![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 18, Issue 10, 3883-3893, October 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Department of Molecular Biology, Massachusetts General Hospital, and Department of Genetics, Harvard Medical School, Boston, MA 02114; Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720; and Department of Physiology, Tufts University School of Medicine, Boston, MA 02111
Submitted September 14, 2006;
Revised June 21, 2007;
Accepted July 20, 2007
Monitoring Editor: Francis Barr
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). In mammals, the activity of Cdk5 requires association with either of two regulatory subunits, p35 or p39 (Dhavan and Tsai, 2001). Cdk5 or p35/p39 knockout mice die perinatally, with aberrant layering of cortical neurons, likely due to cell migration defects (Ohshima et al., 1996; Ko et al., 2001).
Recent evidence suggests that Cdk5 may also regulate synaptic transmission (Dhavan and Tsai, 2001; Bibb, 2003; Samuels and Tsai, 2003). Both Cdk5 and p35 are localized to synapses, and they are present in subcellular fractions enriched for synaptic membranes (Dhavan and Tsai, 2001; Morabito et al., 2004). Cdk5 has been proposed to regulate neurotransmitter release by phosphorylating Munc18 and P/Q-type voltage-dependent calcium channels (Fletcher et al., 1999; Tomizawa et al., 2002) and to regulate synaptic vesicle endocytosis by phosphorylating dynamin, type I phosphatidylinositol (4) phosphate 5-kinase, amphiphysin, and synaptojanin (Samuels and Tsai, 2003; Lee et al., 2004, 2005).
Cdk5 has also been proposed to regulate glutamate receptor function. Fast excitatory synaptic transmission is mediated primarily by two families of glutamate receptors (GluRs): 
-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors and N-methyl-D-aspartate (NMDA) receptors. Work from several laboratories suggests that regulation of the abundance of postsynaptic AMPA receptors is a cellular mechanism for producing activity-dependent changes in synaptic strength, e.g., long-term potentiation (LTP), long-term depression, and homeostatic plasticity (Malinow and Malenka, 2002; Song and Huganir, 2002;McGee and Bredt, 2003; Park et al., 2004). Cdk5 phosphorylates PSD95 and the NMDA receptor subunit NR2A, the latter resulting in increased NMDA receptor currents (Li et al., 2001; Wang et al., 2003; Morabito et al., 2004). Cdk5 may also regulate synaptic plasticity, because manipulation of Cdk5 activity produces defects in LTP and spatial learning (Fischer et al., 2002, 2005; Ohshima et al., 2005).
We have used the nematode Caenorhabditis elegans as a genetic model to study regulation of GluR abundance at synapses. The C.elegans genome encodes two NMDA and eight non-NMDA receptor subunits (Brockie et al., 2001a), one of which is encoded by the glr-1 gene (Hart et al., 1995; Maricq et al., 1995). The glr-1 GluR is expressed in ventral cord interneurons (Hart et al., 1995; Maricq et al., 1995), where it is localized at sensory–interneuron and interneuron–interneuron synapses (Rongo et al., 1998; Burbea et al., 2002). We previously showed that the synaptic abundance of GLR-1 receptors is regulated by clathrin-mediated endocytosis and ubiquitin ligases (Burbea et al., 2002; Juo and Kaplan, 2004; Dreier et al., 2005), as are mammalian AMPA receptors (Carroll et al., 1999; Luscher et al., 1999; Man et al., 2000; Colledge et al., 2003; Patrick et al., 2003).
Here, we show that CDK-5 regulates the abundance of GLR-1 in the ventral cord, which may be mediated, in part, by the ability of CDK-5 to regulate the scaffolding protein LIN-10/Mint-1.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The cdk-5 allele gm336 was isolated by screening a C.elegans deletion library. The gm336 mutation corresponds to a 760-base pair deletion defined by the following endpoints (left breakpoint: tagagatttgagagacacaaacaa/right breakpoint: tacttcaattgatatgtggtctgccggg, positionally ambiguous nucleotides are underlined). The cdk-5 allele ok626 was isolated by the C.elegans Knockout Consortium and consists of a 1.6-kb deletion. Both gm336 and ok626 are predicted to be null alleles, because both delete the cdk-5 start codon. The ok626 allele also deletes part of a neighboring gene T27E9.4.
The p35 allele gm335 was isolated by screening a C.elegans deletion library. gm335 deletes the entire coding region of p35. The molecular endpoints of the deletion are undefined. The p35 deletion allele tm648 was isolated by Shohei Mitani (National Bioresource Project) and consists of an 833-base pair deletion. The tm648 deletion removes exons 2 and 3, and it is not likely to encode a functional protein.
Fluorescence Microscopy and Quantitation
All imaging was done using a Zeiss Axiovert 100 microscope (Carl Zeiss, Thornwood, NY) and an ORCA 100 charge-coupled device camera (Hamamatsu, Bridgewater, NJ). Larval stage 4 (L4) animals raised at 20°C were immobilized with 30 mg/ml 2,3-butanedione monoxamine (Sigma-Aldrich, St. Louis, MO) for 5 min before imaging. All images were captured and processed using MetaMorph 4.5 software (Molecular Devices, Downingtown, PA).
Quantitative analysis of puncta fluorescence was achieved using a Planapo 100x (numerical aperture = 1.4) objective (Olympus America, Melville, NY). Maximum intensity projections of Z-series stacks were obtained. Identical fluorescence filters were used for all experiments. Exposure settings and camera gain were set to fill the 12-bit dynamic range without saturation. Line scans of ventral cord puncta fluorescence were obtained using MetaMorph, and they were analyzed in Igor Pro (Wavemetrics, Lake Oswego, OR) using custom-written software (J. Dittman, Massachusetts General Hospital, Boston, MA).
Each line scan corresponded to 
60–70 µm of the ventral nerve cord. Unless otherwise noted, all images were taken from an anterior region of the ventral nerve cord just posterior to the RIG neuronal cell bodies. We also imaged a region of the ventral nerve cord just posterior to the vulva (puncta intensity [normalized] ± SEM: wild type: 1.0 ± 0.06 (n = 25), cdk-5(gm336): 0.71 ± 0.07 (n = 22), p < 0.01; width [µm] ± SEM: wild type: 0.91±0.05, cdk-5(gm336): 0.9 ± 0.08; density [puncta/10 µm] ± SEM: wild type: 1.88±0.1, cdk-5(gm336): 1.76 ± 0.1). These results are similar to those observed in the anterior region of the ventral nerve cord (VNC) (Figure 2). These regions are distinct from that which was analyzed in our previous article, which was anterior to the RIG cell bodies (Juo and Kaplan, 2004); consequently, the data reported here cannot be directly compared with those reported previously. Puncta intensities, widths, and densities from each line scan were analyzed in an automated manner using Igor Pro, as described previously (Burbea et al., 2002). Puncta intensity was measured as the fractional increase in peak fluorescence of each punctum over the diffuse fluorescence in the ventral nerve cord (%
F/F). Puncta widths were determined by measuring the width of each punctum at half the maximum peak fluorescence. Puncta density was determined by the average number of puncta per 10 µm of ventral nerve cord, as described previously (Burbea et al., 2002). All the values reported in the figures are means ± SEM. Statistical significance was determined using the Student's t test.
To quantify soluble green fluorescent protein (GFP) from the glr-1 transcriptional reporter nuIs1, we used MetaMorph version 7.1 software (Molecular Devices) to image the ventral nerve cords of wild-type (nuIs1) and nuIs1;cdk-5(gm336) animals. A defined region posterior to the RIG cell bodies was imaged, and the amount of soluble GFP fluorescence was quantitated using Region Statistics in MetaMorph. The values reported in the text refer to the average pixel intensities ± SEM.
To quantitate the amount of GLR-1::GFP in interneuron cell bodies, we imaged the cell body of the interneuron PVC in L4 animals and quantitated the average pixel intensities of three patches per cell body using MetaMorph version 7.1 software.
Real-Time Polymerase Chain Reaction (PCR)
Total RNA was isolated from wild-type (nuIs24) and cdk-5 null mutant [nuIs24;cdk-5(ok626)] animals by using an RNeasy fibrous tissue kit (QIAGEN, Valencia, CA). cDNA was synthesized using Superscript II (Invitrogen, Carlsbad, CA), and real-time PCR was performed using SYBR Green and SureStart Taq (Stratagene, La Jolla, CA) and a Stratagene MxPro real-time PCR machine. Standard curves were used to calculate the relative amount of glr-1 or lin-10 mRNA in each sample, and they were normalized to actin mRNA.
Transgenes and Germline Transformation
Standard techniques were used to isolate transgenic strains by microinjection of various plasmids (50 ng/µl) with Pttx3::dsRed2 (J. Dittman) as a coinjection marker. nuIs24, nuIs125, and nuEx993 have been described previously (Rongo et al., 1998; Juo and Kaplan, 2004). The p35 (T23F11.3) and cdk-5 open reading frames (ORFs) were obtained by reverse transcription-PCR from wild-type cDNA and subsequently subcloned under the control of the glr-1 promoter (pV6) [pV6::p35 (KP#1413), pV6::cdk-5 (KP#1414)]. Site-directed mutagenesis was performed on pV6::cdk-5 using QuikChange mutagenesis kit (Stratagene) to mutate Asp144 to Asn in pV6::cdk-5(D144N) (KP#1415), and Lys33 to Thr in pV6::cdk-5(K33T) (KP#1416). The lin-10 ORF was subcloned under the control of the glr-1 promoter to create pV6::lin-10 (KP#199) as described previously (Rongo et al., 1998). A Not I site was introduced at the C terminus of LIN-10 just before the stop codon. The LIN-10::GFP construct was created by inserting GFP into the NotI site. Phosphomutant LIN-10(10Pm)::GFP was created by using a combination of site-directed mutagenesis and PCR-overlap extension mutagenesis. The following sites in LIN-10 were mutated to alanine in LIN-10(10Pm): S15A, T26A, T28A, S87A, S155A, S201A, T330A, T396A, T416A, S420A. GFP was introduced at the C terminus of LIN-10 by using a NotI site to create pV6::LIN-10(10Pm)::GFP. All constructs were confirmed by sequencing. Full details of plasmids and oligonucleotides are available upon request.
Behavior Assays
Nose touch assays were preformed as described previously (Kaplan and Horvitz, 1993). Briefly, young adult wild-type, cdk-5(gm336), cdk-5(ok626), or glr-1(n2461) animals were placed on a thin lawn of OP50 Escherichia coli and assayed for nose touch responses to an eyelash. Each animal was scored 10 times. For locomotion assays, young adult wild-type animals, overexpressing Pglr-1::cdk-5(pzIs2), glr-1(n2461), and Pglr-1::cdk-5(pzIs2);glr-1(n2461) double mutant animals were transferred with halocarbon oil (Sigma-Aldrich) to an NGM plate without food. After 2 min of equilibration, the number of reversals/min was recorded for a total of 5 min/animal. Both behavioral assays were performed by an experimenter unaware of the mutant genotypes (i.e., in a blind manner).
Kinase Assays
Full-length LIN-10, LIN-10(C) (amino acids [aa] 1–572), and LIN-10(N) (aa 565-954) were N-terminally tagged with glutathione S-transferase (GST), expressed in bacteria and purified using standard techniques. GST-tagged substrates were incubated in a 30-µl reaction with [
32P]ATP and kinase buffer (50 mM HEPES, pH 7, 10 mM MgCl2, 100 µm ATP, 1 mM dithiothreitol, 50 mM 
-glycerolphosphate) for 30 min at 37°C either with or without purified, recombinant CDK5/p25 (a gift from L.-H. Tsai, MIT, MA). Kinase assay reactions were stopped with 30 µl of 2X sample buffer (250 mM Tris, pH 6.8, 4% SDS, 10% -mercaptoethanol, 15% glycerol, and 0.25% bromophenol blue), and analyzed on SDS-polyacrylamide gels, stained with Coomassie Brilliant Blue, dried and autoradiographed.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). GLR-1::GFP has a punctate pattern of localization in the VNC interneurons (Rongo et al., 1998). Greater than 80% of the GLR-1::GFP puncta are closely apposed by the presynaptic markers synaptobrevin and the vesicular glutamate transporter (VGLUT), indicating that GLR-1::GFP localizes to postsynaptic elements (Burbea et al., 2002).
To test whether CDK-5 regulates GLR-1 trafficking, we analyzed the distribution of GLR-1::GFP in two p35 deletion mutants, p35(tm648) and p35(gm335) (p35 is also known as cdka-1; see Materials and Methods), using quantitative fluorescence microscopy. To estimate the amount of GLR-1::GFP in each punctum, we measured the fluorescence intensities (%F/F) and widths of each punctum, as described previously (see Materials and Methods) (Burbea et al., 2002). To assess changes in the number of GLR-1-containing synapses in the ventral cord, we measured the density of GLR-1::GFP puncta. GLR-1::GFP puncta intensities were significantly decreased in both p35 mutants (Figure 1, A–C and E), whereas puncta densities were unchanged (data not shown). The decreased puncta intensities observed in p35(gm335) mutants were corrected by expression of wild-type p35 cDNA in ventral cord interneurons, by using the glr-1 promoter (Figure 1, D–F) (Hart et al., 1995; Maricq et al., 1995). These data indicate that p35 functions in interneurons to regulate GLR-1::GFP abundance in the ventral cord.
|
|
) did not increase puncta fluorescence (Figure 3, A–D, G, and H). The failure of these mutant constructs to increase GLR-1 abundance in the cord could be caused by decreased stability of the mutant proteins; however, equivalent point mutations in mammalian Cdk5 did not affect protein stability in cultured cells (Nikolic et al., 1996). Overexpressing CDK-5(D144N) produced a slight decrease (p < 0.01) in GLR-1::GFP puncta fluorescence (Figure 3G), suggesting that this mutant protein must be expressed at sufficiently high levels to produce dominant-negative activity. The increased GLR-1::GFP abundance caused by overexpression of CDK-5 was eliminated in mutants lacking p35 (Figure 3, A, B, and E–H), suggesting that endogenous p35 is required for this effect. These results indicate that CDK-5/p35 catalytic activity bidirectionally regulates GLR-1::GFP levels in the ventral cord.
|
CDK-5 Regulates GLR-1–dependent Behaviors
If CDK-5 regulates the abundance of GLR-1 at synapses, we might expect an effect on GLR-1 function and a consequent change in behavior. Two simple behavioral assays can be used to assess the function of GLR-1–containing synapses: the nose touch assay and locomotion (Hart et al., 1995; Maricq et al., 1995; Zheng et al., 1999). Gentle touch to the nose of the worm results in a mechanosensory reflex that induces backward locomotion. Mutants with defects in glutamatergic signaling, such as glr-1 or eat-4 VGLUT (a presynaptic vesicular glutamate pump) nulls are less responsive to nose touch (Hart et al., 1995, 1999; Maricq et al., 1995; Berger et al., 1998). We found that cdk-5 null mutant animals had decreased responses to nose touch compared with wild-type controls (Figure 3I; Student's t test, p < 0.01 for both cdk-5 alleles). We also tested whether increased CDK-5 activity affected locomotion behavior. C.elegans moves in a sinusoidal pattern and alternates between periods of forward and reverse locomotion. The frequency of reversals is dependent on the amount of glutamatergic signaling. For example, mutants with decreased glutamatergic signaling, such as glr-1 or eat-4 VGLUT mutants, have decreased reversal frequencies compared with controls (Zheng et al., 1999; Brockie et al., 2001b; Burbea et al., 2002; Juo and Kaplan, 2004; Schaefer and Rongo, 2006) (Figure 3J). Conversely, mutants with increased glutamatergic signaling have increased reversal frequencies compared with controls (Zheng et al., 1999; Burbea et al., 2002; Juo and Kaplan, 2004; Schaefer and Rongo, 2006). We found that animals overexpressing cdk-5 under the glr-1 promoter (Pglr-1::cdk-5) had increased reversal frequencies compared with wild-type controls (Figure 3J), as would be predicted if glutamatergic signaling were increased. Furthermore, the increased reversal frequency caused by overexpressed cdk-5 (Pglr-1::cdk-5) was suppressed in glr-1 null mutant animals (Figure 3J), suggesting that CDK-5 regulation of locomotion behavior is dependent on endogenous GLR-1. Thus, CDK-5 activity bidirectionally regulates GLR-1::GFP abundance in the ventral cord, and produces corresponding changes in GLR-1–mediated behaviors.
The Distribution of Synaptobrevin Was Not Altered in cdk-5 Mutants
To determine whether CDK-5 regulates the trafficking of other synaptic proteins, we examined the distribution of the synaptic vesicle protein, synaptobrevin, tagged with GFP (SNB-1::GFP). The intensities, widths, and densities of SNB-1::GFP puncta were unaltered in both cdk-5(gm336) and cdk-5(ok626) compared with wild-type controls (Figure 4, A–C). These results suggest that the effects of CDK-5 on GLR-1::GFP are unlikely to be a secondary consequence of decreased synaptic inputs, because the density of presynaptic SNB-1::GFP puncta was normal in cdk-5 mutants. Cdk5 has been implicated in synaptic vesicle endocytosis; however, we did not observe increased, diffuse SNB-1::GFP fluorescence in the ventral cord, which is characteristically found in other endocytic mutants (Jorgensen et al., 1995; Burbea et al., 2002; Schuske et al., 2003; Dittman and Kaplan, 2006). These results do not exclude the possibility that CDK-5 regulates synaptic vesicle endocytosis, as has been suggested previously (Samuels and Tsai, 2003; Lee et al., 2004; Lee et al., 2005), because our analysis is likely insensitive to small changes in endocytosis (Dittman and Kaplan, 2006). Together, our results are most consistent with the idea that CDK-5 directly regulates some aspect of GLR-1 trafficking.
|
; Dhavan and Tsai, 2001; Morfini et al., 2004), and endocytic recycling of cargo proteins (Samuels and Tsai, 2003; Lee et al., 2004, 2005). Either of these functions could explain the effects of CDK-5 on the distribution of GLR-1::GFP. The decreased GLR-1::GFP observed in cdk-5 mutants could result from increased postendocytic degradation of GLR-1 or from decreased anterograde trafficking of GLR-1 to the VNC. To distinguish between these possibilities, we analyzed unc-11;cdk-5 double mutants (Figure 5, A–F). Null mutations in unc-11, which encodes the clathrin adaptin AP180, have defects in clathrin-mediated endocytosis (Zhang et al., 1998; Nonet et al., 1999), resulting in the accumulation of GLR-1::GFP in the VNC (Figure 5, A and B) (Burbea et al., 2002). If GLR-1::GFP endocytosis is enhanced in a cdk-5 loss-of-function mutant, then the distribution of GLR-1::GFP in unc-11;cdk-5 double mutants should be similar to that seen in unc-11 single mutants, because unc-11 AP180 mutations should block this enhanced retrieval. By contrast, we found that unc-11;cdk-5 double mutants had GLR-1::GFP puncta intensities that were indistinguishable from those found in cdk-5(gm336) single mutants (p = 0.4) (Figure 5, C–F). Similar results were observed in unc-11 double mutants by using the cdk-5(ok626) allele (data not shown). These results suggest that CDK-5 regulates a process that occurs earlier in the secretory pathway than receptor recycling, and they are consistent with a role for CDK-5 in regulating anterograde trafficking of GLR-1::GFP.
|
CDK-5 Negatively Regulates the Abundance of LIN-10/Mint-1
What is the target of CDK-5 that mediates its effects on GLR-1::GFP? Several studies suggest that the PDZ protein LIN-10/Mint-1 may regulate anterograde membrane trafficking from the ER/Golgi to the synapse. LIN-10/Mint-1 localizes to the Golgi and to synapses, and it regulates the surface expression of AMPA receptors in mammalian hippocampal neurons (Butz et al., 1998; Borg et al., 1999; Whitfield et al., 1999; Tomita et al., 2001; Stricker and Huganir, 2003). In addition, mammalian LIN-10/Mint-1 has been proposed to act as a cargo adaptor promoting association of the kinesin KIF17 with NMDA receptor-containing transport vesicles (Setou et al., 2000). We showed previously that the distribution of GLR-1::GFP is abnormal in lin-10 mutants (Rongo et al., 1998). The intensities and widths of GLR-1::GFP puncta increase in lin-10(n1853) loss-of-function mutants compared with wild-type controls (Figure 6A and C–E) (Rongo et al., 1998). Similar results were seen in a second loss-of-function mutant lin-10(e1439) (data not shown) (Rongo et al., 1998). Conversely, overexpression of lin-10 cDNA in interneurons (using the glr-1 promoter) resulted in a small but significant decrease in GLR-1::GFP puncta intensities and widths compared with wild-type controls (Figure 6, A and B, and D and E). These results indicate that LIN-10/Mint-1 negatively regulates the abundance of GLR-1::GFP in the VNC. These findings are consistent with data from cultured rat neurons where overexpression of wild-type Mint-1 decreased GluR1 surface clusters, whereas expression of a mutant Mint-1 protein, in which the first PDZ domain was mutated, increased GluR1 clusters (Stricker and Huganir, 2003).
|
; Juo and Kaplan, 2004; Dreier et al., 2005). Overexpression of the cdk-5 cDNA in interneurons, by using the glr-1 promoter, decreased the intensities and density of LIN-10::GFP puncta, with no effect on puncta widths (Figure 7, A and B, E–G). Conversely, LIN-10::GFP puncta intensities increased in both cdk-5(gm336) and cdk-5(ok626) loss-of-function mutants (Figure 7, A–E). These results indicate that CDK-5 decreases the abundance of LIN-10::GFP in the ventral nerve cord. Changes in LIN-10::GFP abundance were not caused by changes in expression of the transgene because expression of the glr-1 promoter (which was used to drive expression of this construct) was not altered in cdk-5 mutants (detailed above). Moreover, the abundance of endogenous lin-10 mRNA was not significantly different between wild-type and cdk-5 null mutant animals (mean lin-10 mRNA levels ± SEM normalized to actin mRNA: wild-type animals = 1.1 ± 0.1, n = 4; cdk-5(ok626) null mutant animals = 1.2 ± 0.1, n = 6; Student's t test, p = 0.06). These results indicate that CDK-5 regulates LIN-10::GFP abundance by a posttranscriptional mechanism.
|
). To determine whether LIN-10/Mint-1 is a direct substrate for CDK-5, we performed an in vitro kinase assay by using recombinant mammalian Cdk5/p25 and GST-tagged LIN-10 proteins (Figure 8, A and B). p25 is a truncated, more active form of p35 (Dhavan and Tsai, 2001). Cdk5/p25 phosphorylated full-length LIN-10 and a deletion mutant lacking the C terminus (C), but not a mutant lacking the N terminus (N) (Figure 8B; data not shown). These results indicate that Cdk5 can directly phosphorylate the amino-terminal domain of LIN-10 in vitro.
|
Thus far, our results suggest that CDK-5 regulates LIN-10 abundance, which may contribute to CDK-5–mediated regulation of GLR-1 abundance and behaviors. To further test this idea, we analyzed GLR-1 abundance in lin-10;cdk-5 double mutants (Figure 9). If LIN-10 is the only CDK-5 target required for regulation of GLR-1, then we would expect that CDK-5 would not be able to regulate GLR-1 in the absence of LIN-10 in a lin-10 mutant. Instead, we found that GLR-1::GFP puncta intensities in cdk-5;lin-10 double mutants were intermediate in value between cdk-5 and lin-10 single mutants (Figure 9). These results suggest that CDK-5 must have other relevant targets, in addition to LIN-10, because CDK-5 was still able to regulate GLR-1 in lin-10 mutants (i.e., double mutant puncta intensities were significantly lower than those found in lin-10 single mutants).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Our results suggest that CDK-5 positively regulates the abundance of GLR-1 in the ventral cord and that it has corresponding effects on GLR-1-mediated behaviors (nose touch and locomotion). CDK-5 regulation of GLR-1 depends on its kinase activity and on the regulatory subunit p35. The effects of CDK-5/p35 on GLR-1 are cell autonomous and consistent with the idea that CDK-5 plays a role in regulating GLR-1 trafficking.
CDK-5 Regulation of the Polarized Protein Trafficking Machinery
The scaffolding protein LIN-10/Mint-1 is required for polarized sorting of the LET-23 epidermal growth factor receptor to the basolateral domain of epithelial cells in C.elegans (Kaech et al., 1998). In both mammals and worms, LIN-10/Mint-1 proteins have been shown to exist in heteromultimeric protein complexes containing LIN-2/CASK, LIN-7/Veli, Caskin, and SAP97 proteins (Butz et al., 1998; Borg et al., 1999). These protein complexes have been proposed to play a general role in polarized receptor trafficking in both epithelial cells and neurons (to basolateral and dendritic domains, respectively).
We showed that LIN-10/Mint-1 is likely a physiological substrate of CDK-5. Recombinant CDK-5 phosphorylated LIN-10/Mint-1 in vitro. In vivo, CDK-5 activity decreased the abundance of the scaffolding protein LIN-10/Mint-1 in the ventral cord, and a nonphosphorylatable mutant LIN-10 protein was resistant to this effect (Figures 7 and 8). These results suggest that CDK-5 is likely to directly regulate the function of protein complexes containing LIN-10/Mint-1, and thus it could potentially regulate the polarized trafficking of axonal and dendritic proteins.
What Aspect of GLR-1 Trafficking Is Regulated by CDK-5?
CDK-5/p35 seems to regulate an early step in the secretory pathway. Our data show that cdk-5 loss-of-function mutants have decreased GLR-1::GFP in the ventral cord, whereas overexpression of cdk-5 results in increased GLR-1::GFP (Figures 2 and 3). Loss of CDK-5 activity prevents accumulation of GLR-1::GFP in the ventral cord after blockade of clathrin-mediated endocytosis (Figure 5). This result suggests that CDK-5 regulates an aspect of GLR-1 trafficking that occurs before receptor recycling. In support of this model, GLR-1::GFP accumulates in neuronal cell bodies in cdk-5 null mutant animals (Figure 5). Thus, CDK-5 could regulate assembly of receptors in the endoplasmic reticulum, budding of receptors from the Golgi, or anterograde transport of receptors from the Golgi to the ventral cord. Consistent with the idea that CDK-5 regulates anterograde transport of GLR-1, previous studies have suggested that Cdk5 promotes kinesin-mediated transport of membrane bound cargo in squid axoplasm (Ratner et al., 1998; Morfini et al., 2004).
Because LIN-10 regulates GLR-1 in the VNC and has been implicated in receptor trafficking (Rongo et al., 1998; Borg et al., 1999; Whitfield et al., 1999; Setou et al., 2000; Tomita et al., 2001; Hill et al., 2003; Stricker and Huganir, 2003), we tested whether LIN-10 was required for the effects of CDK-5 on GLR-1. We found that GLR-1::GFP puncta fluorescence intensities in cdk-5;lin-10 double mutants were intermediate in value between those observed in cdk-5 and lin-10 single mutants (Figure 9). This result could be interpreted in either of two ways: 1) CDK-5 and LIN-10 function in independent parallel pathways to regulate GLR-1, or 2) CDK-5 regulation of GLR-1 is mediated, in part, through LIN-10, but there are other relevant CDK-5 targets in vivo. We favor the second interpretation for several reasons. Changes in LIN-10 abundance are sufficient to alter GLR-1 in the nerve cord (Figure 6). As detailed above, LIN-10 is likely to be a CDK-5 substrate in vivo, whereby LIN-10 abundance in the nerve cord is negatively regulated by CDK-5. These results strongly support the idea that CDK-5 and LIN-10 are two components of a single biochemical pathway. Nonetheless, further experiments will be required to decisively determine the role of LIN-10 in CDK-5–mediated regulation of GLR-1. Our results do clearly indicate that CDK-5 must have additional targets that contribute to regulating GLR-1. Although we have no direct data bearing on the identity of these targets, two interesting possibilities are the microtubule-associated proteins TAU and MAP1B, both of which are known Cdk5 targets (Pigino et al., 1997; Flaherty et al., 2000).
CDK-5–mediated regulation of LIN-10/Mint1 abundance provides a potential mechanism coupling CDK-5 activity to the anterograde trafficking process. Several previous studies support the idea that LIN-10/Mint-1 proteins are involved in anterograde transport of GluRs. First, mammalian LIN-10/Mint-1 proteins are localized to the trans-Golgi network (TGN), as well as to both pre- and postsynaptic elements (Butz et al., 1998; Borg et al., 1999; Whitfield et al., 1999; Tomita et al., 2001; Stricker and Huganir, 2003). Thus, LIN-10/Mint1 proteins are found in subcellular locations consistent with a role in anterograde transport. Second, LIN-10/Mint-1 proteins have been proposed to act as coat proteins that promote budding of cargo into transport vesicles at the TGN (Hill et al., 2003). Third, the mouse LIN-10/Mint-1 protein has been proposed to act as a cargo adaptor linking NMDA receptor subunits to the anterograde motor protein KIF17 (Setou et al., 2000). Fourth, overexpression of LIN-10/Mint-1 proteins in cultured rat neurons decreases delivery of GluR1 to the cell surface (Stricker and Huganir, 2003).
These studies raise the possibility that LIN-10/Mint-1 and CDK-5 regulate trafficking of GLR-1 from the ER/Golgi to synaptic sites and that they may do so as part of a single biochemical pathway. Our studies also suggest that CDK-5 regulation of GLR-1 is functionally important, because perturbing CDK-5 activity produces changes in GLR-1–mediated behaviors.
Implications for Neurodegeneration and Synaptic Plasticity
Many previous studies have suggested that Cdk5 plays a central role in neurodegeneration. More recent studies have suggested that Cdk5 also regulates synaptic transmission (Fu et al., 2001; Fischer et al., 2002, 2005; Bibb, 2003; Ohshima et al., 2005). Our results provide further support for a potential synaptic function for CDK-5. These results have several potentially interesting implications. It is possible that misregulation of anterograde transport of GluRs contributes to the effects of CDK-5 on neurodegeneration. Increased CDK-5 activity, for example, after cleavage of p35 to the more active p25 by the protease calpain, could predispose neurons to excitotoxicity by increasing the delivery of GluRs to dendrites and nerve terminals. Conversely, inhibition of CDK-5 activity may provide a useful therapy for mitigating neuron death by potentially decreasing excitotoxicity.
Several studies have suggested that regulated delivery of GluRs to synapses is an important mechanism for expressing activity-dependent synaptic plasticity (Malinow and Malenka, 2002; Song and Huganir, 2002; McGee and Bredt, 2003). In most cases, the activity-dependent step is proposed to be some aspect of endocytic recycling of GluRs at nerve terminals. For example, a recent study shows that delivery of GluRs from recycling endosomes to the synaptic cell surface is the critical step in LTP (Park et al., 2004). Other studies suggest that activity also regulates earlier steps in the secretory pathway. For example, chronic activity blockade regulates the splicing of the NMDA receptor subunit NR1 pre-mRNAs, leading to expression of an NR1 isoform that has accelerated exit from the ER (Mu et al., 2003). Our studies provide further support for the idea that regulated anterograde transport of GluRs may provide an additional cellular mechanism for synaptic plasticity.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Peter Juo (peter.juo{at}tufts.edu)
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Berger, A. J., Hart, A. C., and Kaplan, J. M. (1998). G alphas-induced neurodegeneration in Caenorhabditis elegans. J. Neurosci 18, 2871–2880.
Bibb, J. A. (2003). Role of Cdk5 in neuronal signaling, plasticity, and drug abuse. Neurosignals 12, 191–199.[CrossRef][Medline]
Borg, J. P., Lopez-Figueroa, M. O., de Taddeo-Borg, M., Kroon, D. E., Turner, R. S., Watson, S. J., and Margolis, B. (1999). Molecular analysis of the X11-mLin-2/CASK complex in brain. J. Neurosci 19, 1307–1316.
Brockie, P. J., Madsen, D. M., Zheng, Y., Mellem, J., and Maricq, A. V. (2001a). Differential expression of glutamate receptor subunits in the nervous system of Caenorhabditis elegans and their regulation by the homeodomain protein UNC-42. J. Neurosci 21, 1510–1522.
Brockie, P. J., Mellem, J. E., Hills, T., Madsen, D. M., and Maricq, A. V. (2001b). The C. elegans glutamate receptor subunit NMR-1 is required for slow NMDA-activated currents that regulate reversal frequency during locomotion. Neuron 31, 617–630.[CrossRef][Medline]
Burbea, M., Dreier, L., Dittman, J. S., Grunwald, M. E., and Kaplan, J. M. (2002). Ubiquitin and AP180 regulate the abundance of GLR-1 glutamate receptors at postsynaptic elements in C. elegans. Neuron 35, 107–120.[CrossRef][Medline]
Butz, S., Okamoto, M., and Sudhof, T. C. (1998). A tripartite protein complex with the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Cell 94, 773–782.[CrossRef][Medline]
Carroll, R. C., Beattie, E. C., Xia, H., Luscher, C., Altschuler, Y., Nicoll, R. A., Malenka, R. C., and von Zastrow, M. (1999). Dynamin-dependent endocytosis of ionotropic glutamate receptors. Proc. Natl. Acad. Sci. USA 96, 14112–14117.
Colledge, M., Snyder, E. M., Crozier, R. A., Soderling, J. A., Jin, Y., Langeberg, L. K., Lu, H., Bear, M. F., and Scott, J. D. (2003). Ubiquitination regulates PSD-95 degradation and AMPA receptor surface expression. Neuron 40, 595–607.[CrossRef][Medline]
Dhavan, R., and Tsai, L. H. (2001). A decade of CDK5. Nat. Rev. Mol. Cell Biol 2, 749–759.[CrossRef][Medline]
Dittman, J. S., and Kaplan, J. M. (2006). Factors regulating the abundance and localization of synaptobrevin in the plasma membrane. Proc. Natl. Acad. Sci. USA 103, 11399–11404.
Dreier, L., Burbea, M., and Kaplan, J. M. (2005). LIN-23-mediated degradation of beta-catenin regulates the abundance of GLR-1 glutamate receptors in the ventral nerve cord of C. elegans. Neuron 46, 51–64.[CrossRef][Medline]
Fischer, A., Sananbenesi, F., Pang, P. T., Lu, B., and Tsai, L. H. (2005). Opposing roles of transient and prolonged expression of p25 in synaptic plasticity and hippocampus-dependent memory. Neuron 48, 825–838.[CrossRef][Medline]
Fischer, A., Sananbenesi, F., Schrick, C., Spiess, J., and Radulovic, J. (2002). Cyclin-dependent kinase 5 is required for associative learning. J. Neurosci 22, 3700–3707.
Flaherty, D. B., Soria, J. P., Tomasiewicz, H. G., and Wood, J. G. (2000). Phosphorylation of human tau protein by microtubule-associated kinases: GSK3beta and cdk5 are key participants. J. Neurosci. Res 62, 463–472.[CrossRef][Medline]
Fletcher, A. I., Shuang, R., Giovannucci, D. R., Zhang, L., Bittner, M. A., and Stuenkel, E. L. (1999). Regulation of exocytosis by cyclin-dependent kinase 5 via phosphorylation of Munc18. J. Biol. Chem 274, 4027–4035.
Fu, A. K., Fu, W. Y., Cheung, J., Tsim, K. W., Ip, F. C., Wang, J. H., and Ip, N. Y. (2001). Cdk5 is involved in neuregulin-induced AChR expression at the neuromuscular junction. Nat. Neurosci 4, 374–381.[CrossRef][Medline]
Hart, A. C., Kass, J., Shapiro, J. E., and Kaplan, J. M. (1999). Distinct signaling pathways mediate touch and osmosensory responses in a polymodal sensory neuron. J. Neurosci 19, 1952–1958.
Hart, A. C., Sims, S., and Kaplan, J. M. (1995). Synaptic code for sensory modalities revealed by C. elegans GLR-1 glutamate receptor. Nature 378, 82–85.[CrossRef][Medline]
Hill, K., Li, Y., Bennett, M., McKay, M., Zhu, X., Shern, J., Torre, E., Lah, J. J., Levey, A. I., and Kahn, R. A. (2003). Munc18 interacting proteins: ADP-ribosylation factor-dependent coat proteins that regulate the traffic of -Alzheimer's precursor protein. J. Biol. Chem 278, 36032–36040.
Jorgensen, E. M., Hartwieg, E., Schuske, K., Nonet, M. L., Jin, Y., and Horvitz, H. R. (1995). Defective recycling of synaptic vesicles in synaptotagmin mutants of Caenorhabditis elegans. Nature 378, 196–199.[CrossRef][Medline]
Juo, P., and Kaplan, J. M. (2004). The anaphase-promoting complex regulates the abundance of GLR-1 glutamate receptors in the ventral nerve cord of C. elegans. Curr. Biol 14, 2057–2062.[CrossRef][Medline]
Kaech, S. M., Whitfield, C. W., and Kim, S. K. (1998). The LIN-2/LIN-7/LIN-10 complex mediates basolateral membrane localization of the C. elegans EGF receptor LET-23 in vulval epithelial cells. Cell 94, 761–771.[CrossRef][Medline]
Kaplan, J. M., and Horvitz, H. R. (1993). A dual mechanosensory and chemosensory neuron in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 90, 2227–2231.
Ko, J., Humbert, S., Bronson, R. T., Takahashi, S., Kulkarni, A. B., Li, E., and Tsai, L. H. (2001). p35 and p39 are essential for cyclin-dependent kinase 5 function during neurodevelopment. J. Neurosci 21, 6758–6771.
Lee, S. Y., Voronov, S., Letinic, K., Nairn, A. C., Di Paolo, G., and De Camilli, P. (2005). Regulation of the interaction between PIPKI gamma and talin by proline-directed protein kinases. J. Cell Biol 168, 789–799.
Lee, S. Y., Wenk, M. R., Kim, Y., Nairn, A. C., and De Camilli, P. (2004). Regulation of synaptojanin 1 by cyclin-dependent kinase 5 at synapses. Proc. Natl. Acad. Sci. USA 101, 546–551.
Li, B. S., Sun, M. K., Zhang, L., Takahashi, S., Ma, W., Vinade, L., Kulkarni, A. B., Brady, R. O., and Pant, H. C. (2001). Regulation of NMDA receptors by cyclin-dependent kinase-5. Proc. Natl. Acad. Sci. USA 98, 12742–12747.
Luscher, C., Xia, H., Beattie, E. C., Carroll, R. C., von Zastrow, M., Malenka, R. C., and Nicoll, R. A. (1999). Role of AMPA receptor cycling in synaptic transmission and plasticity. Neuron 24, 649–658.[CrossRef][Medline]
Malinow, R., and Malenka, R. C. (2002). AMPA receptor trafficking and synaptic plasticity. Annu. Rev. Neurosci 25, 103–126.[CrossRef][Medline]
Man, H. Y., Lin, J. W., Ju, W. H., Ahmadian, G., Liu, L., Becker, L. E., Sheng, M., and Wang, Y. T. (2000). Regulation of AMPA receptor-mediated synaptic transmission by clathrin-dependent receptor internalization. Neuron 25, 649–662.[CrossRef][Medline]
Maricq, A. V., Peckol, E., Driscoll, M., and Bargmann, C. I. (1995). Mechanosensory signalling in C. elegans mediated by the GLR-1 glutamate receptor. Nature 378, 78–81.[CrossRef][Medline]
McGee, A. W., and Bredt, D. S. (2003). Assembly and plasticity of the glutamatergic postsynaptic specialization. Curr. Opin. Neurobiol 13, 111–118.[CrossRef][Medline]
Morabito, M. A., Sheng, M., and Tsai, L. H. (2004). Cyclin-dependent kinase 5 phosphorylates the N-terminal domain of the postsynaptic density protein PSD-95 in neurons. J. Neurosci 24, 865–876.
Morfini, G., Szebenyi, G., Brown, H., Pant, H. C., Pigino, G., DeBoer, S., Beffert, U., and Brady, S. T. (2004). A novel CDK5-dependent pathway for regulating GSK3 activity and kinesin-driven motility in neurons. EMBO J 23, 2235–2245.[CrossRef][Medline]
Mu, Y., Otsuka, T., Horton, A. C., Scott, D. B., and Ehlers, M. D. (2003). Activity-dependent mRNA splicing controls ER export and synaptic delivery of NMDA receptors. Neuron 40, 581–594.[CrossRef][Medline]
Nikolic, M., Dudek, H., Kwon, Y. T., Ramos, Y. F., and Tsai, L. H. (1996). The cdk5/p35 kinase is essential for neurite outgrowth during neuronal differentiation. Genes Dev 10, 816–825.
Nonet, M. L., Holgado, A. M., Brewer, F., Serpe, C. J., Norbeck, B. A., Holleran, J., Wei, L., Hartwieg, E., Jorgensen, E. M., and Alfonso, A. (1999). UNC-11, a Caenorhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol. Biol. Cell 10, 2343–2360.
Ohshima, T. et al. (2005). Impairment of hippocampal long-term depression and defective spatial learning and memory in p35 mice. J. Neurochem 94, 917–925.[CrossRef][Medline]
Ohshima, T., Ward, J. M., Huh, C. G., Longenecker, G., Veeranna, Pant, H. C., Brady, R. O., Martin, L. J., and Kulkarni, A. B. (1996). Targeted disruption of the cyclin-dependent kinase 5 gene results in abnormal corticogenesis, neuronal pathology and perinatal death. Proc. Natl. Acad. Sci. USA 93, 11173–11178.
