunoprecipitation and Western Blotting
Detection of c-Met, Gab1, HA-Erk, and phosphorylated signaling components has been described previously (Orian-Rousseau et al., 2002
). Note that throughout the article, activation was measured upon 24 h of starvation of the cells and 5 min of treatment with HGF at 37°C. This time point showed maximal activation of Met and Erk in activation kinetics (data not shown). For coimmunoprecipitation of Sos and ezrin, GFP-Sos and VSV-G ezrin constructs (Algrain et al., 1993
) were transfected into 293 cells by using Lipofectamine 2000 (Invitrogen). The cells were lysed in 25 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10% glycerol, 1% NP-40, 0.5 mM MgCl2, 10 mM NaF, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM Na orthovanadate, and 1 mM aprotinine and leupeptin. Immunoprecipitation was carried out using GFP antibodies.
Activated Ras was detected in cells seeded in six-well plates by using a GST fusion protein, corresponding to the human Ras binding domain of Raf-1 (RBD; residues 1-149) bound to glutathione agarose (BIOMOL Research Laboratories) according to the manufacturer's instruction. Raf activity was measured using an in vitro kinase assay. Cell were lysed in 50 mM HEPES, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10 mM NaF, 1 mM PMSF, 1 mM Na orthovanadate, and 1 mM aprotinine and leupeptin, and Raf was immunoprecipitated. The pellets were washed three times in lysis buffer and one time in the kinase buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 20 mM MgCl2, and 1 mM ATP supplemented with protease inhibitors). The pellets were then incubated with the kinase buffer supplemented with 10 µCi of [
-32P]ATP and GST-MEK (500 ng of purified protein) for 30 min at 30°C. After centrifugation the pellets were dissolved in SDS-sample buffer and subsequently loaded on a SDS-PAGE gel. GST-MEK was prepared from transfected Escherichia coli cells by affinity purification with glutathione agarose beads (Sigma) (Smith et al., 1993
).
Grb2 Pull-Down
Cells (10-cm plate) were induced with HGF, where indicated, lysed in the same buffer used for coimmunoprecipitation of Sos and ezrin (see above), and incubated overnight with Grb2 agarose beads (BIOMOL Research Laboratories). The beads were washed three times in lysis buffer and prepared for SDS-PAGE. Western blotting was performed with the different antibodies as indicated.
Transfection
The 293 cells were transiently transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Transfection of the BSp73AS cells was performed by electroporation using the protocol provided by Amaxa (Amaxa Biosystems, Gaithersburg, MD). In brief, 1 x 106 cells were used for each reaction. DNA (1.5 µg of HA-Erk and 2.5 µg of indicated vectors) and nucleofector solution L (200 µl) were mixed and combined with the cells. Electroporation was performed using the program T-020. Prewarmed medium without serum was then added, and the cells were seeded in a six-well plate. After 24-h incubation, the cells were starved for 24 h followed by induction with HGF. Immunoprecipitation and detection of HA-Erk has been described previously (Orian-Rousseau et al., 2002
).
Small interfering RNA (siRNA) sequences against human ezrin were kindly provided by S. Pust (GBF Braunschweig, Braunschweig, Germany) (sense, CCCCAAAGAUUGGCUUUCC) and Santa Cruz Biotechnology (mixture of six single-stranded RNAs; sense sequences: 1, GGAACAUCUC UUUCAAUGA; 2, CCACGUCUGAGAAUCAACA; and 3, GACUCUGUUUGCU UGUGUU) and transfected into 293 cells using Oligofectamine (Invitrogen) according to the manufacturer's protocol twice with a delay of 24 h between two transfections. For control the off-target siRNA, UUCUCCGAACGUGUCACGU (sense strand; Qiagen-Xeragon, Germantown, MD) was used.
Triton X-100 Insolubility Assay
Cells (3 x 106) were seeded in 10-cm plates and grown, starved, and induced with HGF as described previously (Orian-Rousseau et al., 2002
) and fixed in 10% formalin. The cells were then lysed in 25 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% Triton X-100, and 0.5 mM MgCl2 together with protease and phosphatase inhibitors (see above). The lysate was centrifugated for 5 min at 1000 x g, and the supernatant was then centrifugated at 100,000 x g for 1 h. The pellet was dissolved in sample buffer and loaded on SDS gel.
Scattering Assay
HT29 cells were transfected with the indicated constructs (3 µg) by using the Amaxa electroporation device as described above. For these cells, the solution R and the program S4 were used. The scattering assay has been described previously (Orian-Rousseau et al., 2002
).
| RESULTS |
|---|
|
|
|---|
cyt) catalyzed HGF-induced c-Met phosphorylation as well. However, the activation of downstream signaling components was abolished (Figure 1A). These data indicate a requirement of the CD44 tail for pathways that lead to Akt and JNK activation in addition to the Ras/MAPK pathway. Transfection of the CD44v6 tailless mutant did not affect serum-, TPA-, or LPA-dependent induction of Erk phosphorylation (Figure 1B) excluding unspecific effects on all extracellular stimuli.
|
were not affected by the absence of the CD44 tail (Figure 2A). However, activation of Ras, Raf, MEK, and Erk was only observed in cells transfected with wild-type CD44v6 but not with the tailless mutant (Figure 2A).
|
Overexpression of soluble CD44 tails in the cytoplasm of 293 human kidney carcinoma cells in which c-Met activation is triggered by endogenous CD44v6 also abolished signaling from c-Met to Erk (Orian-Rousseau et al., 2002
), whereas CD44 tails mutated in the ERM binding site did not. These data suggested that ERM proteins are recruited to the CD44 tail to promote c-Met signaling. To further characterize the role of ERM proteins in signal transduction, we performed two types of experiments: Down-regulation of ezrin expression by siRNA in CD44v6-positive cells (the 293 cells and the HT29 cells used here contain predominantly ezrin), and transfection of a covalent CD44v6ezrin fusion construct into CD44v6-negative BSp73AS cells.
siRNA directed against ezrin abrogated the expression of endogenous ezrin, whereas an off-target siRNA (control; ctl) did not inhibit ezrin expression (Figure 3A, shown for 293 cells; two different ezrin-specific siRNA sources were used revealing similar results). Consequently, the induction of Erk phosphorylation by HGF was reduced to the basal level (Figure 3A) pointing toward a decisive role of ezrin in c-Met signaling. In the second approach, we fused pseudophosphorylated ezrin (in rat T566D, mimicking the activated state of ezrin; Gautreau et al., 2000
) to tailless CD44v6 (schematic representation in Figure 3B). In contrast to tailless CD44v6 that does not allow signal transduction (Orian-Rousseau et al., 2002
; Figure 1A), the fusion protein established HGF-induced Erk activation in the CD44v6-negative BSp73AS cells (Figure 3C). Phosphorylation of the c-Met receptor in cells transfected with the fusion protein was similar to cells transfected with CD44v6 (Figure 4C). These data prove a causal role of ezrin in HGF-dependent signal transduction and indicate that the CD44 tail serves to tether ezrin to the membrane into the proximity of c-Met. Together with the data presented in Figure 2, they suggest that the binding of ezrin to the cytoplasmic tail of CD44v6 is dispensable for the phosphorylation of the c-Met receptor and the activation of receptor binding signaling components in response to HGF but is needed to activate Ras, most likely via the recruitment of Ras into a complex with Sos (or a Shp-2-regulated GEF; Kodama et al., 2000
). In agreement with this assumption, ezrin could be coimmunoprecipitated with Sos upon HGF stimulation in 293 cells (Figure 3D).
|
|
Transfection of BSp73AS cells with the fusion between CD44v6 and the C terminus of ezrin allowed signaling from the c-Met receptor (Figure 3C), indicating that the F-actin binding domain is enough for signal transduction. Actin polymerization was inhibited by either cytochalasin D or latrunculin B. Cytochalasin D interferes with actin polymerization by binding to the barbed ends of actin filaments (for review, see Cooper, 1987
). Latrunculin B sequesters actin monomers and thereby prevents polymerization (Spector et al., 1989
). Both agents severely reduced the HGF-dependent activation of Erk without affecting at all the phosphorylation of c-Met (Figure 4, A and B). The fact that c-Met phosphorylation was unaffected by both latrunculin B and cytochalasin D demonstrates the specificity of the effects of the drugs on signal transduction. The cells were still viable during these short treatments as tested by staining with trypan blue (data not shown). Finally, we made use of a CD44v6ezrin fusion construct (Figure 3B) in which the F-actin binding domain was deleted. Transfection of this deletion construct into the CD44v6-negative BSp73AS cells did not restore HGF-dependent signaling in contrast to the fusion protein containing the F-actin binding site (Figure 4C). c-Met activation, however, was not impaired (data not shown), indicating that this construct was functional and properly expressed at the membrane. Note that similar levels of fusion proteins were expressed (Figure 4C). Thus, F-actin seems to play a decisive role in c-Metdependent signaling but not in c-Met phosphorylation.
Based on these findings, we predicted that the fusion protein lacking the actin binding site as well as an ezrin mutant deleted in the actin binding site (Algrain et al., 1993
) should exert a dominant-negative effect on c-Met signaling. This was indeed the case. When the highly transfectable 293 cells, in which HGF induced c-Met signaling is dependent on endogenous CD44v6 (Orian-Rousseau et al., 2002
) were transiently transfected with the mutant fusion construct, Erk activation was completely abrogated (Figure 5A). The fusion protein containing the F-actin binding domain rather enhanced c-Met signaling. Note, however, that c-Met activation itself was not influenced by the fusion proteins underlining the specificity of the effect on signal transduction but not on c-Met activation. Transfection of an ezrin mutant deleted in the F-actin binding domain also repressed HGF-induced Erk activation (Figure 5B).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
These conclusions are based on several independent experiments. In cells containing CD44v6 with a cytoplasmic tail deletion, Ras was the first component in the signaling cascade that was not activated by HGF. Furthermore, in these cells Ras was not present in complexes obtained by Grb2 pull-down or cytoskeleton precipitations upon HGF stimulation (Figure 2). In contrast, the signaling components above Ras, including the c-Met receptor itself, were activated and found in the respective complexes. Therefore, we conclude that the step between Ras and Sos is the one targeted by the cytoplasmic tail of CD44v6.
The involvement of ezrin in downstream signaling was concluded from 1) experiments using the CD44v6 truncation of the cytoplasmic tail and competitions with these cytoplasmic tails (Orian-Rousseau et al., 2002
), 2) experiments using various CD44v6 fusion proteins containing either pseudophosphorylated ezrin or the ezrin C terminus to restore HGF-induced signaling in cells negative for CD44v6 (Figure 3), and 3) experiments using siRNA to inhibit ezrin expression (Figure 3).
The involvement of the F-actin cytoskeleton for downstream signaling was shown by means of constructs deleted in the F-actin binding domain of ezrin (Figure 4), by disturbance of the cytoskeleton integrity by drugs (Figure 4) and by the association of components of the HGF induced signaling pathway with F-actin in Triton X-100 insolubility assays (Figure 6).
In the Grb2 pull-down complexes and in the F-actin complexes in the Triton X-100 precipitations Ras could be linked to ezrin, Sos, or another GEF or a scaffold protein that binds to actin. An interesting aspect is the observation that as well Sos and Shp2 are in the complex with Grb2. It has been proposed that the activation of Ras by the c-Met receptor is predominantly mediated by a Shp2 dependent GEF and not by Sos (Schaeper et al., 2000
).
Also, other signaling pathways starting at the c-Met receptor, from phosphatidylinositol 3-kinase (PI3K) to Akt or the activation of JNK, depend on the function of the CD44v6 cytoplasmic tail. In principle, the activation of PI3K and of JNK could be mediated by Ras (Derijard et al., 1994
; Cantley, 2002
), but in case of the c-Met receptor, the activation of PI3K seems to be a Ras-independent event, occurring directly at the receptor (Bardelli et al., 1999
). In agreement with this observation, a dominant-negative version of Ras (N17) did not interfere with HGF-mediated Akt activation (our unpublished data). The activation of JNK, however, seems to depend on Ras as a dominant-negative version of Ras prevented its phosphorylation (our unpublished data).
The physiological relevance of the involvement of the cytoskeletal organization by ERM proteins for c-Metdependent signaling was demonstrated using dominant-negative ezrin constructs lacking the actin binding domain. These constructs interfered effectively with c-Metdependent scattering similar to CD44v6-specific antibodies or CD44v6-specific peptides or an inhibitor of the Ras/MAPK pathway (Matzke et al., 2005
).
Interestingly, an involvement of ezrin in signal transduction has been demonstrated using siRNA (Khanna et al., 2004
). The down-regulation of ezrin led to reduced levels of MAPK and Akt activation in osteosarcoma cells. Furthermore, ezrin is overexpressed in these highly metastatic tumor cells as well as in highly metastatic rhabdomyosarcoma cells (Yu et al., 2004
), and ezrin inhibition reduced the metastatic capacity of these cells.
The tumor suppressor merlin, another member of the ERM protein family (Bretscher et al., 2002
), is a natural antagonist of the action of ERMs. Similar to ERM proteins, merlin binds to transmembrane proteins such as CD44, but its binding interrupts signaling events (Morrison et al., 2001
). This interference seems to occur on the step of Ras or Rac activation and seems to be the consequence of the inability of merlin to bind F-actin, because it lacks a C-terminal F-actin binding site (Morrison et al., 2007
).
There is ample evidence for a connection of the cytoskeleton and signaling. The majority of articles, however, deal with changes of the cytoskeleton as a consequence of signaling, e.g., by the induction of migratory processes (for recent review, see Ivetic and Ridley, 2004
), the lateral movement of membrane components in the formation of the B-cell cap (de Petris and Raff, 1973
), or the formation of the T-cell synapse (Penninger and Crabtree, 1999
; Krawczyk and Penninger, 2001
). Interestingly, a microfilament-associated large signal transduction complex containing the activated p185(neu) receptor as well as Sos and Ras was isolated from microvilli of an aggressive mammary adenocarcinoma (Li et al., 1999
). The connection of the cytoskeleton to this signaling complex, however, was thought to physically link mitogenic signaling to cytoskeletal remodeling (Carraway et al., 1999
). Recently, the ERM protein radixin was shown to be essential for the anchoring of the GABA receptor
5 subunit to the actin cytoskeleton. In this case, the ERM protein seems to mediate receptor clustering (Loebrich et al., 2006
).
The only direct involvement of the cortical actin cytoskeleton in signaling described so far refers to the activation of the transcription factor SRF. Here, free G-actin inhibits SRF activity by sequestering a coactivator, MAL, in the cytoplasm (Miralles et al., 2003
). The SRF/MAL complex addresses a subset of SRF target genes (Treisman et al., 1998
). Another subset requiring SRFTCF interaction is addressed by Erk (Gille et al., 1995
) and is likely also dependent on the signal promoting effect of cortical actin described here.
The functional contribution of CD44 isoforms as a coreceptor seems not to be restricted to c-Met and its relative Ron. For several other receptors, e.g., of the epidermal growth factor receptor family, members of the vascular endothelial growth factor-R family, and Trk, CD44v6 isoforms seem to be also required for their activation (Matzke et al., 2005
; our unpublished data). Furthermore, signaling from the platelet-derived growth factor receptor, although independent of CD44, is strictly dependent on ezrin and its binding to the cytoskeleton (our unpublished data).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* These authors contributed equally to this work. ![]()
Present address: Leibniz Institute for Age Research-Fritz Lipmann Institute, Beutenbergstrasse 11, 07745 Jena, Germany. ![]()
Address correspondence to: Helmut Ponta (helmut.ponta{at}itg.fzk.de)
Abbreviations used: ERM, ezrin, radixin, moesin; HGF, hepatocyte growth factor/scatter factor; RTK, receptor tyrosine kinase.
| REFERENCES |
|---|
|
|
|---|
Arpin, M., Algrain, M., Louvard, D. (1994). Membrane-actin microfilament connections: an increasing diversity of players related to band 4.1. Curr. Opin. Cell Biol 6, 136141.[CrossRef][Medline]
Bardelli, A., Basile, M. L., Audero, E., Giordano, S., Wennstrom, S., Menard, S., Comoglio, P. M., Ponzetto, C. (1999). Concomitant activation of pathways downstream of Grb2 and PI 3kinase is required for MET-mediated metastasis. Oncogene 18, 11391146.[CrossRef][Medline]
Bardelli, A., Pugliese, L., Comoglio, P. M. (1997). "Invasive-growth" signaling by the Met/HGF receptor: the hereditary renal carcinoma connection. Biochim. Biophys. Acta 1333, M41M51.[Medline]
Boguski, M. S. and McCormick, F. (1993). Proteins regulating Ras and its relatives. Nature 366, 643654.[CrossRef][Medline]
Bretscher, A., Edwards, K., Fehon, R. G. (2002). ERM proteins and merlin: integrators at the cell cortex. Nat. Rev. Mol. Cell Biol 3, 586599.[CrossRef][Medline]
Cantley, L. C. (2002). The phosphoinositide 3-kinase pathway. Science 296, 16551657.
Carraway, C. A., Carvajal, M. E., Carraway, K. L. (1999). Association of the Ras to mitogen-activated protein kinase signal transduction pathway with microfilaments. Evidence for a p185(neu)-containing cell surface signal transduction particle linking the mitogenic pathway to a membrane-microfilament association site. J. Biol. Chem 274, 2565925667.
Cooper, J. A. (1987). Effects of cytochalasin and phalloidin on actin. J. Cell Biol 105, 14731478.
de Petris, S. and Raff, M. C. (1973). Normal distribution, patching and capping of lymphocyte surface immunoglobulin studied by electron microscopy. Nat. New Biol 241, 257259.[Medline]
Denker, S. P., Huang, D. C., Orlowski, J., Furthmayr, H., Barber, D. L. (2000). Direct binding of the NaH exchanger NHE1 to ERM proteins regulates the cortical cytoskeleton and cell shape independently of H(+) translocation. Mol. Cell 6, 14251436.[CrossRef][Medline]
Derijard, B., Hibi, M., Wu, I. H., Barrett, T., Su, B., Deng, T., Karin, M., Davis, R. J. (1994). JNK 1, a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76, 10251037.[CrossRef][Medline]
Di Renzo, M. F., et al. (1995a). Overexpression and amplification of the met/HGF receptor gene during the progression of colorectal cancer. Clin. Cancer Res 1, 147154.[Abstract]
Di Renzo, M. F., Poulsom, R., Olivero, M., Comoglio, P. M., Lemoine, N. R. (1995b). Expression of the Met/hepatocyte growth factor receptor in human pancreatic cancer. Cancer Res 55, 11291138.
Dransfield, D. T., Bradford, A. J., Smith, J., Martin, M., Roy, C., Mangeat, P. H., Goldenring, J. R. (1997). Ezrin is a cyclic AMP-dependent protein kinase anchoring protein. EMBO J 16, 3543.[CrossRef][Medline]
Egan, S. E., Giddings, B. W., Brooks, M. W., Buday, L., Sizeland, A. M., Weinberg, R. A. (1993). Association of Sos Ras exchange protein with Grb2 is implicated in tyrosine kinase signal transduction and transformation. Nature 363, 4551.[CrossRef][Medline]
Fogh, J., Fogh, J. M., Orfeo, T. (1977). One hundred and twenty-seven cultured human tumor cell lines producing tumors in nude mice. J. Natl. Cancer Inst 59, 221226.[Medline]
Gautreau, A., Louvard, D., Arpin, M. (2000). Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J. Cell Biol 150, 193203.
Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M. H., Shaw, P. E. (1995). ERK phosphorylation potentiates Elk-1-mediated ternary complex formation and transactivation. EMBO J 14, 951962.[Medline]
Giordano, S., Zhen, Z., Medico, E., Gaudino, G., Galimi, F., Comoglio, P. M. (1993). Transfer of motogenic and invasive response to scatter factor/hepatocyte growth factor by transfection of human MET protooncogene. Proc. Natl. Acad. Sci. USA 90, 649653.
Günthert, U., Hofmann, M., Rudy, W., Reber, S., Zöller, M., Haußmann, I., Matzku, S., Wenzel, A., Ponta, H., Herrlich, P. (1991). A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 65, 1324.[CrossRef][Medline]
Helander, T. S., Carpen, O., Turunen, O., Kovanen, P. E., Vaheri, A., Timonen, T. (1996). ICAM-2 redistributed by ezrin as a target for killer cells. Nature 382, 265268.[CrossRef][Medline]
Huser, M., Luckett, J., Chiloeches, A., Mercer, K., Iwobi, M., Giblett, S., Sun, X. M., Brown, J., Marais, R., Pritchard, C. (2001). MEK kinase activity is not necessary for Raf-1 function. EMBO J 20, 19401951.[CrossRef][Medline]
Ivetic, A. and Ridley, A. J. (2004). Ezrin/radixin/moesin proteins and Rho GTPase signalling in leucocytes. Immunology 112, 165176.[CrossRef][Medline]
Jeffers, M., Rong, S., Anver, M., Vande Woude, G. F. (1996). Autocrine hepatocyte growth factor/scatter factor-Met signaling induces transformation and the invasive/metastastic phenotype in C127 cells. Oncogene 13, 853856.[Medline]
Khanna, C., Wan, X., Bose, S., Cassaday, R., Olomu, O., Mendoza, A., Yeung, C., Gorlick, R., Hewitt, S. M., Helman, L. J. (2004). The membrane-cytoskeleton linker ezrin is necessary for osteosarcoma metastasis. Nat. Med 10, 182186.[CrossRef][Medline]
Kodama, A., Matozaki, T., Fukuhara, A., Kikyo, M., Ichihashi, M., Takai, Y. (2000). Involvement of an SHP-2-Rho small G protein pathway in hepatocyte growth factor/scatter factor-induced cell scattering. Mol. Biol. Cell 11, 25652575.
Krawczyk, C. and Penninger, J. M. (2001). Molecular controls of antigen receptor clustering and autoimmunity. Trends Cell Biol 11, 212220.[CrossRef][Medline]
Li, Y., Hua, F., Carraway, K. L., Carraway, C. A. (1999). The p185(neu)-containing glycoprotein complex of a microfilament-associated signal transduction particle. Purification, reconstitution, and molecular associations with p58(gag) and actin. J. Biol. Chem 274, 2565125658.
Loebrich, S., Bahring, R., Katsuno, T., Tsukita, S., Kneussel, M. (2006). Activated radixin is essential for GABAA receptor alpha5 subunit anchoring at the actin cytoskeleton. EMBO J 25, 987999.[CrossRef][Medline]
Matzke, A., Herrlich, P., Ponta, H., Orian-Rousseau, V. (2005). A 5-amino-acid peptide blocks Met and Ron dependent cell migration. Cancer Res 65, 61056110.
Matzku, S., Komitowski, D., Mildenberger, M., Zoller, M. (1983). Characterization of BSp73, a spontaneous rat tumor and its in vivo selected variants showing different metastasizing capacities. Invasion Metastasis 3, 109123.[Medline]
Miralles, F., Posern, G., Zaromytidou, A. I., Treisman, R. (2003). Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 113, 329342.[CrossRef][Medline]
Morrison, H., Sherman, L. S., Legg, J., Banine, F., Isacke, C., Haipek, C. A., Gutmann, D. H., Ponta, H., Herrlich, P. (2001). The NF2 tumor suppressor gene product, merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev 15, 968980.
Morrison, H., Sperka, T., Manent, J., Giovannini, M., Ponta, H., Herrlich, P. (2007). Merlin/NF2 suppresses growth by inhibiting the activation of Ras and Rac. Cancer Research in press.
Musil, L. S. and Goodenough, D. A. (1991). Biochemical analysis of connexin43 intracellular transport, phosphorylation, and assembly into gap junctional plaques. J. Cell Biol 115, 13571374.
Naor, D., Nedvetzki, S., Golan, I., Melnik, L., Faitelson, Y. (2002). CD44 in cancer. Crit. Rev. Clin. Lab. Sci 39, 527579.[CrossRef][Medline]
Naor, D., Sionov, R. V., Ish-Shalom, D. (1997). CD 44, structure, function and association with the malignant process. In: Advances in Cancer Research, ed. G. F. Vande Woude and G. Klein. San Diego, CA: Elsevier, Academic Press, Vol. 71, 243318.
Nel, A. E., Gupta, S., Lee, L., Ledbetter, J. A., Kanner, S. B. (1995). Ligation of the T-cell antigen receptor (TCR) induces association of hSos1, ZAP-70, phospholipase C-gamma 1, and other phosphoproteins with Grb2 and the zeta-chain of the TCR. J. Biol. Chem 270, 1842818436.
Nishida, K., et al. (1999). Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B-cell antigen receptors. Blood 93, 18091816.
Orian-Rousseau, V., Chen, L., Sleeman, J. P., Herrlich, P., Ponta, H. (2002). CD44 is required for two consecutive steps in HGF/c-Met signaling. Genes Dev 16, 30743086.
Penninger, J. M. and Crabtree, G. R. (1999). The actin cytoskeleton and lymphocyte activation. Cell 96, 912.[CrossRef][Medline]
Ponta, H., Sherman, L., Herrlich, P. A. (2003). CD 44, from adhesion molecules to signalling regulators. Nat. Rev. Mol. Cell Biol 4, 3345.[CrossRef][Medline]
Schaeper, U., Gehring, N. H., Fuchs, K. P., Sachs, M., Kempkes, B., Birchmeier, W. (2000). Coupling of Gab1 to c-Met, Grb2, and Shp2 mediates biological responses. J. Cell Biol 149, 14191432.
Seiter, S., Arch, R., Reber, S., Komitowski, D., Hofmann, M., Ponta, H., Herrlich, P., Matzku, S., Zoller, M. (1993). Prevention of tumor metastasis formation by anti-variant CD44. J. Exp. Med 177, 443455.
Sherman, L., Wainwright, D., Ponta, H., Herrlich, P. (1998). A splice variant of CD44 expressed in the apical ectodermal ridge presents fibroblast growth factors to limb mesenchyme and is required for limb outgrowth. Genes Dev 12, 10581071.
Sleeman, J., Kondo, K., Moll, J., Ponta, H., Herrlich, P. (1997). Variant exons v6 and v7 together expand the repertoire of glycosaminoglycans bound by CD44. J. Biol. Chem 272, 3183731844.
Smith, D. B., Berger, L. C., Wildeman, A. G. (1993). Modified glutathione S-transferase fusion proteins for simplified analysis of protein-protein interactions. Nucleic Acids Res 21, 359360.
Spector, I., Shochet, N. R., Blasberger, D., Kashman, Y. (1989). Latrunculinsnovel marine macrolides that disrupt microfilament organization and affect cell growth: I. Comparison with cytochalasin D. Cell Motil. Cytoskeleton 13, 127144.[CrossRef][Medline]
Treisman, R., Alberts, A. S., Sahai, E. (1998). Regulation of SRF activity by Rho family GTPases. Cold Spring Harb. Symp. Quant. Biol 63, 643651.[CrossRef][Medline]
Tsukita, S., Oishi, K., Sato, N., Sagara, J., Kawai, A. (1994). ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J. Cell Biol 126, 391401.
Tsukita, S. and Yonemura, S. (1997). ERM proteins: head-to-tail regulation of actin-plasma membrane interaction. Trends Biochem. Sci 22, 5358.[CrossRef][Medline]
Turunen, O., Wahlstrom, T., Vaheri, A. (1994). Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J. Cell Biol 126, 14451453.
Yu, Y., Khan, J., Khanna, C., Helman, L., Meltzer, P. S., Merlino, G. (2004). Expression profiling identifies the cytoskeletal organizer ezrin and the developmental homeoprotein Six-1 as key metastatic regulators. Nat. Med 10, 175181.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. J. Killock, M. Parsons, M. Zarrouk, S. M. Ameer-Beg, A. J. Ridley, D. O. Haskard, M. Zvelebil, and A. Ivetic In Vitro and in Vivo Characterization of Molecular Interactions between Calmodulin, Ezrin/Radixin/Moesin, and L-selectin J. Biol. Chem., March 27, 2009; 284(13): 8833 - 8845. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rampon, N. Weiss, C. Deboux, N. Chaverot, F. Miller, D. Buchet, H. Tricoire-Leignel, S. Cazaubon, A. Baron-Van Evercooren, and P.-O. Couraud Molecular Mechanism of Systemic Delivery of Neural Precursor Cells to the Brain: Assembly of Brain Endothelial Apical Cups and Control of Transmigration by CD44 Stem Cells, July 1, 2008; 26(7): 1673 - 1682. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matzke, V. Sargsyan, B. Holtmann, G. Aramuni, E. Asan, M. Sendtner, G. Pace, N. Howells, W. Zhang, H. Ponta, et al. Haploinsufficiency of c-Met in cd44 / Mice Identifies a Collaboration of CD44 and c-Met In Vivo Mol. Cell. Biol., December 15, 2007; 27(24): 8797 - 8806. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Singleton, R. Salgia, L. Moreno-Vinasco, J. Moitra, S. Sammani, T. Mirzapoiazova, and J. G. N. Garcia CD44 Regulates Hepatocyte Growth Factor-mediated Vascular Integrity: ROLE OF c-Met, Tiam1/Rac1, DYNAMIN 2, AND CORTACTIN J. Biol. Chem., October 19, 2007; 282(42): 30643 - 30657. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhu, R. Zhou, S. Mettler, T. Wu, A. Abbas, J. Delaney, and J. G. Forte High turnover of ezrin T567 phosphorylation: conformation, activity, and cellular function Am J Physiol Cell Physiol, September 1, 2007; 293(3): C874 - C884. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||