QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 18, Issue 11, 4292-4303, November 2007

This Article Abstract Full Text (PDF) Supplemental Materials All Versions of this Article: E06-10-0889v1 18/11/4292    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yoshikawa, H. Articles by Harris, C. C. Search for Related Content PubMed PubMed Citation Articles by Yoshikawa, H. Articles by Harris, C. C.

WNT10B Functional Dualism: -Catenin/Tcf-dependent Growth Promotion or Independent Suppression with Deregulated Expression in Cancer

Hirohide Yoshikawa^*, Kenichi Matsubara, Xiaoling Zhou, Shu Okamura, Takahiko Kubo^*, Yaeko Murase^*, Yuko Shikauchi^*, Manel Esteller, James G. Herman, Xin Wei Wang, and Curtis C. Harris

*Department of Epigenetic Carcinogenesis, The Cancer Institute, Japanese Foundation for Cancer Research, Tokyo 135-8550, Japan; DNA Chip Research Inc., Kanagawa 230-0045, Japan; Laboratory of Human Carcinogenesis, National Cancer Institute, National Institutes of Health, Bethesda, MD 20896; and The Johns Hopkins University School of Medicine, The Oncology Center, Baltimore, MD 21231

Submitted October 4, 2006; Revised August 6, 2007; Accepted August 21, 2007
Monitoring Editor: John Cleveland

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
We found aberrant DNA methylation of the WNT10B promoter region in 46% of primary hepatocellular carcinoma (HCC) and 15% of colon cancer samples. Three of 10 HCC and one of two colon cancer cell lines demonstrated low or no expression, and 5-aza-2'deoxycytidine reactivated WNT10B expression with the induction of demethylation, indicating that WNT10B is silenced by DNA methylation in some cancers, whereas WNT10B expression is up-regulated in seven of the 10 HCC cell lines and a colon cancer cell line. These results indicate that WNT10B can be deregulated by either overexpression or silencing in cancer. We found that WNT10B up-regulated -catenin/Tcf activity. However, WNT10B-overexpressing cells demonstrated a reduced growth rate and anchorage-independent growth that is independent of the -catenin/Tcf activation, because mutant -catenin–transduced cells did not suppress growth, and dominant-negative hTcf-4 failed to alleviate the growth suppression by WNT10B. Although WNT10B expression alone inhibits cell growth, it acts synergistically with the fibroblast growth factor (FGF) to stimulate cell growth. WNT10B is bifunctional, one function of which is involved in -catenin/Tcf activation, and the other function is related to the down-regulation of cell growth through a different mechanism. We suggest that FGF switches WNT10B from a negative to a positive cell growth regulator.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The WNT10B gene is a member of the Wnt family (Lee et al., 1995), which are conserved among diverse species and play crucial roles in normal development and neoplastic transformation (Nusse and Varmus, 1992; Moon et al., 1997). Ectopic expression of Wnt1 induces embryonic axis duplication in Xenopus (McMahon and Moon, 1989), and it increases the number of mitogenic cells in the mouse spinal cord (Dickinson and McMahon, 1992). Wnt1 knockout mice show severe abnormalities in brain development (McMahon and Bradley, 1990; Thomas and Capecchi, 1990), whereas Wnt3a, Wnt4, and Wnt7a genes are required for somite and tailbud formation (Takada et al., 1994), renal development (Stark et al., 1994), and limb development (Parr and McMahon, 1995), respectively. Originally, Wnt1 was identified in mice as a proto-oncogene (Nusse and Varmus, 1982). Similarly, Wnt3 and Wnt10b are found in the mouse mammary tumor virus (MMTV) insertion sites where these genes are activated and cause mammary tumors (Roelink et al., 1990; Lee et al., 1995). The oncogenic activity of Wnt family genes also has been demonstrated in cultured cells. Wnt1, Wnt2, Wnt3, Wnt3a, Wnt5b, Wnt6, Wnt7a, and Wnt7b induce morphological transformation in mammary epithelial, fibroblast, and pheochromocytoma cell lines (Rijsewijk et al., 1987; Bradley et al., 1993; Ramakrishna and Brown, 1993; Shackleford et al., 1993; Bradbury et al., 1994; Shimizu et al., 1997). These reports indicate that unscheduled expression of Wnt family genes is a significant event in oncogenesis. The expression of Wnt family genes is tightly regulated during normal mouse development (Buhler et al., 1993; Weber-Hall et al., 1994; Veltmaat et al., 2004). In mammary glands, Wnt family genes are expressed in the embryonic stage, but they are not expressed in lactating mice (Gavin and McMahon, 1992). Wnt1 expression is found only in the testes of adult mice (Shackleford and Varmus, 1987). The abnormal expression of Wnt family genes has been reported in various types of cancer. Elevated expression levels of human WNT2, WNT5A, WNT7B, and WNT10B genes have been detected in proliferative lesions of human breast tissues (Huguet et al., 1994; Lejeune et al., 1995; Bui et al., 1997). The WNT2 gene is overexpressed in human colorectal carcinoma (Vider et al., 1996). WNT5A is up-regulated in lung, colon, and prostate cancers, as well as melanomas (Iozzo et al., 1995).

The prevalence of Wnt family activation in cancer has warranted functional analysis for a better understanding of the molecular interactions. Wnt family proteins are secreted glycoproteins that bind to the cell surface and extracellular matrix (Papkoff et al., 1987; Bradley and Brown, 1990; Papkoff and Schryver, 1990), and they are thought to activate the Frizzled family of membrane receptors (Bhanot et al., 1996). The activation suppresses the activity of the glycogen synthetase kinase 3 (GSK3) homologue, zw3 (Cook et al., 1996). In turn, the catenin homologue, armadillo, is hypophosphorylated and accumulates in the cell (Peifer et al., 1994). Stabilized -catenin binds to the Tcf family of transcription factors to increase the expression of multiple genes (van de Wetering et al., 1997). The protein level of -catenin is regulated by several proteins. In mammals, -catenin forms complexes with GSK3, adenomatosis polyposis coli (APC), Axin, and Tcf (Willert and Nusse, 1998; Polakis, 2000). GSK3, a Ser/Thr protein kinase, phosphorylates the amino terminus of -catenin, and it induces the degradation of -catenin by the ubiquitin-proteasome pathway (Aberle et al., 1997). APC is a major gene that is responsible for hereditary and sporadic colorectal carcinoma (Kinzler and Vogelstein, 1996), and APC inactivation leads to -catenin stabilization (Korinek et al., 1997; Morin et al., 1997). -Catenin mutations in GSK3 phosphorylation sites are found not only in colorectal carcinoma without APC mutations (Korinek et al., 1997; Morin et al., 1997), but also in melanoma (Rubinfeld et al., 1997), medulloblastoma (Zurawel et al., 1998), ovarian carcinoma (Palacios and Gamallo, 1998), endometrial carcinoma (Fukuchi et al., 1998), hepatocellular carcinoma (HCC) (de La Coste et al., 1998; Miyoshi et al., 1998), hepatoblastoma (Koch et al., 1999), prostatic carcinoma (Voeller et al., 1998), and skin cancer (Chan et al., 1999). Axin promotes GSK3-dependent phosphorylation of -catenin through an interaction with the complex involving -catenin, APC, and GSK3, resulting in the degradation of -catenin (Hart et al., 1998; Ikeda et al., 1998). Axin mutations can be found in 9% of HCC (Satoh et al., 2000). Activated -catenin associates with hTcf-4, a member of Tcf transcription factor. Subsequently, the complex translocates into the nucleus (Behrens et al., 1996; Korinek et al., 1997) and transactivates target genes such as c-myc (He et al., 1998), cyclin D1 (Tetsu and McCormick, 1999), cyclooxygenase-2 (COX-2) (Araki et al., 2003), and NOS2 (Du et al., 2006). These reports indicate that the -catenin/Tcf pathway, which is downstream of the Wnt family gene, plays a crucial role in oncogenesis. Several of the Wnt family genes are known to regulate -catenin. Wnt1 overexpression increases the steady-state levels of -catenin in mouse mammary epithelial and mouse pituitary cell lines (Papkoff et al., 1996). Wnt1, Wnt2, Wnt3, and Wnt3a are able to transform a mouse mammary epithelial cell line, demonstrating the accumulation of cytosolic -catenin (Shimizu et al., 1997). In a reporter assay, Wnt1 activates transcription from a promoter containing Tcf-binding elements (Young et al., 1998). Together, the overexpression of Wnt family members is common in diverse types of cancer, and the oncogenic function of the Wnt family depends on the activation of -catenin.

Int-2 transgenic mice produce mammary tumors in a focal manner. When the int-2 transgenic mice are further infected with MMTV, multiple tumors develop in a mammary gland. Twenty-three percent (5 of 35) of the tumors have a MMTV-insertion at the Wnt1 locus, and 6% (2 of 35 tumors) have it at the Wnt10b locus (Lee et al., 1995). Similarly, Wnt10b transgenic mice produced mammary tumors in a solitary manner (Lane and Leder, 1997). These observations suggest that Wnt10b takes part in the development of mouse mammary tumors and that it requires other collaborating genes to develop cancer. WNT10B is also overexpressed in human primary breast carcinomas, breast carcinoma cell lines, and neuroblastoma cell lines (Bui et al., 1997; Yuza et al., 2003). However, the precise roles of WNT10B in both development and oncogenesis are not well understood. Wnt10b is expressed in mouse embryonic yolk sac, fetal liver, and hematopoietic stem cells, suggesting that Wnt10b functions in hematopoiesis. Both mouse and human WNT10B induce the proliferation of hematopoietic stem cells as well as granulocyte macrophage progenitor cells (Austin et al., 1997; Van Den Berg et al., 1998), whereas WNT10B can suppress the proliferation of human erythroid progenitor cells (Van Den Berg et al., 1998). This growth-suppressive effect is functionally dominant in that WNT10B overrides the growth stimulation by WNT2B and WNT5A (Van Den Berg et al., 1998). WNT10B is also involved in adipogenesis by maintaining the preadipocyte in an undifferentiated state (Bennett et al., 2003; Ross et al., 2000). These imply that WNT10B has multiple functions, which are dependent on the cellular and microenvironmental context.

Recently, we have identified a candidate tumor suppressor, SOCS-1, in the structural and functional analyses of a gene identified by restriction landmark genomic scanning analysis (RLGS) (Yoshikawa et al., 2001). Another aberrant NotI restriction DNA fragment that reduced the intensity in HCC samples compared with the normal counterparts has been found in the RLGS analysis (Nagai et al., 1994). This DNA contained a part of the human WNT10B gene, and it was mapped to chromosome 12q13 (Yoshikawa et al., 1997), where WNT10B is localized (Bui et al., 1997). Because WNT10B has been minimally studied in human cancer, we analyzed promoter DNA methylation, expression, and functions with respect to tumor development.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell Culture and Tissues
Cancer cell lines, SNU-182, SNU-387, SNU-398, SNU-423, SNU-449, SNU-475, PLC/PRF/5, H460, H209, H1155, SW480, RKO, and Raji were obtained from the American Type Culture Collection (Manassas, VA). HuH-1, HuH-4, and HuH-7 were from the Japanese Culture Collection (RIKEN BioResource Center, Saitama, Japan). These were grown in either DMEM or RPMI 1640 medium, supplemented with 10% fetal bovine serum. Normal DNA and RNA samples (liver, colon, and placenta) were purchased from Biochain Institute (Hayward, CA) and BD Biosciences (Palo Alto, CA). Primary HCC samples are as described previously (Yoshikawa et al., 2001; Ye et al., 2003). Colon cancer samples were a kind gift from Dr. Bert Vogelstein (Johns Hopkins University).

Methylation-specific Polymerase Chain Reaction (MSP) Analysis
Genomic DNA was extracted using a standard method, and bisulfite modification of genomic DNA was performed as described previously (Herman et al., 1996). The bisulfite-treated DNA was amplified either with a methylation-specific or unmethylation-specific primer set at 35 cycles at 95°C for 40 s, 58°C for 40 s, and 72°C for 40 s. The methylation-specific primer sequences for WNT10B were forward, AAAGTTAGAGTTTTTAGTTTTTTGTTCGTC and reverse, CTTCCCCAACGCCGCCG. These primers were designed from nucleotide (nt) 69 through nt 98 for the forward primer and from nt 174 through nt 158 for the reverse primer in U81787. [GenBank] The unmethylation-specific primer sequences for WNT10B were forward, GAGTAAAGTTAGAGTTTTTAGTTTTTTGTTTGTT, and reverse, TCACCACTTCCCCAACACCACCA. These primers were from nt 65 through nt 98 for the forward primer and from nt 180 through nt 158 for the reverse primer in U81787 [GenBank] .

Bisulfite Sequencing Analysis
WNT10B noncoding exon1 was amplified from the bisulfite-treated DNA by using a primer set (GGTAGGGTGGGGAAGCCCCAGG and TGCTTTCCCAGGTCTAATTACCTCCAG). The polymerase chain reaction (PCR) products were cloned, and 10 randomly selected clones for each sample were sequenced.

RNA Isolation and Reverse Transcription (RT)-PCR
Total cellular RNA, which was prepared using RNeasy Mini kit (QIAGEN, Valencia, CA), was treated with RNase-free DNase (RQ1; Promega, Madison, WI) to eliminate contaminated DNA. cDNA was synthesized using a Superscript preamplification system (Invitrogen, Carlsbad, CA) from 3 µg of total RNA. Semiquantitative PCR for WNT10B was performed using 2 µl of cDNA, 2 µM of each primer (TGGAAGAATGCGGCTCTGA and CTCTCCAAAGTCCATGTCATGG), 1.5 mM MgCl₂, 800 µM dNTP mix, and 2.5 U of AmpliTaq DNA polymerase (Roche Molecular Systems, Branchburg, NJ) in a buffer supplied by the company. The condition was 35 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 2 min. An exponential amplification had been confirmed up to 38 cycles of the amplification (data not shown). A primer set for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA) was purchased from BD Biosciences. Semiquantitative PCR was performed as described in WNT10B amplification except that 1 µl of cDNA was used, and 30 cycles. An exponential amplification had been confirmed up to 34 cycles of the amplification (data not shown). For a reactivation study, the cells were treated with 5-aza-2'deoxycytidine (5Aza-dC) and trichostatin A (TSA) as described previously (Cameron et al., 1999). Then, RT-PCR was performed as described above. Real-time PCR was performed with Taqman gene expression assay for FGF-2 and GAPDH (Applied Biosystems, Foster City, CA) and an ABI PRISM 7000 sequence detection system (Applied Biosystems), by using the relative standard curve method. Values were normalized to the relative amounts of GAPDH.

Plasmids
Mutant K-ras plasmid (pCGN K-ras 12V) was a kind gift from Dr. Channing Der (University of North Carolina). -Catenin/Tcf luciferase reporter plasmids (pGL3/OT and pGL3/OF), S 33 Y mutant -Catenin construct (pCI-NEO--CATENINXL), and the dominant-negative hTcf-4 plasmid (pcDNA/Myc-hTcf-4) were from Dr. Bert Vogelstein. To construct the hygromycin-resistant vector carrying the dominant-negative hTcf-4 gene, we transferred the N-terminal–deleted Tcf-4 gene from pcDNA/Myc-hTcf-4 into pcDNA3.1/Hygro (Invitrogen). Full-length WNT10B cDNA was amplified from human placenta RNA by using a primer set (TGGAAGAATGCGGCTCTGAC and AGAGTGACCTTGGAAGGAAATC). The PCR product was cloned into the pT7blueT vector (Novagen, Darmstadt, Germany). The recombinant DNA was propagated in Epicurian coli SCS110 (Stratagene, La Jolla, CA) to avoid Dam methylation. The full-length WNT10B was cut out from the recombinant with XbaI and ClaI, and it was blunted with Klenow enzyme and then ligated into EcoRV-digested pcDNA3.1/HisC (Invitrogen). A clone, pcDNA-WNT10B, showed an in-frame ligation, sense orientation, and correct sequence to human WNT10B gene sequences of U81787 [GenBank] or X97057 [GenBank] (GenBank). The WNT10B insert in pT7blueT was also cloned into a pCR3.1 vector (Invitrogen) by double digestion with EcoRI plus XbaI to generate another expression vector, pCR-WNT10B.

-Catenin/Tcf Reporter Analysis
The -catenin/Tcf luciferase reporter plasmid pGL3/OT contains a multiple -catenin/Tcf motif, but pGL3/OF contains a multiple-mutated motif. To measure the activation of the -catenin/Tcf reporter by exogenously expressed genes, cells (30 x 10⁴) were plated and grown overnight in each well of six-well plates. Each 1 µg of the reporter plasmid and an expression plasmid were transfected into the cells by using a Lipofectamine plus reagent (Invitrogen) according to the company's protocol. At 48 h after transfection, luciferase activity was measured using a reporter assay system (Promega). The luminescence was normalized to the relative protein concentration. To measure the steady-state level of reporter activities, cells (30 x 10⁴) were plated and grown overnight in each well of six-well plates. One microgram of pGL3/OT with 1 ng of the reference plasmid, pRL-CMV (Promega), was transfected into these cells, and at 48 h posttransfection, luciferase activities were measured using the Dual-Luciferase Reporter Assay system (Promega). The values of the -catenin/Tcf reporter were normalized to those of the reference reporter.

RNA Interference
The target sequences used for WNT10B silencing were AAGGGUGGGAAGGGAUAAU (small interfering [si]RNA1), AAGCGCGGUUUCCGUGUUU (siRNA2), and GAAUGCGAAUCCACAACAA (siRNA3). Cells (20 x 10⁴ in 60-mm dish) were transfected with WNT10B-specific siRNA or control siRNA (QIAGEN) at a concentration of 250 nM by using oligofectamine (Invitrogen). At 48 h posttransfection, cells were lysed, harvested, or incubated with 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)- 2H-tetrazolium, inner salt (MTS) reagent.

Establishment of Stably Transfected HuH-7 Clones
HuH-7 cells (30 x 10⁴) were transfected with either the WNT10B expression or the backbone vector by using Lipofectamine Plus reagent (Invitrogen), and they were selected with 500 µg/ml Geneticin (G-418; Invitrogen) for 4 wk. Because the pcDNA3-WNT10B generated WNT10B protein more efficiently than the pCR-WNT10B in an in vitro transcription-coupled translation experiment (data not shown), we established WNT10B-overexpressing clones with the pcDNA-WNT10B. Drug-resistant colonies were isolated, and expanded. A mutant -catenin–overexpressing HuH-7 clone also was generated using the S33Y mutant -Catenin expression vector.

Western Blot Analysis
At 70% confluence, cells were lysed on ice in lysis buffer composed of 20 mM Tris, pH 8.0, 1% Nonidet P-40, 0.1% SDS, 150 mM NaCl, 50 mM NaF, 1 mM Na₃VO₄, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 1 µg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride. After 10-min incubation on ice, the cells were scraped into microfuge tubes and centrifuged at 15,000 x g for 30 min. Supernatants (30 µg) were boiled for 5 min in SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer, resolved by SDS-PAGE, and then electroblotted onto a nitrocellulose membrane. The blot was blocked with 5% skim milk in phosphate-buffered saline (PBS) for 1 h at room temperature (RT), and then it was incubated with an antibody for 1 h at RT. Anti-Wnt10B antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was used at a 1:1000 dilution, anti-actin antibody (Roche Diagnostics, Indianapolis, IN) was used at a 1:400 dilution, anti-cyclin D1 antibody (Upstate Biotechnology, Lake Placid, NY) was used at a 1:500 dilution, and anti-c-Myc antibody and anti-caspase-3 antibody (Santa Cruz Biotechnology) were used at a 1:250 dilution. After several washes, a 1:5000 dilution of the appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) was added for 1 h at RT. After several washes, the blot was incubated with an enhanced chemiluminescent substrate and exposed to Hyperfilm (GE Healthcare, Arlington Heights, IL). To detect COX-2 protein, cells were transfected with mutant K-ras vector, and the lysate was analyzed as described previously (Araki et al., 2003).

Flow Cytometry
Transfected cells were pelleted and washed with PBS. Ice-cold 80% ethanol was then added dropwise over the pellets with periodic vortexing to mix cells. After fixation, propidium iodide was added to 50 µg/ml in PBS. The samples were then analyzed by flow cytometry.

Cell Proliferation Assay
Stably transfected HuH-7 cells (1 x 10³) were plated in 96-well plates. At 24 and 48 h postplating, Cell Titer 96 Aqueous One Solution Reagent (Promega) was added into each well. After 4-h incubation, absorbance at 490 nm was recorded. The confluence was <70% under phase-contrast microscopy at 48 h postplating. For siRNA-treated cells, 100 µl of the reagent was added to the medium (2 ml) at 48 h posttransfection. To examine the effects of fibroblast growth factor (FGF)-2 and FGF-7 on WNT10B-overexpressing clones, stably transfected HuH-7 clones (1 x 10³ cells) were seeded in six-well plates. Cells were incubated with or without 5 ng/ml FGF-2 or FGF-7 (Chemicon International, Temecula, CA) for 2 wk. The medium was replaced every 4 d. Colony numbers were counted at 14 d postincubation.

Soft Agar Colony Formation Assay
Stably transfected HuH-7 cells (1 x 10⁴) were suspended in RPMI 1640 medium containing 0.35% agar and 10% fetal bovine serum, and they were layered on 0.5% agar-containing RPMI 1640 medium and 10% fetal bovine serum in 100-mm tissue culture dishes. An additional 0.35% agar culture medium was overlayered every 5 d. The culture media were supplemented with 500 µg/ml G-418. Colony formation was assessed at 21 d postincubation. To inactivate the -Catenin/Tcf complex, WNT10B-overexpressing cells (10 x 10⁴) were transfected either with 1 µg of dominant-negative hTcf4 plasmid or the backbone pcDNA3.1/Hygro plasmid (Invitrogen) with Lipofectamine Plus reagent (Invitrogen). Cells were selected with 50 µg/ml hygromycin (Invitrogen) for 3 wk in the 0.35% agarose containing RPMI 1640 medium and 10% fetal bovine serum.

Tumorigenicity in Athymic Nude Mice
Cells (1.25 x 10⁶) of stably transfected HuH-7 clones were injected subcutaneously into each of the 10 athymic nu/nu female mice. Tumors were monitored weekly after 2 mo postinoculation, and they were examined pathologically, when the mice died.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Methylation and Expression Analysis of the WNT10B Gene in Cancer
We analyzed the DNA methylation status of the WNT10B gene by using MSP in primary human HCC and colon cancer samples, because we identified WNT10B by the RLGS analysis, in which the related NotI site was found aberrant in primary cancer compared with nontumorous samples. We designed MSP primers in noncoding exon1 where CpG density is relatively high and the NotI site is located (Figure 1A). Eleven of 24 (46%) HCC samples (Figure 1B) and seven of 46 (15%) colon cancer samples were methylated (Figure 1C). In contrast, no methylation was found in normal samples (Figure 1D). We further examined DNA methylation of WNT10B in cancer cell lines, including lung cancer, colon cancer, leukemia, and HCC. RKO and Raji cells were methylated (Figure 1E), whereas 10 HCC cell lines did not show any methylation in the region that we analyzed by MSP (data not shown). Bisulfite sequencing analysis demonstrated that RKO was densely methylated and 40% of Raji DNA was methylated in the noncoding exon1 (Figure 1F). We next examined WNT10B steady-state levels in 10 HCC, one leukemia and two colon cancer cell lines by RT-PCR. Seven of the 10 HCC and one of the two colon cancer cell lines expressed abundant WNT10B RNA; however, HuH-7, SNU-182, SNU-387, Raji, and RKO showed no detectable or minimal expression (Figure 1G). The WNT10B expression seemed a specific event to cancer, because normal liver and colon samples did not show detectable expression of WNT10B. Despite the up-regulation of WNT10B expression in SW480 and the seven HCC cell lines, we observed aberrant DNA methylation in RKO and Raji cell lines as well as primary HCC and primary colon cancer samples. This finding lead us to determine whether DNA methylation of WNT10B was associated with its faint or lack of expression, which was observed in HuH-7, SNU-182, SNU-387, Raji, and RKO. We treated HuH-7 and RKO cells with a demethylating agent, 5Aza-dC, and we found the up-regulation of WNT10B expression. The combination treatment with 5Aza-dC and a histone deacethylase inhibitor, TSA, resulted in a more robust effect, as was shown in methylation-silenced genes (Figure 1H). We further examined 5Aza-dC–treated cells to confirm WNT10B reactivation by demethylation. MSP analysis revealed that unmethylated WNT10B DNA appeared in 5Aza-dC-treated cells, whereas that was not detectable in untreated cells (Figure 1I). This result was consistent with the reactivation of WNT10B expression in 5Aza-dC–treated cells. Interestingly, the addition of 1 mM TSA did not increase demethylated WNT10B compared with 5Aza-dC treatment alone. We next examined DNA methylation and expression of WNT10B in primary HCC samples. We analyzed 10 primary HCC by using matched (DNA/RNA) samples. Three HCC samples (3, 4, and 6) were methylated in which WNT10B expression was not detectable, whereas four (1, 7, 9, and 10) of seven unmethylated samples expressed WNT10B. Three nontumorous liver samples (11, 12, and 13) showed neither methylation nor expression (Figure 1J). These results support WNT10B can be silenced by DNA methylation.

View larger version (52K): [in this window] [in a new window]   Figure 1. Aberrant methylation and expression of WNT10B in HCC. (A) Schematic representation of WNT10B promoter region. Arrowheads and arrows indicate positions of MSP and bisulfite sequencing primers, respectively. ATG represents the translation start site. CpG sequences are shown as vertical bars. (B) MSP analysis of WNT10B in primary HCC. Twenty-four HCC samples were analyzed. Visible bands in U lanes are unmethylated 106-base pair DNA products with unmethylation-specific primers, and those in M lanes are methylated 116-base pair DNA products with methylation-specific primers. (C) MSP analysis of WNT10B in primary colon cancer samples. Representative 18 of 46 samples were presented. The incomplete methylation can be explained by possible contamination of nontumorous cells in the tumor specimens, or by the heterogeneity in the methylation status in the tumor. (D) MSP analysis of six normal samples (1, 2, and 3 are normal liver samples and 4, 5, and 6 are normal colon samples). (E) MSP analysis of cancer cell lines. Three lung cancer (H460, H209, and H1155), two colon cancer (SW480 and RKO), and one leukemia (Raji) cell lines were analyzed. (F) Bisulfite sequencing analysis. Four cancer cell lines (RKO, Raji, HuH-7, and SW480) and two normal samples (liver and colon) were analyzed in the WNT10B noncoding exon1. and represent methylation and unmethylation, respectively. Ten individual clones were sequenced for each sample. (G) RT-PCR analysis of WNT10B. One leukemia (Raji), two colon cancer (SW480 and RKO), 10 HCC cell lines (HuH-1, HuH-4, HuH-7, SNU-182, SNU-387, SNU-398, SNU-423, SNU-449, SNU-475, and PLC/PRF/5), and two normal samples were analyzed with WNT10B primers or GAPDH primers within cycles showing exponential amplification. Visible bands are 788- and 452-base pair DNA products in WNT10B and GAPDH amplification, respectively. (H) WNT10B reactivation by 5Aza-dC and TSA in HuH-7 and RKO. Cells were treated with 5Aza-dC for 3 d with or without TSA for the last 12 h and WNT10B expression was analyzed by RT-PCR. (I) Demethylation of WNT10B by 5Aza-dC. RKO cells were treated with 5Aza-dC for 3 d with or without TSA for the last 12 h. Demethylation was assessed by MSP. (J) Methylation and expression analysis in matched (DNA/RNA) primary HCC samples. Ten HCC and three nontumorous liver samples were analyzed by MSP (left) and RT-PCR (right). Numbers 1 through 10 are primary HCC samples, and 11 through 13 are nontumorous liver samples.

Regulation of the -Catenin/Tcf Complex by WNT10B in HCC

View larger version (24K): [in this window] [in a new window]   Figure 2. -Catenin/Tcf reporter activity in HuH-4 and HuH-7 cell lines. (A) The -catenin/Tcf reporter activity was measured by transient transfections with a -catenin/Tcf reporter plasmid, pGL3/OT, and a reference plasmid, pRL-CMV, into a WNT10B high-producer cell line, HuH-4, and a low-producer cell line, HuH-7. The values of the -catenin/Tcf reporter activity are normalized to those of the reference reporter, and they are the means of three replicates. Error bars represent standard deviations. The difference between HuH-4 and HuH-7 is statistically significant (p < 0.05). (B) The WNT10B low-producer cell line, HuH-7, was transiently transfected with the indicated vectors. WNT10B is the pcDNA-WNT10B expression construct. pGL3/OT and pGL3/OF contain true and mutated -catenin/Tcf binding motifs, respectively. Luminescence was normalized to the respective protein concentration, and data are the mean of three replicates. Error bars represent standard deviations. The difference between the WNT10B and the vector control is statistically significant (p < 0.05). Another WNT10B expression plasmid, pCR-WNT10B, which was constructed in a pCR3.1 vector, also showed a similar result (data not shown). (C) WNT10B stably overexpressing clones or the vector control was generated by transfections into HuH-7 cells with the pcDNA-WNT10B or the backbone plasmid, respectively. Thirty micrograms of protein were analyzed by SDS-PAGE and followed by immunoblotting with the anti-Wnt10B antibody or anti-actin antibody. (D) The -catenin/Tcf reporter activity was measured by cotransfections with pGL3/OT and pRL-CMV into the WNT10B clones, mutant -catenin clone, or vector control clone. The mutant -catenin–overexpressing clone was established by selecting a single colony of HuH-7 cells transfected with the S33Ymutant -Catenin construct. The values of -catenin/Tcf reporter activities are normalized to those of the reference reporter, and they are the means of three replicates. Error bars represent standard deviations. The differences in the activity among clones were all statistically significant (p < 0.05). (E) Western blot analysis of the downstream genes. Thirty micrograms of protein from the WNT10B stably overexpressing clones, mutant -catenin clone, and vector control clone were analyzed by SDS-PAGE, followed by immunoblotting either with anti-cyclin D1, anti-c-Myc, or anti-actin antibody. For the COX-2 analysis, these stable clones were transfected with the mutant K-ras plasmid, and the protein was analyzed with the anti-COX-2 antibody. The intensities of cyclin D1, c-MYC, and COX-2 were normalized to those of actin, and the ratios against normalized intensities of the vector control were calculated. In cyclin D1, the WNT10B clone R8 was 1.2-fold, WNT10B clone R9 was 2.0-fold, and mutant -catenin was 4.3-fold increased in intensity compared with the vector control. In the c-MYC, the WNT10B clone R8 was 1.2-fold, WNT10B clone R9 was 1.3-fold, and mutant -catenin was 1.5-fold increased in intensity compared with the vector control. In the COX-2, the WNT10B clone R8 was 1.3-fold, WNT10B clone R9 was 1.8-fold, and mutant -catenin was 2.1-fold increased in intensity compared with the vector control.

WNT10B Inhibits Cell Growth through a -Catenin–independent Mechanism

View larger version (36K): [in this window] [in a new window]   Figure 3. Induction of growth suppression by WNT10B. (A) MTS assay. Growth rates were calculated by the increase of absorbance between 24 and 48 h after plating. Vector control is a stable transfectant with an empty vector. The WNT10B clones R9 and R8 produce high and intermediate levels of WNT10B protein, respectively. Mutant -catenin is the S33Y mutant -catenin–overexpressing clone. The values are the means of three replicates. Error bars represent standard deviations. The differences between clone R9 and the vector control clone, and between clone R8 and the vector control clone, were statistically significant (p < 0.05). The difference between the vector control and the mutant -catenin clones was not significant. The difference between clones R8 and R9 was not significant. (B) Soft agar cloning efficiency. Cells (vector control, mutant -catenin, WNT10B-overexpressing clones R8 and R9) were grown in soft agar with G-418, and colony numbers were counted at 4 wk after seeding. The WNT10B-overexpressing clone R9 was either transfected with the dominant-negative hTcf-4 expression construct (clone R9 DN Tcf-4) or backbone hygromycin-resistant plasmid (clone R9 hygro control), and then it was grown in soft agar with hygromycin. Hygromycin-resistant colonies were counted at 4 wk after seeding. The values are relative colony numbers to vector control (100%). The values are the means of three replicates. Error bars represent standard deviations. The difference between the WNT10B clones (R8 and R9) was statistically significant (p < 0.05). The differences between the mutant -catenin clone and WNT10B clones (R8 and R9) were also statistically significant (p < 0.05), but the difference between the vector control and mutant -catenin was not significant. The difference between clone R9 DN Tcf-4 and clone R9 hygro control was not significant. (C) WNT10B-mediated apoptosis. WNT10B was transiently transfected in HuH-7 and RKO cells. Cell lysates were analyzed by Western blotting using anti-caspase-3 and actin antibodies. Cleaved caspase-3 (20 kDa) was detected by anti-caspase-3 immunoblotting (left). Transfected cells were analyzed by fluorescence-activated cell sorting analysis. The sub-G1 populations increased in WNT10B-transfected HuH-7 cells (16.35%) compared with the control vector-transfected cells (8.72%) and in WNT10B-transfected RKO cells (8.57%) compared with the control vector transfected cells (1.93%) (right). (D) Microscopic observation of stably transfected clones. WNT10B (R8 and R9), mutant -catenin, vector control, and parental HuH-7 cells were viewed by phase-contrast microscopy.

View larger version (25K): [in this window] [in a new window]   Figure 4. Effects of WNT10B inhibition by siRNA. (A) Knocking WNT10B down by the specific siRNA. WNT10B-expressing cells were transfected with WNT10B-specific siRNAs. WNT10B expression was analyzed by RT-PCR (top) and immunoblotting (bottom). (B) Down-regulation of Cyclin D1, c-MYC, and -catenin in WNT10B knockdown cells. siRNA-transfected HuH-4 and SW480 cells were lysed and immunoblotted by indicated antibodies. (C) Down-regulation of cell growth by WNT10B inhibition. HuH-4 and SW480 cells were transfected with WNT10B-specific or control siRNA. Cell growth was assessed by MTS assay at 48 h posttransfection.

View larger version (17K): [in this window] [in a new window]   Figure 5. Synergy of WNT10B and FGF. (A) Effects of FGF family proteins on the WNT10B-overexpressing clones. Stably transfected HuH-7 clones were incubated with or without 5 ng/ml FGF-2 or FGF-7 for 2 wk, and then the colony numbers were counted. Black and white bars indicate -fold increases by FGF-2 and FGF-7, respectively. The values shown are the means of three replicates. Error bars represent standard deviations. The differences between WNT10B-overexpressing clones and the other clones were statistically significant (p < 0.05). The difference between clones R9 and R8 was also significant (p < 0.05), but the difference between the vector control and mutant -catenin was not (top). WNT10B expression was analyzed by immunoblotting using FGF-2– or FGF-7–treated R8 and R9 cells (bottom). (B) WNT10B expression in primary HCC samples. Using RT-PCR as in Figure 1E, WNT10B and GAPDH expressions were analyzed in 22 primary HCC samples for which metastatic status and expression status of osteopontin were reported (Ye et al., 2003).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The seemingly paradoxical finding of the WNT10B activation and inactivation in cancer lead us to further investigate its biological activity. Activating mutations of -Catenin were reported in various cancers, including HCC. However, we did not find any -Catenin or Axin mutations in the 10 HCC cell lines examined. Therefore, we determined whether WNT10B transduced the -catenin/Tcf pathway in those HCC cell lines. We compared the -catenin/Tcf reporter activity by using endogenous -catenin and hTcf-4 between WNT10B high-producer and low-producer cell lines. The higher activity in the WNT10B high-producer suggested that WNT10B transduced the -catenin/Tcf pathway. In addition, the reporter activity was enhanced by exogenously expressed WNT10B. Thus, we constructed stably transfected HuH-7 cells to investigate the function of WNT10B in more detail. We detected the elevation of the -catenin/Tcf reporter activity in WNT10B stably overexpressing clones as in the mutant -catenin clone. Furthermore, -catenin/Tcf target genes, cyclin D1, c-MYC, and COX-2 (He et al., 1998; Tetsu and McCormick, 1999; Araki et al., 2003), were transactivated by WNT10B. Significantly, the WNT10B expression level was correlated with the level of -catenin/Tcf activity. Consistent with WNT10B overexpression, inhibition of WNT10B by siRNA down-regulated cyclin D1 and c-MYC. Based on these results, we concluded that WNT10B is able to regulate the oncogenic -catenin/Tcf pathway.

Wnt family members can promote the growth of rodent cells. Wnt1-, Wnt6-, or Wnt7b-transduced cells grew in a higher density (Bradbury et al., 1994). Wnt1 induced serum-independent cellular proliferation (Young et al., 1998) and enhanced tumorigenicity in nude mice (Rijsewijk et al., 1987) and soft agar cloning efficiency by stimulating the -catenin/Tcf pathway (Bafico et al., 1998). Furthermore, as the downstream key factor of Wnt1, -catenin also induced cellular transformation and enhanced the soft agar cloning efficiency (Orford et al., 1999). These reports raise a possibility that WNT10B is an oncogenic protein involved in the -catenin/Tcf pathway. Therefore, we studied whether WNT10B up-regulated cell growth in vitro and in vivo by using WNT10B-overexpressing HuH-7 clones. Surprisingly, WNT10B-overexpressing clones suppressed cell growth, including the growth rate in a monolayer culture, soft agar cloning efficiency, and tumorigenicity in nude mice, except that the WNT10B intermediate clone increased the incidence of tumors in nude mice. In addition, growth suppression in the soft agar cloning efficiency was directly correlated with the amount of WNT10B expression. A same tendency was observed in the growth rate in a monolayer culture, although it was not statistically significant. A reported growth suppression by WNT10B in erythroid progenitor cells is consistent with our findings (Van Den Berg et al., 1998). The up-regulation of c-MYC–induced apoptosis under certain conditions (Prendergast, 1999) lead us to investigate whether growth suppression by WNT10B is caused by increased c-MYC. However, the mutant -catenin clone, which activated c-MYC greater than the WNT10B clones, maintained the growth rate and soft agar cloning efficiency, and it increased tumorigenicity in nude mice. Dominant-negative hTcf-4, which can abrogate the transcriptional activity of the -catenin/Tcf complex, failed to recover growth of the WNT10B-overexpressing clone. Therefore, c-MYC activation is not likely the cause of growth suppression by WNT10B. These findings indicate that WNT10B is involved in a growth suppression pathway independently of -catenin/Tcf. Apoptosis may be one of the factors that induces WNT10B-mediated growth suppression, because we found the activation of caspase-3 in WNT10B transiently overexpressed cells. It seems that the balance between the up-regulating and down-regulating functions of WNT10B decide the outcome of cancer cell growth. This hypothesis might explain why the WNT10B intermediate producer showed a reduced growth rate and anchorage-independent growth, but increased tumorigenicity in nude mice. Given the growth suppression activity of WNT10B, we speculate that transcriptional silencing of WNT10B takes place to inhibit its growth suppression effect. Alternatively, the up-regulation of WNT10B is more favorable when its growth suppression activity is specifically alleviated. Wnt10b transgenic mice produce mammary solitary tumors (Lane and Leder, 1997), and transgenic mice with a member of the FGF family, int-2, produce multiple carcinomas only when MMTV activated Wnt1 or Wnt10b (Lee et al., 1995). These reports suggest that WNT10B activation is insufficient for malignant transformation. We postulated that WNT10B may cooperate with other growth factors in oncogenesis. Therefore, we incubated stable HuH-7 clones with two members of the FGF family proteins, and we found that FGF-2 or FGF-7 stimulated growth synergistically with WNT10B, but not with mutant -catenin. In addition, the inhibition of WNT10B reduced the growth of HuH-4 or SW480 cells in which FGF-2 (data not shown) or FGF-20 (Kirikoshi et al., 2000) was up-regulated, respectively. This suggests that WNT10B collaborates with FGF family proteins to promote oncogenesis. Expression analysis of WNT10B and FGF-2 in primary HCC samples demonstrated interesting data. Four of five metastatic samples with up-regulated WNT10B showed increased FGF-2 expression. Four of five WNT10B/FGF-2 double up-regulated samples were metastatic cases, and metastasis-related osteopontin was not activated in one exceptional case (S49) (Ye et al., 2003). The up-regulation of FGF family might promote the metastasis of tumor cells in WNT10B-expressing cancer cells. However, apparently WNT10B/FGF-2 double up-regulation is not sufficient for metastasis, because one double up-regulated case was nonmetastatic, and four cases with FGF-2 up-regulation alone were also nonmetastatic. Other metastasis-associated factors, including osteopontin, may also play a role in HCC (Ye et al., 2003).

In general, WNT family proteins are thought to act as ligands to frizzled receptors. WNT10B seems to function in an autocrine or paracrine manner. We propose that WNT10B has dual functions, one function of which promotes oncogenesis through the -catenin/Tcf pathway, and another function inhibits cell growth by a different mechanism. Our hypothesis is that autocrine or paracrine expression of FGF family proteins cooperates with WNT10B to switch its growth-suppressive effects to growth stimulatory. The release of growth regulatory factors, including FGF family members is an interesting mechanism in tumor growth and metastasis. Our current studies are identifying the mechanism of growth suppression by WNT10B.

	ACKNOWLEDGMENTS

 
We thank D. Dudek-Creaven for editorial assistance; A. Hancock, M. McMenamin, and E. Spillare for technical support; K. Nomura and T. Kitagawa for support and advice; and G. Trivers for help with the nude mice experiment. This work was supported by the Intramural Research Program of National Institutes of Health, National Cancer Institute, and Center for Cancer Research, NIH SPORE grant P50 CA58184 at The Johns Hopkins Oncology Center, and grant-in-aid for scientific research (S) from Japan Society for the Promotion of Science.

	Footnotes

 
This was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-10-0889) on August 29, 2007.

The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org).

Address correspondence to: Curtis C. Harris (curtis_harris{at}nih.gov)

Abbreviations used: 5Aza-dC, 5-aza-2'deoxycytidine; COX-2, cyclooxygenase-2; FGF, fibroblast growth factor; HCC, hepatocellular carcinoma; MMTV, mouse mammary tumor virus; MSP, methylation-specific polymerase chain reaction; TSA, trichostatin A.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Aberle, H., Bauer, A., Stappert, J., Kispert, A., and Kemler, R. (1997). beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J 16, 3797–3804.[CrossRef][Medline]

Araki, Y., Okamura, S., Hussain, S. P., Nagashima, M., He, P., Shiseki, M., Miura, K., and Harris, C. C. (2003). Regulation of cyclooxygenase-2 expression by the Wnt and ras pathways. Cancer Res 63, 728–734.[Abstract/Free Full Text]

Austin, T. W., Solar, G. P., Ziegler, F. C., Liem, L., and Matthews, W. (1997). A role for the Wnt gene family in hematopoiesis: expansion of multilineage progenitor cells. Blood 89, 3624–3635.[Abstract/Free Full Text]

Bafico, A., Gazit, A., Wu-Morgan, S. S., Yaniv, A., and Aaronson, S. A. (1998). Characterization of Wnt-1 and Wnt-2 induced growth alterations and signaling pathways in NIH3T3 fibroblasts. Oncogene 16, 2819–2825.[CrossRef][Medline]

Behrens, J., von Kries, J. P., Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl, R., and Birchmeier, W. (1996). Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 382, 638–642.[CrossRef][Medline]

Bennett, C. N., Hodge, C. L., MacDougald, O. A., and Schwartz, J. (2003). Role of Wnt10b and C/EBPalpha in spontaneous adipogenesis of 243 cells. Biochem. Biophys. Res. Commun 302, 12–16.[CrossRef][Medline]

Bhanot, P., Brink, M., Samos, C. H., Hsieh, J. C., Wang, Y., Macke, J. P., Andrew, D., Nathans, J., and Nusse, R. (1996). A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382, 225–230.[CrossRef][Medline]

Bradbury, J. M., Niemeyer, C. C., Dale, T. C., and Edwards, P. A. (1994). Alterations of the growth characteristics of the fibroblast cell line C3H 10T1/2 by members of the Wnt gene family. Oncogene 9, 2597–2603.[Medline]

Bradley, R. S., and Brown, A. M. (1990). The proto-oncogene int-1 encodes a secreted protein associated with the extracellular matrix. EMBO J 9, 1569–1575.[Medline]

Bradley, R. S., Cowin, P., and Brown, A. M. (1993). Expression of Wnt-1 in PC12 cells results in modulation of plakoglobin and E-cadherin and increased cellular adhesion. J. Cell Biol 123, 1857–1865.[Abstract/Free Full Text]

Buhler, T. A., Dale, T. C., Kieback, C., Humphreys, R. C., and Rosen, J. M. (1993). Localization and quantification of Wnt-2 gene expression in mouse mammary development. Dev. Biol 155, 87–96.[CrossRef][Medline]

Bui, T. D., Rankin, J., Smith, K., Huguet, E. L., Ruben, S., Strachan, T., Harris, A. L., and Lindsay, S. (1997). A novel human Wnt gene, WNT10B, maps to 12q13 and is expressed in human breast carcinomas. Oncogene 14, 1249–1253.[CrossRef][Medline]

Cameron, E. E., Bachman, K. E., Myohanen, S., Herman, J. G., and Baylin, S. B. (1999). Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat. Genet 21, 103–107.[CrossRef][Medline]

Chan, E. F., Gat, U., McNiff, J. M., and Fuchs, E. (1999). A common human skin tumour is caused by activating mutations in beta-catenin. Nat. Genet 21, 410–413.[CrossRef][Medline]

Cook, D., Fry, M. J., Hughes, K., Sumathipala, R., Woodgett, J. R., and Dale, T. C. (1996). Wingless inactivates glycogen synthase kinase-3 via an intracellular signalling pathway which involves a protein kinase C. EMBO J 15, 4526–4536.[Medline]

de La Coste, A., Romagnolo, B., Billuart, P., Renard, C. A., Buendia, M. A., Soubrane, O., Fabre, M., Chelly, J., Beldjord, C., Kahn, A., and Perret, C. (1998). Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc. Natl. Acad. Sci. USA 95, 8847–8851.[Abstract/Free Full Text]

Dickinson, M. E., and McMahon, A. P. (1992). The role of Wnt genes in vertebrate development. Curr. Opin. Genet. Dev 2, 562–566.[CrossRef][Medline]

Du, Q., Park, K. S., Guo, Z., He, P., Nagashima, M., Shao, L., Sahai, R., Geller, D. A., and Hussain, S. P. (2006). Regulation of human nitric oxide synthase 2 expression by Wnt beta-catenin signaling. Cancer Res 66, 7024–7031.[Abstract/Free Full Text]

Evan, G. I., Wyllie, A. H., Gilbert, C. S., Littlewood, T. D., Land, H., Brooks, M., Waters, C. M., Penn, L. Z., and Hancock, D. C. (1992). Induction of apoptosis in fibroblasts by c-myc protein. Cell 69, 119–128.[CrossRef][Medline]

Fukuchi, T., Sakamoto, M., Tsuda, H., Maruyama, K., Nozawa, S., and Hirohashi, S. (1998). Beta-catenin mutation in carcinoma of the uterine endometrium. Cancer Res 58, 3526–3528.[Abstract/Free Full Text]

Gavin, B. J., and McMahon, A. P. (1992). Differential regulation of the Wnt gene family during pregnancy and lactation suggests a role in postnatal development of the mammary gland. Mol. Cell. Biol 12, 2418–2423.[Abstract/Free Full Text]

Hart, M. J., de los Santos, R., Albert, I. N., Rubinfeld, B., and Polakis, P. (1998). Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr. Biol 8, 573–581.[CrossRef][Medline]

He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998). Identification of c-MYC as a target of the APC pathway. Science 281, 1509–1512.[Abstract/Free Full Text]

Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. (1996). Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA 93, 9821–9826.[Abstract/Free Full Text]

Huguet, E. L., McMahon, J. A., McMahon, A. P., Bicknell, R., and Harris, A. L. (1994). Differential expression of human Wnt genes 2, 3, 4, and 7B in human breast cell lines and normal and disease states of human breast tissue. Cancer Res 54, 2615–2621.[Abstract/Free Full Text]

Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S., and Kikuchi, A. (1998). Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J 17, 1371–1384.[CrossRef][Medline]

Iozzo, R. V., Eichstetter, I., and Danielson, K. G. (1995). Aberrant expression of the growth factor Wnt-5A in human malignancy. Cancer Res 55, 3495–3499.[Abstract/Free Full Text]

Kinzler, K. W., and Vogelstein, B. (1996). Lessons from hereditary colorectal cancer. Cell 87, 159–170.[CrossRef][Medline]

Kirikoshi, H., Sagara, N., Saitoh, T., Tanaka, K., Sekihara, H., Shiokawa, K., and Katoh, M. (2000). Molecular cloning and characterization of human FGF-20 on chromosome 8p21.3-p22. Biochem. Biophys. Res. Commun 274, 337–343.[CrossRef][Medline]

Koch, A., Denkhaus, D., Albrecht, S., Leuschner, I., von Schweinitz, D., and Pietsch, T. (1999). Childhood hepatoblastomas frequently carry a mutated degradation targeting box of the beta-catenin gene. Cancer Res 59, 269–273.[Abstract/Free Full Text]

Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Vogelstein, B., and Clevers, H. (1997). Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC–/– colon carcinoma. Science 275, 1784–1787.[Abstract/Free Full Text]

Lane, T. F., and Leder, P. (1997). Wnt-10b directs hypermorphic development and transformation in mammary glands of male and female mice. Oncogene 15, 2133–2144.[CrossRef][Medline]

Lee, F. S., Lane, T. F., Kuo, A., Shackleford, G. M., and Leder, P. (1995). Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc. Natl. Acad. Sci. USA 92, 2268–2272.[Abstract/Free Full Text]

Lejeune, S., Huguet, E. L., Hamby, A., Poulsom, R., and Harris, A. L. (1995). Wnt5a cloning, expression, and up-regulation in human primary breast cancers. Clin. Cancer Res 1, 215–222.[Abstract]

McMahon, A. P., and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62, 1073–1085.[CrossRef][Medline]

McMahon, A. P., and Moon, R. T. (1989). Ectopic expression of the proto-oncogene int-1 in Xenopus embryos leads to duplication of the embryonic axis. Cell 58, 1075–1084.[CrossRef][Medline]

Miyoshi, Y., Iwao, K., Nagasawa, Y., Aihara, T., Sasaki, Y., Imaoka, S., Murata, M., Shimano, T., and Nakamura, Y. (1998). Activation of the beta-catenin gene in primary hepatocellular carcinomas by somatic alterations involving exon 3. Cancer Res 58, 2524–2527.[Abstract/Free Full Text]

Moon, R. T., Brown, J. D., and Torres, M. (1997). WNTs modulate cell fate and behavior during vertebrate development. Trends Genet 13, 157–162.[CrossRef][Medline]

Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997). Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275, 1787–1790.[Abstract/Free Full Text]

Nagai, H., Ponglikitmongkol, M., Mita, E., Ohmachi, Y., Yoshikawa, H., Saeki, R., Yumoto, Y., Nakanishi, T., and Matsubara, K. (1994). Aberration of genomic DNA in association with human hepatocellular carcinomas detected by 2-dimensional gel analysis. Cancer Res 54, 1545–1550.[Abstract/Free Full Text]

Nusse, R., and Varmus, H. E. (1982). Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31, 99–109.[CrossRef][Medline]

Nusse, R., and Varmus, H. E. (1992). Wnt genes. Cell 69, 1073–1087.[CrossRef][Medline]

Orford, K., Orford, C. C., and Byers, S. W. (1999). Exogenous expression of beta-catenin regulates contact inhibition, anchorage-independent growth, anoikis, and radiation-induced cell cycle arrest. J. Cell Biol 146, 855–868.[Abstract/Free Full Text]

Palacios, J., and Gamallo, C. (1998). Mutations in the beta-catenin gene (CTNNB1) in endometrioid ovarian carcinomas. Cancer Res 58, 1344–1347.[Abstract/Free Full Text]

Papkoff, J., Brown, A. M., and Varmus, H. E. (1987). The int-1 proto-oncogene products are glycoproteins that appear to enter the secretory pathway. Mol. Cell. Biol 7, 3978–3984.[Abstract/Free Full Text]

Papkoff, J., Rubinfeld, B., Schryver, B., and Polakis, P. (1996). Wnt-1 regulates free pools of catenins and stabilizes APC-catenin complexes. Mol. Cell. Biol 16, 2128–2134.[Abstract]

Papkoff, J., and Schryver, B. (1990). Secreted int-1 protein is associated with the cell surface. Mol. Cell. Biol 10, 2723–2730.[Abstract/Free Full Text]

Parr, B. A., and McMahon, A. P. (1995). Dorsalizing signal Wnt-7a required for normal polarity of D-V and A-P axes of mouse limb. Nature 374, 350–353.[CrossRef][Medline]

Peifer, M., Pai, L. M., and Casey, M. (1994). Phosphorylation of the Drosophila adherens junction protein Armadillo: roles for wingless signal and zeste-white 3 kinase. Dev. Biol 166, 543–556.[CrossRef][Medline]

Pelengaris, S., Rudolph, B., and Littlewood, T. (2000). Action of Myc in vivo–proliferation and apoptosis. Curr. Opin. Genet. Dev 10, 100–105.[CrossRef][Medline]

Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837–1851.[Free Full Text]

Prendergast, G. C. (1999). Mechanisms of apoptosis by c-Myc. Oncogene 18, 2967–2987.[CrossRef][Medline]

Ramakrishna, N. R., and Brown, A. M. (1993). Wingless, the Drosophila homolog of the proto-oncogene Wnt-1, can transform mouse mammary epithelial cells. Dev. Suppl, 95–103.

Rijsewijk, F., van Deemter, L., Wagenaar, E., Sonnenberg, A., and Nusse, R. (1987). Transfection of the int-1 mammary oncogene in cuboidal RAC mammary cell line results in morphological transformation and tumorigenicity. EMBO J 6, 127–131.[Medline]

Roelink, H., Wagenaar, E., Lopes da Silva, S., and Nusse, R. (1990). Wnt-3, a gene activated by proviral insertion in mouse mammary tumors, is homologous to int-1/Wnt-1 and is normally expressed in mouse embryos and adult brain. Proc. Natl. Acad. Sci. USA 87, 4519–4523.[Abstract/Free Full Text]

Ross, S. E., Hemati, N., Longo, K. A., Bennett, C. N., Lucas, P. C., Erickson, R. L., and MacDougald, O. A. (2000). Inhibition of adipogenesis by Wnt signaling. Science 289, 950–953.[Abstract/Free Full Text]

Rubinfeld, B., Robbins, P., El-Gamil, M., Albert, I., Porfiri, E., and Polakis, P. (1997). Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 275, 1790–1792.[Abstract/Free Full Text]

Satoh, S. et al. (2000). AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat. Genet 24, 245–250.[CrossRef][Medline]

Shackleford, G. M., and Varmus, H. E. (1987). Expression of the proto-oncogene int-1 is restricted to postmeiotic male germ cells and the neural tube of mid-gestational embryos. Cell 50, 89–95.[CrossRef][Medline]

Shackleford, G. M., Willert, K., Wang, J., and Varmus, H. E. (1993). The Wnt-1 proto-oncogene induces changes in morphology, gene expression, and growth factor responsiveness in PC12 cells. Neuron 11, 865–875.[CrossRef][Medline]

Shimizu, H., Julius, M. A., Giarre, M., Zheng, Z., Brown, A. M., and Kitajewski, J. (1997). Transformation by Wnt family proteins correlates with regulation of beta-catenin. Cell Growth Differ 8, 1349–1358.[Abstract]

Stark, K., Vainio, S., Vassileva, G., and McMahon, A. P. (1994). Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372, 679–683.[CrossRef][Medline]

Takada, S., Stark, K. L., Shea, M. J., Vassileva, G., McMahon, J. A., and McMahon, A. P. (1994). Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev 8, 174–189.[Abstract/Free Full Text]

Tetsu, O., and McCormick, F. (1999). Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422–426.[CrossRef][Medline]

Thomas, K. R., and Capecchi, M. R. (1990). Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346, 847–850.[CrossRef][Medline]

van de Wetering, M. et al. (1997). Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 88, 789–799.[CrossRef][Medline]

Van Den Berg, D. J., Sharma, A. K., Bruno, E., and Hoffman, R. (1998). Role of members of the Wnt gene family in human hematopoiesis. Blood 92, 3189–3202.[Abstract/Free Full Text]

Veltmaat, J. M., Van Veelen, W., Thiery, J. P., and Bellusci, S. (2004). Identification of the mammary line in mouse by Wnt10b expression. Dev. Dyn 229, 349–356.[CrossRef][Medline]

Vider, B. Z., Zimber, A., Chastre, E., Prevot, S., Gespach, C., Estlein, D., Wolloch, Y., Tronick, S. R., Gazit, A., and Yaniv, A. (1996). Evidence for the involvement of the Wnt 2 gene in human colorectal cancer. Oncogene 12, 153–158.[Medline]

Voeller, H. J., Truica, C. I., and Gelmann, E. P. (1998). Beta-catenin mutations in human prostate cancer. Cancer Res 58, 2520–2523.[Abstract/Free Full Text]

Weber-Hall, S. J., Phippard, D. J., Niemeyer, C. C., and Dale, T. C. (1994). Developmental and hormonal regulation of Wnt gene expression in the mouse mammary gland. Differentiation 57, 205–214.[CrossRef][Medline]

Willert, K., and Nusse, R. (1998). beta-Catenin: a key mediator of Wnt signaling. Curr. Opin. Genet. Dev 8, 95–102.[CrossRef][Medline]

Ye, Q. H. et al. (2003). Predicting hepatitis B virus-positive metastatic hepatocellular carcinomas using gene expression profiling and supervised machine learning. Nat. Med 9, 416–423.[CrossRef][Medline]

Yoshikawa, H., Matsubara, K., Qian, G. S., Jackson, P., Groopman, J. D., Manning, J. E., Harris, C. C., and Herman, J. G. (2001). SOCS-1, a negative regulator of the JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat. Genet 28, 29–35.[CrossRef][Medline]

Yoshikawa, H., Nagai, H., Oh, K. S., Tamai, S., Fujiyama, A., Nakanishi, T., Kajiyama, G., and Matsubara, K. (1997). Chromosome assignment of aberrant NotI restriction DNA fragments in primary hepatocellular carcinoma. Gene 197, 129–135.[CrossRef][Medline]

Young, C. S., Kitamura, M., Hardy, S., and Kitajewski, J. (1998). Wnt-1 induces growth, cytosolic beta-catenin, and Tcf/Lef transcriptional activation in Rat-1 fibroblasts. Mol. Cell. Biol 18, 2474–2485.[Abstract/Free Full Text]

Yuza, Y., Agawa, M., Matsuzaki, M., Yamada, H., and Urashima, M. (2003). Gene and protein expression profiling during differentiation of neuroblastoma cells triggered by 13-cis retinoic acid. J. Pediatr. Hematol. Oncol 25, 715–720.[CrossRef][Medline]

Zurawel, R. H., Chiappa, S. A., Allen, C., and Raffel, C. (1998). Sporadic medulloblastomas contain oncogenic beta-catenin mutations. Cancer Res 58, 896–899.[Abstract/Free Full Text]

This article has been cited by other articles:

				Y. Shikauchi, A. Saiura, T. Kubo, Y. Niwa, J. Yamamoto, Y. Murase, and H. Yoshikawa SALL3 Interacts with DNMT3A and Shows the Ability To Inhibit CpG Island Methylation in Hepatocellular Carcinoma Mol. Cell. Biol., April 1, 2009; 29(7): 1944 - 1958. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Materials All Versions of this Article: E06-10-0889v1 18/11/4292    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yoshikawa, H. Articles by Harris, C. C. Search for Related Content PubMed PubMed Citation Articles by Yoshikawa, H. Articles by Harris, C. C.