![]() |
|
|
Vol. 18, Issue 11, 4353-4364, November 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nephrology Division, Massachusetts General Hospital, Charlestown, MA 02129
Submitted June 6, 2007;
Revised July 16, 2007;
Accepted August 21, 2007
Monitoring Editor: Stephen Doxsey
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Cilia assembly has been well studied in the flagellate Chlamydomonas reinhardtii and the nematode C. elegans (Rosenbaum and Witman, 2002
; Scholey, 2003
). Ciliogenesis involves a process of intraflagellar transport (IFT) that mediates the delivery of components such as tubulin, dyneins, and membrane proteins to the cilia tip where new cilia assembly occurs (Rosenbaum and Witman, 2002
; Scholey, 2003
; Qin et al., 2004
). Transport in the anterograde direction is mediated by kinesin II motor proteins, whereas retrograde transport is driven by dynein motor proteins, and it serves to return components to the basal body (Rosenbaum and Witman, 2002
; Scholey, 2003
). The proteins that comprise the IFT particles (IFT proteins) have been biochemically characterized and shown to be selectively associated with anterograde (complex B) and retrograde (complex A) transport (Rosenbaum and Witman, 2002
; Scholey, 2003
). Localization of IFT proteins by immunoelectron microscopy, and live studies of fluorescent IFT-fusion proteins indicate that IFT and ciliogenesis occur in a stepwise process. First, particles assemble on basal body transitional fibers where cargo, kinesin motors, and IFT proteins associate. These complexes translocate to the cilia transition zone microtubules, and then to axonemal microtubules where transport of the IFT particle to the cilia tip is initiated (Rosenbaum and Witman, 2002
; Scholey, 2003
). Core IFT proteins, together with peripheral IFT proteins, link the IFT particles to kinesins or cargo molecules (Lucker et al., 2005
) and form the basis of axonemal transport as well as Golgi-to-cilia trafficking of cilia membrane proteins (Follit et al., 2006
). Engagement of kinesin and dynein motors on the cilia axoneme is essential for IFT, and it has been shown to be enhanced by a posttranslational modification of axonemal tubulin that adds polyglutamyl side chains to acidic residues in the tubulin C terminus (Gagnon et al., 1996
; Wang and Sheetz, 2000
; Skiniotis et al., 2004
; Vent et al., 2005
). These acidic domains are proposed to interact electrostatically with basic residues on kinesins resulting in efficient microtubule based transport of kinesin and dynein-linked cargo molecules (Okada and Hirokawa, 2000
; Thorn et al., 2000
).
Although progress has been made in the characterization of IFT and its IFT particle proteins, studies of the cilia/basal body proteome indicate that there may be 600 or more proteins involved in cilia structure and assembly (Ostrowski et al., 2002
; Andersen et al., 2003
; Avidor-Reiss et al., 2004
; Li et al., 2004
; Blacque et al., 2005
; Efimenko et al., 2005
; Pazour et al., 2005
; Stolc et al., 2005
); from this, it is clear that ciliogenesis is a complex process and that many other proteins are involved. For example, in C. elegans amphid cilia, two IFT motors, kinesin-II and osmotic avoidance defective (OSM)-3 kinesin, cooperate to drive two separate anterograde IFT pathways that build distinct cilia segments (Ou et al., 2005
). The conserved tetratricopeptide protein DYF-1 has been shown to be required for OSM-3 kinesin to dock onto and move IFT particles, and it has been proposed to act as a cofactor required for homodimeric kinesin OSM-3 motility (Ou et al., 2005
). However, the role of DYF-1 in protein interactions that drive ciliogenesis is currently unknown. We have analyzed ciliogenesis in the zebrafish embryo and demonstrated that zebrafish embryos and larvae exhibit multiple different forms of cilia, including 9 + 2 motile, 9 + 0 motile, and immotile sensory cilia (Tsujikawa and Malicki, 2004
; Kramer-Zucker et al., 2005
). Zebrafish cystic kidney mutants typically exhibit pleiotropic defects in photoreceptor cell morphology and organ situs that can arise from a common defect in ciliogenesis (Kramer-Zucker et al., 2005
). Here we describe the positional cloning and characterization of the ENU mutant flr, which exhibits the multiorgan phenotype of cystic kidney, hydrocephalus, retinal degeneration, and left-right asymmetry defects. We find that flr encodes a tetratricopeptide repeat protein homologue of the C. elegans dyf-1 and demonstrate that it is required for axonemal tubulin polyglutamylation. We also show that the tubulin polyglutamylase Ttll6 is required for the formation of zebrafish olfactory cilia, demonstrating for the first time that vertebrate ciliogenesis and function in vivo requires tubulin polyglutamylation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Positional Cloning of fleer
Standard linkage analysis using simple sequence repeat polymorphisms was used for both low- and high-resolution mapping of flr. The initial assignment of flr to chromosome 3 was performed by bulk segregant analysis with a panel of sslp markers spaced every 10 cM over the 25 zebrafish chromosomes. For high-resolution mapping within the interval flanked by z10805 and z22516, 34 Candidate SSR marker primer pairs were generated using the Zebrafish SSR search website (Massachusetts General Hospital, Charlestown, MA; http://danio.mgh.harvard.edu/markers/ssr.html). Genomic sequence in the genetic interval defined by markers z10805 and z63912 was repeatmasked using Repeatmasker (http://www.repeatmasker.org) and analyzed using Genscan (Burge and Karlin, 1997
) to predict genes in the interval. Predicted peptides were compared with cilia proteome blast databases (Ostrowski et al., 2002
; Avidor-Reiss et al., 2004
; Li et al., 2004
), using blastp. A high scoring hit to all three databases emerged as the Fleer candidate peptide. A hypothetical flr open reading frame (ORF) was predicted from genomic DNA based on similarity to mouse and human expressed sequence tags. Sequences within the putative 5' and 3' Untranslated regions of the flr ORF were used to generate nested polymerase chain reaction (PCR) primers. Reverse transcription (RT)-PCR performed on total RNA from 2.5-d-old zebrafish larvae yielded a 2.4-kb cDNA product whose sequence yielded the complete Fleer predicted polypeptide. The amplified flr cDNA was cloned into pCRII-Topo Dual vector (Invitrogen, Carlsbad, CA). The sequence of the primers used for amplification of flr cDNA is as follows: flrF1 TGTTTTTAAGCTCTGGGAAGCGTCA, flrR1 CCATTGACTGTGATGCACAGAACC, flrF2 GCTCTGGGAAGCGTCATGTATTGA, and flrR2 TGCCCTTCTGTGTCGAATATTTCC. Genbank accession numbers for sequences in this work: fleer EF653429, fleer_tv1 EU124003, ttll6 EU124004.
Morpholino Knockdown of fleer and ttll6
Two antisense morpholinos, flrMoex9d and flrMoex17d, were designed to target the splicing donor sites of exons 9 and 17, respectively. Reverse complement of the exon 9 sequence was used to generate a control morpholino flx9Con. The actual sequence of individual antisense morpholinos is as follows, with the splice donor corresponding site underlined: flrMoex9d 5' TAGTACACTTACCTCATATTTACAG 3', flrMoex9Con 5' GACATTTATACTCCATTCACATGAT 3', and flrMoex17d 5' AATTACCTTTTTGTTGTATGGCTC 3'.
Morpholino oligonucleotides (oligos) were diluted to 0.5 mM in 100 mM KCl, 10 mM HEPES, 0.1% phenol red (Sigma-Aldrich, St. Louis, MO), and 4.6 nl was injected into two- to four-cell–stage wild-type TuAB embryos by using a nanoliter 2000 microinjector (WPI, Sarasota, FL). To verify the morpholino induced mRNA splicing defects, nested RT-PCR was performed on total RNA extracted from individual morpholino-injected embryos. Sequences of the primers located in flanking exons are listed here, with the numbers referring to exons and letters F and R denote forward and reverse, respectively: flrEx4F 5' GCAGGCTGCAATCAAATATGGAGA 3', flrEx9F 5' TTCCTCCTTCAGCAAAACCCCTTC 3', flrEx16F 5' AGGCAGAGGAACTGATGAGGAAA 3', flrEx16F2 5' TCTTTCATTTGTGCATTGTCAACC 3', flrEx12R 5' TGTTTCGTAACCTTGCGGAGCTGT 3', flrEx11R 5' GAGCTGTTTGGCATGTGATCATGG 3', flrEx19R 5' TCATACGTGACGGTGTTCTTGC 3', and flrEx18R 5' TCACAGTGCTCAAGGAACTGAATGC 3'.
Antisense morpholino to the exon 10 splice donor site (ttll6MoEx10d) of the zebrafish ttll6 gene were designed based on cDNA sequence to the ttll6 C terminus (GenBank accession no. CT667061) and corresponding ttll6 genomic sequence in bac BX001014.6. PCR primers located within flanking exons 9 and 11 were used to amplify and sequence the morphant mRNA to assay induced mRNA splicing defects. Sequence of the morpholino and RT-PCR oligos are as follows: ttll6MoEx10d: GCAACTGAATGACTTACTGAGTTTG, ttll6Ex9F GACGGAGGAGAAATATGAAAAGT, ttll6Ex9F2 CCAACACAGCAGCTCTCTTTTCCA, ttll6Ex11R2 TCACGCTGGACAGCTCAAGCATT, and ttll6Ex11R TCCGCTCAAGAGAAACAGGT.
In Situ Hybridization
Whole mount in situ hybridization was performed as described previously (Thisse and Thisse, 1998
). Digoxygenin-labeled antisense RNA probe (1.1 kb) was synthesized by in vitro transcription reaction by using the T7 polymerase (Ambion, Austin, TX) and HindIII-linearized flr_tv1-TopoII clone as template. The stained embryos were dehydrated, cleared with benzyl benzoate:benzyl alcohol (2:1), and photographed with a Spot digital camera (National Diagnostics, Atlanta, GA) mounted on a Leica MZ12 stereomicroscope (Leica Microsystems, Deerfield, IL).
Histology
Zebrafish larvae were fixed for histology with 4% formaldehyde in phosphate-buffered saline (PBS), overnight at 4°C. The fixed specimens were dehydrated, embedded in JB-4 (Polysciences, Warrington, PA), and sectioned at 5–7 µm. Slides were stained with methylene blue/azure II (Humphrey and Pittman, 1974
), and they were examined using a Nikon E800 microscope (Nikon, Tokyo, Japan).
Antibody Staining and Immunofluorescence
Whole zebrafish embryos or larvae were fixed for immunolabeling in Dent's fixative (80% methanol:20% dimethyl sulfoxide) at 4°C overnight or for 4 h at room temperature in Prefer fixative (Anatech, Battle Creek, MI). Before antibody labeling, the fixed specimens were rehydrated, washed with PBS containing 0.5% Tween 20 (PBST), and blocked with 10% normal goat serum (NGS) in PBST.
The C. elegans cultures were grown on agar plates by using standard methods (Sulston and Hodgkin, 1988
). Adult worms from wild-type N2, dyf-1 SP1205, and osm-3 strains were prepared for immunohistochemistry as per the procedure of Nonet et al. (1997)
. Briefly, worms were suspended for 1 h in modified Bouin's fixative (0.75 ml of saturated picric, 0.25 ml of 37% Formalin, 0.05 ml of acetic acid, 0.25 ml of methanol, and 0.01 ml of
-mercaptoethanol). While suspended in the fix, the worms were permeabilized by repeat freeze-thaw in liquid nitrogen. After an additional hour of incubation, the worms were washed with BTB (25 mM Na-borate, 0.5% Triton X-100, and 2%
-mercaptoethanol) for a total of 3 h. After a brief wash in BT (25 mM Na-borate and 0.5% Triton X-100) buffer, the worms were stored in PBST (PBS containing 0.1% Tween 20) for immunohistochemistry.
Polyclonal rabbit antibody to Fleer was raised against a 13-amino acid synthetic peptide (YYHMQDFTNAAEC) epitope located at the start of first tetratricopeptide repeat (TPR) domain in the Fleer N terminus (Cocalico Biologicals, Reamstown, PA). The antibody was affinity purified on antigen peptide-conjugated beads (Pierce Chemical, Rockford, IL).
Primary antibodies were diluted in PBST containing 5% NGS at following concentrations. rabbit anti-Fleer (1:400) mouse anti-acetylated tubulin, monoclonal antibody (mAb) 6-11B-1 (1:750; Sigma-Aldrich); mouse anti-glutamylated tubulin, mAb GT335 (1:400; gift from C. Janke); mouse anti
-tubulin, mAb 3F3-G2 (1:100; Seven Hills Bioreagents, Cincinnati, OH); mouse anti-OSM-5 (1:350; gift from B. Yoder); and rabbit anti-OSM10 (1:200; gift from Anne Hart). Antibody incubations were performed overnight at 4°C followed by washing five times, 15 min each with PBST, blocked with 10% NGS in PBST for 1 h at room temperature (RT), and detected using the secondary antibodies Alexa 546 anti-mouse (1:1000) or Alexa 488 anti-mouse (1:750). Double immunostaining using two antibodies from mouse, mAb GT335 and mAb 6–11B-1, incorporated a blocking step to prevent secondary antibody cross-reactivity (Supplemental Figure S2; Negoescu et al., 1994
). mAb GT335 was applied first and detected with the secondary A546 anti-mouse antibody. This binary complex was stabilized by 1-h fixation with 4% formaldehyde at RT, followed by a brief rinse and blocking with 10% normal mouse serum (2 h at 4°C). Nonspecifically bound normal mouse serum was removed by extensive washing with PBST (5 x 15 min), and unconjugated mouse F(ab) fragments (1:20) were applied overnight at 4°C to eliminate recognition of the first mouse primary antibody with the later secondary anti-mouse antibody. After washes with PBST, sequential labeling with the second primary (mAb 6–11B-1) and its detection with Alexa 488 anti-mouse was carried out as for the single antibody labeling. Immunolabeled specimens were dehydrated in methanol, cleared with 2:1 benzyl benzoate:benzyl alcohol, and examined with a Zeiss LSM5 Pascal-confocal microscope. Two-color confocal z-series images were acquired using sequential laser excitation. For measurements of cilia length, z-series images were converted into a single plane projection and analyzed using Image J software (LSM reader).
Electron Microscopy
Embryos were prepared for electron microscopy as described previously (Drummond et al., 1998
).
High-Speed Video Microscopy
The 54-h phenylthiourea (PTU)-treated embryos were put in E3 egg water containing 40 mM 2,3-butanedione monoxime (BDM; Sigma-Aldrich) for 5 min to stop the heart beat, and then they were changed to 20 mM BDM-containing egg water for observation. The embryos were analyzed with Nomarski optics by using a 40x/0.55 water immersion lens on a Zeiss Axioplan microscope (Carl Zeiss, Jena, Germany) equipped with a high-speed Photron FastCAM-PCI500 videocamera (Photron, Tokyo, Japan). Images of beating cilia were acquired at 250 frames/s by using Photron FastCAM version 1.2.0.7 (Photron). Image processing was done using Photoshop (Adobe Systems, Mountain View, CA), and movies were compiled in Graphic converter version 4.5.2 (Lemke Software, Peine, Germany) and Quicktime (Apple, Cupertino, CA).
| RESULTS |
|---|
|
|
|---|
|
|
Phenocopy of flr by Morpholino Knockdown
Antisense oligo-mediated knockdown of the predicted TPR repeat containing protein phenocopied the entire range of defects characteristic of the ENU mutant flrm477 (Figure 3, A and B). Wild-type embryos injected with morpholinos targeting splice donor sites in either exon 9 (Figure 3, C and D) or exon 17 (Figure 3, E and F) developed the axis curvature and pronephric cysts characteristic of flr mutants. Embryos injected with a control morpholino were normal in appearance. Molecular analysis of RT-PCR products from morpholino-injected embryos revealed misplicing events consistent with a flr loss of function phenotype. In exon 9 morphants, inclusion of intron 10 in the altered mRNA introduced a premature termination codon (Figure 3, G and H). In exon 17 morphants (Figure 3, G and I), the targeted exon was eliminated. Complete deletion of exon 17 would be expected to yield a polypeptide resembling flr_tv1; however, a single base frame shift at the splice acceptor site in exon 18 introduced a stop codon, prematurely truncating the morphant polypeptide. These results suggest that the C-terminal 114 amino acids of Fleer encoded by exons 17–19 are essential for its function and that protein encoded by the flr_tv1 splice variant may be nonfunctional.
|
|
-tubulin. Motile cilia in Kupffer's vesicle generate a directional fluid flow thought to constitute a signal determining organ laterality (Bisgrove et al., 2005
70% of control length.
|
|
Defects seen in flr morphant cilia in Kupffer's vesicle would suggest that these embryos would show randomization of embryonic left-right asymmetry (Bisgrove et al., 2005
; Kramer-Zucker et al., 2005
). We used the laterality marker southpaw to assess left-right Asymmetry in flr exon 9 morphants, because the uniformity of phenotype in morphants would be expected to give a greater number of affected embryos than a clutch of embryos from an intercross of flrm477 heterozygotes. Approximately 90% of wild-type embryos showed normal left-sided expression of southpaw at the 18 somite stage, whereas <50% of flr morphants showed normal left-sided expression (Figure 6). The remaining flr morphants showed either an absence of southpaw expression, bilateral expression, or right-sided expression. These results are consistent with previous studies that point to an essential role of cilia in Kupffer's vesicle, the equivalent of the mouse embryonic node, and fluid movement in generating a signal that breaks left-right symmetry (Bisgrove et al., 2005
; Kramer-Zucker et al., 2005
).
|
flr Mutant Cilia Exhibit Ultrastructural Defects in the B-Tubule of Microtubule Doublets
To assess whether the motility defects we observed in flr mutant cilia were due to defects in dynein arm assembly or alternatively, might be reflected changes in the structure of cilia microtubules themselves, we pursued ultrastructural analysis of flr cilia. Single pronephric cilia from 2.5 days postfertilization (dpf) wild-type zebrafish exhibit a typical "9 + 2" structure in cross section, with well formed microtubule doublets and both inner and outer dynein arm motors (Figure 7A). In contrast, flr mutant cilia exhibited a gap or discontinuity in the outer aspect of the microtubule doublet B-tubule (Figure 7B). Discontinuities were observed in B-tubules of all flr cilia examined however in some cases not all 9 doublets were affected.
|
-tubulin that prevent posttranslational modifications of tubulin, i.e., polyglutamylation and/or polyglycylation, result in structural defects in cilia doublet B-tubules, similar to what we observe in flr mutants (Redeker et al., 2005
75% of axoneme length. These results demonstrate that the flr gene product is essential for proper tubulin polyglutamylation, and they further suggest that a failure in posttranslational modification of tubulin may account for the observed defects in flr cilia structure and motility.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
- and
-tubulin (Kann et al., 2003
The C. elegans Fleer homologue DYF-1 is transported by IFT in neuronal cilia, suggesting that Fleer/DYF-1 interacts directly or indirectly with microtubule motors (Ou et al., 2005
). Evidence has also been presented suggesting that DYF-1 may regulate kinesin motor activity. C. elegans dyf-1 mutants lack the most distal, singlet microtubule segments of neurosensory cilia and seem similar in this regard to osm-3 mutants that harbor mutations in a homodimeric kinesin (Ou et al., 2005
). In dyf-1 mutants, transport processes dependent on the multimeric kinesin kinesin II continue at reduced velocity; however, motility of the homodimeric kinesin OSM-3 is arrested (Ou et al., 2005
). This finding has lead to the idea that multiple anterograde motors function in amphid cilia and that OSM-3 is specifically required for IFT in the singlet microtubule outer segments. DYF-1 could function as a specific activator of OSM-3 (Ou et al., 2005
; Imanishi et al., 2006
). In light of our results, an alternative view could be that a reduction in axonemal tubulin polyglutamylation could lead to a loss of OSM-3 motility in dyf-1 mutants. In support of this idea, in vitro studies of kinesin motility have shown that removal of the tubulin C terminus containing polyglutamylation sites does not prevent binding of kinesin motors to microtubules, but most potently reduces the processivity of kinesin movement (Thorn et al., 2000
; Wang and Sheetz, 2000
). Basic residues in the kinesin neck coiled-coil have been proposed to interact electrostatically with acidic tubulin C termini to maintain proximity of kinesin heads to microtubules, facilitating reengagement and processive, hand-overhand kinesin movement (Okada and Hirokawa, 2000
; Thorn et al., 2000
). Although our results clearly show an absence of polyglutamylation in outer labial cilia, the extent of polyglutamylation in amphid cilia, where OSM-3 motility has been measured in vivo (Ou et al., 2005
), was more difficult to assess given the variable staining intensity we saw with GT335 antibody in dyf-1 mutants and the organization of amphid cilia in bundles with staggered basal body positions. Nonetheless, the lack of polyglutamylation in outer labial cilia in dyf-1 mutants suggests that a polyglutamylation defect may exist in amphid cilia and that this could contribute to defects in kinesin motility.
OSM-3 and Kinesin II are affected differently in dyf-1 mutants; OSM-3 motility is arrested while Kinesin II motility persists (Ou et al., 2005
). Although further experiments will be required to clearly link polyglutamylation to the behavior of OSM-3 kinesin in amphid neuron cilia, our results raise the possibility that OSM-3 and Kinesin II may be differentially sensitive to a reduction in tubulin polyglutamylation. The idea that different classes of kinesins may have different requirements for tubulin polyglutamylation is supported by recent studies of the ROSA22 mouse mutant that lacks the PGs1 subunit of tubulin polyglutamylase. These mutant mice show a substantial reduction of polyglutamylated tubulin in neurons and a selective impairment of KIF1A cargo trafficking, whereas KIF3A and KIF5 transport is unaltered (Ikegami et al., 2007
). Differential sensitivity of IFT in different cell types to loss of polyglutamylation may also help account for the high sensitivity of zebrafish olfactory cilia and kidney multiciliated cells to loss of flr function compared with other cilia. It may be that distinct kinesin motors function in olfactory and kidney multiciliated cells and these kinesins may be more sensitive to loss of tubulin polyglutamylation.
All TTLL enzymes contain a conserved core "TTL domain" (Supplemental Figure S1; van Dijk et al., 2007
) that is required for polyglutamylation activity. Nonconserved domains are dispensable for enzyme activity, but they are required for normal localization of TTLL proteins (van Dijk et al., 2007
). In both Tetrahymena and mammalian cells, TTLL6 is localized to basal bodies and cilia (Janke et al., 2005
; van Dijk et al., 2007
). The C-terminal truncated TTLL6 proteins localize to basal bodies, but cilia localization is lost (Janke et al., 2005
; van Dijk et al., 2007
). Our zebrafish ttll6 knockdown mRNA would be predicted to encode the N-terminal 505 amino acids of Ttll6, a domain sufficient for polyglutamylase activity (Janke et al., 2005
; van Dijk et al., 2007
), but lack the C terminus (Supplemental Figure S1B) required for cilia localization. Morpholino knockdown of ttll6 had strongest effects on olfactory cilia. Most cilia were missing, and interestingly, in remaining cilia, only basal bodies were polyglutamylated. This finding is consistent with the idea that the Ttll6 protein encoded by the morphant mRNA may be enzymatically active but defective in transport to the ciliary axoneme. In contrast to its strong effect on olfactory cilia, ttll6 knockdown had little effect on kidney cilia (data not shown). In the mouse kidney, all nine TTLL polyglutamylases have been shown to be expressed, suggesting that a high degree of functional redundancy may exist (van Dijk et al., 2007
). Further experiments will be required to determine how many of the zebrafish Ttll polyglutamylases are expressed in the pronephros and whether a similar degree of functional redundancy can explain the lack of effect of ttll6 knockdown in the larval kidney.
The Fleer protein lacks a TTL domain (van Dijk et al., 2007
) and is therefore unlikely to function as a tubulin polyglutamylase. It is more likely that Fleer acts as a regulator of TTLL enzyme activity or plays a role in TTLL enzyme localization or transport. Our results on flr together with the data on TTLL enzyme localization suggest that Fleer/DYF-1 could act as a cargo adaptor protein that links TTLL polyglutamylase enzymes to anterograde intraflagellar transport. In the absence of Fleer, polyglutamylation of basal body tubulin would be maintained, but failure to tether TTLL enzymes to IFT would result in lack of polyglutamylated cilia tubulin leading to B-subfiber instability, impaired dynein motility, and the arrest of polyglutamylation-dependent kinesin motility (Figure 11A). This hypothetical model also raises the possibility that coordination of different kinesin motility in IFT may be, at least in part, achieved indirectly by the action of a primary Kinesin:Fleer/DYF-1:TTLL complex laying down a polyglutamylated tubulin track for a secondary kinesin (OSM-3/Kif17) to follow. As an alternative model, Fleer could act as a structural element of cilia axonemes that stabilizes the junction of cilia B-subfiber protofilaments with the A-subfiber partition (Figure 11B). The outer aspect of cilia B-subfibers are the most sensitive to detergent extraction (Witman et al., 1972
), suggesting that these protofilaments may require stabilization by accessory proteins. However, this model does not readily explain how tubulin polyglutamylation would be generally reduced in flr mutant cilia. Also, the active intraflagellar transport of the Fleer homologue DYF-1 in C. elegans (Ou et al., 2005
) argues for a more dynamic role for these proteins. Biochemical analysis of fleer-interacting proteins will be required to better understand its function in cilia.
|
| ACKNOWLEDGMENTS |
|---|
tubulin antibody, and Carsten Janke for GT335 antibody. This work was supported by National Institutes of Health grants DK-53093 and DK-54711 (to I.A.D.). N.P. was supported by National Research Service Award training grant T32-DK007540-20, and S.M. was supported by fellowship 126a2f from the Polycystic Kidney Disease Foundation. | Footnotes |
|---|
![]()
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
* Present address: Department of Medicine, MetroHealth Medical Center, and Department of Genetics, Case Western Reserve University School of Medicine, Cleveland, OH 44109. ![]()
Address correspondence to: Iain Drummond (idrummon{at}receptor.mgh.harvard.edu)
| REFERENCES |
|---|
|
|
|---|
Avidor-Reiss, T., Maer, A. M., Koundakjian, E., Polyanovsky, A., Keil, T., Subramaniam, S., and Zuker, C. S. (2004). Decoding cilia function: defining specialized genes required for compartmentalized cilia biogenesis. Cell 117, 527–539.[CrossRef][Medline]
Bisgrove, B. W., Snarr, B. S., Emrazian, A., and Yost, H. J. (2005). Polaris and Polycystin-2 in dorsal forerunner cells and Kupffer's vesicle are required for specification of the zebrafish left-right axis. Dev. Biol 287, 274–288.[Medline]
Blacque, O. E. et al. (2005). Functional genomics of the cilium, a sensory organelle. Curr. Biol 15, 935–941.[CrossRef][Medline]
Brand, M. et al. (1996). Mutations affecting development of the midline and general body shape during zebrafish embryogenesis. Development 123, 129–142.[Abstract]
Burge, C., and Karlin, S. (1997). Prediction of complete gene structures in human genomic DNA. J. Mol. Biol 268, 78–94.[CrossRef][Medline]
Drummond, I. A. et al. (1998). Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function. Development 125, 4655–4667.[Abstract]
Efimenko, E., Bubb, K., Mak, H. Y., Holzman, T., Leroux, M. R., Ruvkun, G., Thomas, J. H., and Swoboda, P. (2005). Analysis of xbx genes in C. elegans. Development 132, 1923–1934.
Follit, J. A., Tuft, R. A., Fogarty, K. E., and Pazour, G. J. (2006). The intraflagellar transport protein IFT20 is associated with the Golgi complex and is required for cilia assembly. Mol. Biol. Cell 17, 3781–3792.
Gagnon, C., White, D., Cosson, J., Huitorel, P., Edde, B., Desbruyeres, E., Paturle-Lafanechere, L., Multigner, L., Job, D., and Cibert, C. (1996). The polyglutamylated lateral chain of alpha-tubulin plays a key role in flagellar motility. J. Cell Sci 109, 1545–1553.[Abstract]
Humphrey, C., and Pittman, F. (1974). A simple methylene blue-azure II-basic fuchsin stain for epoxy-embedded tissue sections. Stain Technol 49, 9–14.[Medline]
Ibanez-Tallon, I., Heintz, N., and Omran, H. (2003). To beat or not to beat: roles of cilia in development and disease. Hum. Mol. Genet 1, R27–R35.
Ikegami, K. et al. (2007). Loss of alpha-tubulin polyglutamylation in ROSA22 mice is associated with abnormal targeting of KIF1A and modulated synaptic function. Proc. Natl. Acad. Sci. USA 104, 3213–3218.
Imanishi, M., Endres, N. F., Gennerich, A., and Vale, R. D. (2006). Autoinhibition regulates the motility of the C. elegans intraflagellar transport motor OSM-3. J. Cell Biol 174, 931–937.
Janke, C. et al. (2005). Tubulin polyglutamylase enzymes are members of the TTL domain protein family. Science 308, 1758–1762.
Kann, M. L., Soues, S., Levilliers, N., and Fouquet, J. P. (2003). Glutamylated tubulin: diversity of expression and distribution of isoforms. Cell Motil. Cytoskeleton 55, 14–25.[CrossRef][Medline]
Klotz, A., Rutberg, M., Denoulet, P., and Wallin, M. (1999). Polyglutamylation of atlantic cod tubulin: immunochemical localization and possible role in pigment granule transport. Cell Motil. Cytoskeleton 44, 263–273.[CrossRef][Medline]
Kramer-Zucker, A. G., Olale, F., Haycraft, C. J., Yoder, B. K., Schier, A. F., and Drummond, I. A. (2005). Cilia-driven fluid flow in the zebrafish pronephros, brain and Kupffer's vesicle is required for normal organogenesis. Development 132, 1907–1921.
Li, J. B. et al. (2004). Comparative genomics identifies a flagellar and basal body proteome that includes the BBS5 human disease gene. Cell 117, 541–552.[CrossRef][Medline]
Liu, Y., Pathak, N., Kramer-Zucker, A., and Drummond, I. A. (2007). Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros. Development 134, 1111–1122.
Lucker, B. F., Behal, R. H., Qin, H., Siron, L. C., Taggart, W. D., Rosenbaum, J. L., and Cole, D. G. (2005). Characterization of the intraflagellar transport complex B core: direct interaction of the IFT81 and IFT74/72 subunits. J. Biol. Chem 280, 27688–27696.
McGrath, J., Somlo, S., Makova, S., Tian, X., and Brueckner, M. (2003). Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell 114, 61–73.[CrossRef][Medline]
Negoescu, A., Labat-Moleur, F., Lorimier, P., Lamarcq, L., Guillermet, C., Chambaz, E., and Brambilla, E. (1994). F(ab) secondary antibodies: a general method for double immunolabeling with primary antisera from the same species. Efficiency control by chemiluminescence. J. Histochem. Cytochem 42, 433–437.[Abstract]
Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A., Kanai, Y., Kido, M., and Hirokawa, N. (1998). Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell 95, 829–837.[CrossRef][Medline]
Nonet, M. L., Staunton, J. E., Kilgard, M. P., Fergestad, T., Hartwieg, E., Horvitz, H. R., Jorgensen, E. M., and Meyer, B. J. (1997). Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J. Neurosci 17, 8061–8073.
Okada, Y., and Hirokawa, N. (2000). Mechanism of the single-headed processivity: diffusional anchoring between the K-loop of kinesin and the C terminus of tubulin. Proc. Natl. Acad. Sci. USA 97, 640–645.
Ostrowski, L. E., Blackburn, K., Radde, K. M., Moyer, M. B., Schlatzer, D. M., Moseley, A., and Boucher, R. C. (2002). A proteomic analysis of human cilia: identification of novel components. Mol Cell Proteomics 1, 451–465.
Ou, G., Blacque, O. E., Snow, J. J., Leroux, M. R., and Scholey, J. M. (2005). Functional coordination of intraflagellar transport motors. Nature 436, 583–587.[CrossRef][Medline]
Pazour, G. J. (2004). Intraflagellar transport and cilia-dependent renal disease: the ciliary hypothesis of polycystic kidney disease. J. Am. Soc. Nephrol 15, 2528–2536.
Pazour, G. J., Agrin, N., Leszyk, J., and Witman, G. B. (2005). Proteomic analysis of a eukaryotic cilium. J. Cell Biol 170, 103–113.
Perkins, L. A., Hedgecock, E. M., Thomson, J. N., and Culotti, J. G. (1986). Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev. Biol 117, 456–487.[CrossRef][Medline]
Qin, H., Diener, D. R., Geimer, S., Cole, D. G., and Rosenbaum, J. L. (2004). Intraflagellar transport (IFT) cargo: IFT transports flagellar precursors to the tip and turnover products to the cell body. J. Cell Biol 164, 255–266.
Redeker, V., Levilliers, N., Vinolo, E., Rossier, J., Jaillard, D., Burnette, D., Gaertig, J., and Bre, M. H. (2005). Mutations of tubulin glycylation sites reveal cross-talk between the C termini of
- and
-tubulin and affect the ciliary matrix in Tetrahymena. J. Biol. Chem 280, 596–606.
Rosenbaum, J. L., and Witman, G. B. (2002). Intraflagellar transport. Nat. Rev. Mol. Cell Biol 3, 813–825.[CrossRef][Medline]
Scholey, J. M. (2003). Intraflagellar transport. Annu. Rev. Cell. Dev. Biol 19, 423–443.[CrossRef][Medline]
Scholey, J. M., and Anderson, K. V. (2006). Intraflagellar transport and cilium-based signaling. Cell 125, 439–442.[CrossRef][Medline]
Skiniotis, G., Cochran, J. C., Muller, J., Mandelkow, E., Gilbert, S. P., and Hoenger, A. (2004). Modulation of kinesin binding by the C-termini of tubulin. EMBO J 23, 989–999.[CrossRef][Medline]
Stolc, V., Samanta, M. P., Tongprasit, W., and Marshall, W. F. (2005). Genome-wide transcriptional analysis of flagellar regeneration in Chlamydomonas reinhardtii identifies orthologs of ciliary disease genes. Proc. Natl. Acad. Sci. USA 102, 3703–3707.
Sulston, J., and Hodgkin, J. (1988). Methods in the Nematode Caenorhabditis elegans. In: The Nematode Caenorhabditis elegans, W. B. Wood, Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory, 587–606.
Thisse, C., and Thisse, B. (1998). High resolution whole-mount in situ hybridization. Zebrafish Sci. Monit 5, 8–9.
Thorn, K. S., Ubersax, J. A., and Vale, R. D. (2000). Engineering the processive run length of the kinesin motor. J. Cell Biol 151, 1093–1100.
Tsujikawa, M., and Malicki, J. (2004). Intraflagellar transport genes are essential for differentiation and survival of vertebrate sensory neurons. Neuron 42, 703–716.[CrossRef][Medline]
van Dijk, J., Rogowski, K., Miro, J., Lacroix, B., Edde, B., and Janke, C. (2007). A targeted multienzyme mechanism for selective microtubule polyglutamylation. Mol. Cell 26, 437–448.[CrossRef][Medline]
Vent, J., Wyatt, T. A., Smith, D. D., Banerjee, A., Luduena, R. F., Sisson, J. H., and Hallworth, R. (2005). Direct involvement of the isotype-specific C-terminus of beta tubulin in ciliary beating. J. Cell Sci 118, 4333–4341.
Wang, Z., and Sheetz, M. P. (2000). The C-terminus of tubulin increases cytoplasmic dynein and kinesin processivity. Biophys. J 78, 1955–1964.[Medline]
Westermann, S., and Weber, K. (2003). Post-translational modifications regulate microtubule function. Nat. Rev. Mol. Cell Biol 4, 938–947.[CrossRef][Medline]
Witman, G. B., Carlson, K., Berliner, J., and Rosenbaum, J. L. (1972). Chlamydomonas flagella. I. Isolation and electrophoretic analysis of microtubules, matrix, membranes, and mastigonemes. J. Cell Biol 54, 507–539.
This article has been cited by other articles:
![]() |
D. Wloga, D. Dave, J. Meagley, K. Rogowski, M. Jerka-Dziadosz, and J. Gaertig Hyperglutamylation of Tubulin Can either Stabilize or Destabilize Microtubules in the Same Cell Eukaryot. Cell, January 1, 2010; 9(1): 184 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dave, D. Wloga, N. Sharma, and J. Gaertig DYF-1 Is Required for Assembly of the Axoneme in Tetrahymena thermophila Eukaryot. Cell, September 1, 2009; 8(9): 1397 - 1406. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Jenkins, D. P. McEwen, and J. R. Martens Olfactory Cilia: Linking Sensory Cilia Function and Human Disease Chem Senses, June 1, 2009; 34(5): 451 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kubo, A. Yuba-Kubo, S. Tsukita, S. Tsukita, and M. Amagai Sentan: A Novel Specific Component of the Apical Structure of Vertebrate Motile Cilia Mol. Biol. Cell, December 1, 2008; 19(12): 5338 - 5346. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Schneider, M. Ulland, and R. D. Sloboda A Protein Methylation Pathway in Chlamydomonas Flagella Is Active during Flagellar Resorption Mol. Biol. Cell, October 1, 2008; 19(10): 4319 - 4327. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wloga, K. Rogowski, N. Sharma, J. Van Dijk, C. Janke, B. Edde, M.-H. Bre, N. Levilliers, V. Redeker, J. Duan, et al. Glutamylation on {alpha}-Tubulin Is Not Essential but Affects the Assembly and Functions of a Subset of Microtubules in Tetrahymena thermophila Eukaryot. Cell, August 1, 2008; 7(8): 1362 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Jauregui, K. C.Q. Nguyen, D. H. Hall, and M. M. Barr The Caenorhabditis elegans nephrocystins act as global modifiers of cilium structure J. Cell Biol., March 5, 2008; 180(5): 973 - 988. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Scholey Intraflagellar transport motors in cilia: moving along the cell's antenna J. Cell Biol., January 10, 2008; 180(1): 23 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. F. Marshall The cell biological basis of ciliary disease J. Cell Biol., January 10, 2008; 180(1): 17 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Sloboda and J. L. Rosenbaum Making sense of cilia and flagella J. Cell Biol., November 20, 2007; 179(4): 575 - 582. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||