![]() |
|
|
Vol. 18, Issue 12, 4762-4771, December 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


*Institute of Medical Science and
Department of Medicine, University of Toronto, Toronto, ON, Canada, M5S 1A8; and
Program in Cell Biology, Hospital for Sick Children, Toronto, ON, Canada, M5G 2C4
Submitted November 6, 2006;
Revised September 5, 2007;
Accepted September 11, 2007
Monitoring Editor: Jennifer Lippincott-Schwartz
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Constitutive secretion is governed by a defined set of Rab GTPases. Endoplasmic reticulum (ER)-to-Golgi transport requires Rab1 and Rab2 (Tisdale et al., 1992
; Allan et al., 2000
), Rab6 has been linked with intra-Golgi transport (Echard et al., 2000
), and transport from the trans-Golgi network (TGN) to the plasma membrane has been shown to involve Rab8 and Rab11 (Huber et al., 1993
; Chen et al., 1998
). This list, however, is not exhaustive, and whether other Rab proteins and their effectors are involved in constitutive secretion remains to be seen.
Little has been written about Golgi-bound rab, Rab34. Two effectors of Rab34 have been identified: the Rab-interacting lysosomal protein (RILP), which links Rab34 to dynein microtubule motors (Wang and Hong, 2002
), and hmunc13, a protein kinase C superfamily member, which has been implicated in the induction of apoptosis at the Golgi in response to phorbol ester treatment (Speight and Silverman, 2005
). By transfecting cell lines with constitutively active or dominant-negative forms of Rab34, Rab34 has been implicated in fluid-phase uptake of proteins at membrane ruffles via macropinocytosis (Sun et al., 2003
) and in the shifting of lysosomes toward the microtubule organizing center (MTOC; Wang and Hong, 2002
).
To clarify the role of Rab34 in mammalian cells, we have used transiently transfected HeLa cells as a model system. Using green fluorescent protein (GFP) fusions of wild-type (wt-GFP-Rab34), constitutively active (CA-GFP-Rab34), or dominant-negative Rab34 (DN-GFP-Rab34), we have re-examined the existing literature pertaining to Rab34 and investigated new functional roles for Rab34 in HeLa cells. Because Rab34 is localized to the Golgi in our system, we sought to investigate Rab34 function in the context of this organelle. To this end, we used RNA interference (RNAi) to knock down Rab34 expression in HeLa cells. Using this assay, as well as the CA and DN Rab34 constructs used in the studies mentioned above, we re-evaluated the functions of Rab34 that have been described in the literature and examined the role of Rab34 in the secretory pathway. In our system, we are unable to observe any enrichment of Rab34 at membrane ruffles or any effect of Rab34 on fluid-phase uptake. Active Rab34, however, did cause lysosomes to shift to a juxtanuclear position, consistent with a previous report. The mechanism and functional implications of this phenotype are unclear, but we have determined that trafficking of the mannose 6-phosphate receptor (M6PR) is unaffected by Rab34. More strikingly, our data indicate that Rab34 is confined to the Golgi, where it is required for the exit of transport carriers traversing the secretory pathway. Our data show specifically that Rab34 is required for exit of vesicular stomatitis virus G-protein (VSVG)-GFP from the Golgi stack, upstream of the trans-Golgi network (TGN). This site of action places Rab34 upstream of several other known players in the secretory pathway, including protein kinase D (PKD) and phosphatidylinositol 4-phosphate (PI4P; Liljedahl et al., 2001
; Hausser et al., 2005
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids and Small Interfering RNA
Wild-type Rab34 fused to the C-terminal of GFP (wt-GFP-Rab34) was constructed using Gateway Technology (Invitrogen, Carlsbad, CA) with pcDNA-DEST40-Rab34wt (described in Speight and Silverman, 2005
) as donor, and pcDNA6.2/N-EmGFP-DEST as the destination vector. Both the CA GTP-restricted, Q111L mutant and the DN GDP-restricted, T66N mutants were fused to GFP using the same method (CA-GFP-Rab34 and DN-GFP-Rab34, respectively). The pEGFPdKA206K-N1-VSVG tsO45 vector encoding VSVG-GFP and pEGFPdKA206K-N1-mCherry (VSVG-Cherry) were generous gifts from Dr. J. Lippincott-Schwartz (NIH, Bethesda, MD). Plasmids encoding the tail of H-Ras fused to red fluorescent protein (RFP; HRas-tail-RFP), the PH domain of phospholipase c-delta (PLC
-PH-RFP), or GPI-linked RFP (GPI-RFP) have been described previously (Varnai and Balla, 1998
; Choy et al., 1999
; Keller, 2001
). Stealth small interfering RNA (siRNA) directed against human Rab34 and appropriate scrambled control siRNA were synthesized by Invitrogen. siRNA targeting Rab34 was the following annealed duplex: 5'AAUCGUUCCAUCUCGAAGUCCACUC3' and 5'GAGUGGACUUCGAGAUGGAACGAUU3'.
Cell Culture and Transfection
HeLa cells were grown in MEM plus 10% fetal bovine serum and maintained at 37°C in 5% CO2. Transfection of siRNA was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. Plasmid DNA was transfected using FuGene 6 Reagent (Roche, Indianapolis, IN) according to the manufacturer's directions, using a DNA:FuGene ratio of 3:1.
Cryo-Electron Microscopy
HeLa cells were grown in 10-cm dishes and transfected with GFP-Rab34-wt. Twenty-four hours after transfection, cells were washed in phosphate-buffered saline (PBS) and fixed in 4% followed by 8% paraformaldehyde. Cells were then washed in 0.15 M glycine, followed by 1% gelatin in PBS. Cells were scraped, pelleted, and resuspended in 12% gelatin. The cells were then pelleted again and cooled to allow the gelatin to set. The pellets were cut into 1-mm3 pieces and put in 2.3 M sucrose in PBS at 4°C overnight. The sucrose pieces were put on metal pins, frozen in liquid nitrogen, and sectioned at –120°C at a thickness of 75 nm. Sections were picked up in a 1:1 mixture of 2% methyl cellulose and 2.3 M sucrose and transferred to formvar-coated nickel grids. For immunostaining, sections were blocked in 5% fish skin gelatin and then incubated for 30 min in anti-GFP. Sections were washed and incubated with protein A-Gold, then washed, and fixed in 1% glutaraldehyde. Phosphate was removed in water, and the sections were stained in methylcellulose and uranyl acetate on ice.
Immunoblotting
Cells were lysed in 1% NP-40, and protein concentration in lysates was determined using a Lowry assay (Bio-Rad, Richmond, CA). Fifty micrograms of protein was run on a 10% polyacrylamide gel. After transfer to nitrocellulose, filters were blocked in 5% nonfat dry milk powder in 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.05% Tween 20 (TBST) overnight at 4°C. Primary and secondary antibodies were diluted in blocking buffer, and incubations were for 1 h at room temperature. Detection was performed using an ECL Advance Western Blotting Detection Kit (Amersham Biosciences).
Membrane Ruffling and Dextran Uptake
HeLa cells were cotransfected with wt-GFP-Rab34 and either HRas-tail-RFP or PLC
-PH-RFP. After 24 h, membrane ruffling was induced by treatment with 100 nM TPA for 10 min in HEPES-buffered MEM, and the cells were imaged live using a spinning disk confocal microscope (Leica, Deerfield, IL), and the fluorescence intensity of GFP both at a ruffle and nonruffle, as well as for RFP at a ruffle and nonruffle was measured using ImageJ (NIH). The ratio of ruffle to nonruffle fluorescence for GFP was divided by the ratio of ruffle to nonruffle fluorescence for RFP to determine whether or not Rab34 was specifically enriched at membrane ruffles.
To measure dextran uptake, HeLa cells transfected with GFP-Rab34 vectors or with GFP alone were exposed to 200 µg/ml Alexa-647 Dextran for 10 min. Cells were then rinsed in ice-cold PBS, trypsinized, and analyzed by fluorescence-activated cell sorting (FACS). Transfected cells (n = 10,000) were counted for each experimental condition. Data were analyzed using FlowJo (Tree Star, Ashland, OR), and Alexa-647-dextran fluorescence was expressed as a percent of Alexa-647 fluorescence in cells transfected with GFP alone.
Lysosomal Positioning Assay
HeLa cells were transfected with Rab34 vectors and imaged 24 h after transfection. Cells were serum starved for 2 h and then were fixed in 3.7% paraformaldehyde, permeabilized in 0.2% Triton X-100, and blocked in 10% fat-free milk. Fixed cells were stained using anti-LAMP-1 antibody and Cy3-conjugated secondary antibody. Cells were visualized by confocal microscopy. Analysis was performed using the Radial Plot function in ImageJ (NIH). Rab34–expressing cells were identified by GFP fluorescence; using Radial Plot, concentric circles were drawn from the cell center to the cell boundary, and integrated LAMP-1 fluorescence intensities were recorded for the area along each circle. To normalize for cell size and fluorescence, the data were binned into the inner, middle, and outer thirds of each cell and expressed as a percent of total LAMP-1 fluorescence.
DN and CA Rab34 Assays
HeLa cells plated on glass coverslips in 12-well plates were transfected with one of wt-GFP-Rab34, CA-GFP-Rab34, or DN-GFP-Rab34. For M6PR experiments, cells were fixed in 3.7% paraformaldehyde 24 h after transfection, permeabilized, and stained with anti-M6PR and anti-mouse Cy3. Cells were mounted and imaged using a spinning disk confocal microscope (Leica). For VSVG-Cherry experiments, cells were cotransfected with GFP-Rab34 or its mutants, as well as VSVG-Cherry at 40°C as described below.
VSVG-GFP Secretion Assay
HeLa cells were plated on glass coverslips in 12-well plates. The following day, cells were transfected with either scrambled small interfering RNA (siRNA) or siRNA directed against Rab34 and incubated for 48 h. After this, cells were transfected with VSVG-GFP and incubated at 40°C for a further 20 h. All subsequent incubations were done in the presence of 50 µg/ml cycloheximide (Sigma) to halt protein synthesis. For time t = 0, cells were rinsed in ice-cold PBS before fixation. Remaining cells were returned to an incubator at 32°C for the indicated time. After incubation, cells were rinsed in ice-cold PBS and fixed in 3.7% paraformaldehyde. For treatment with WGA, cells were incubated with 0.01 mg/ml WGA on ice for 10 min. For GM130 staining, cells were permeabilized with 0.2% Triton X-100 and stained using anti-GM130, followed by a Cy3-anti-mouse antibody. Cells were mounted on slides and imaged using a Zeiss LSM 510 confocal microscope (Thornwood, NY). Image analysis was performed using Volocity (Improvision, Lexington, MA).
Endoglycosidase H Assay
HeLa cells were plated in 60-mm dishes, transfected with either scrambled siRNA or siRNA against Rab34, and incubated for 72 h. Metabolic labeling, immunoprecipitation and endoglycosidase H (EndoH) digestion were performed as described (Kim et al., 1996
). Briefly, cells were incubated for 30 min in RPMI lacking methionine. Metabolic labeling was performed using 150 µCi of [35S]methionine per plate for 10 min. Chase incubations were done in RPMI supplemented with methionine for the indicated times. After chase, cells were rinsed in ice-cold PBS and lysed in buffer containing NP40. For immunoprecipitation of major histocompatibility complex (MHC) class I molecules, each lysate was incubated in anti-MHC class I antibody W6/32, followed by protein A-Sepharose. After washing, lysates were split, and some were incubated with endoH (New England Biolabs, Beverly, MA) for 3 h at 37°C. Samples were then run on 10% polyacrylamide gels.
| RESULTS |
|---|
|
|
|---|
|
In an effort to examine a potential role for Rab34 in membrane ruffling in HeLa cells, we coexpressed wt-GFP-Rab34 with the tail of H-Ras fused to RFP (HRas-Tail-RFP). HRas-Tail-RFP inserts into the plasma membrane by three palmitate moieties and is therefore a consistent marker for the plasma membrane (Roy et al., 2005
). These cells were then treated with 100 nm TPA for 10 min to induce membrane ruffling, and live cells were subsequently analyzed by spinning disk confocal microscopy (Figure 2). For each of the GFP and RFP channels, a ratio of fluorescence intensity was taken at a membrane ruffle (Figure 2, arrowheads) and compared with an area of the plasma membrane that has not undergone ruffling (Figure 2, arrows). The Rab34 ratio was then divided by the HRas-Tail ratio to correct for membrane density changes at the membrane ruffle. If Rab34 is truly recruited to membrane ruffles, this ratio should be greater than 1. In our HeLa cell system, we found that Rab34 is not recruited to membrane ruffles, because the ratio of Rab34 signals to HRas-Tail signals was 0.98, which was not significantly different from 1 (p > 0.5, n = 20). To further demonstrate the lack of Rab34 recruitment to membrane ruffles, this experiment was repeated with another membrane marker. This time, the pleckstrin-homology domain of phospholipase c-delta fused to RFP (PLC
-PH-RFP), which binds phosphoinositides in the plasma membrane (Stauffer et al., 1998
), was coexpressed with wt-Rab34-GFP, and the same assay and quantification was performed as described above. Similar to what was observed with HRas-Tail, the ratio of Rab34 to PLC
-PH-RFP was not found to differ significantly from 1, strongly supporting the observation that Rab34 is not concentrated at sites of membrane ruffling in HeLa cells (ratio = 1.10, p > 0.3, n = 20; data not shown).
|
Rab34 Regulates Lysosomal Position, But Does Not Affect the Localization of the Mannose 6-Phosphate Receptor
The other phenotype previously associated with active Rab34 was its ability to shift lysosomes toward the MTOC via its association with RILP and the dynein/dynactin system (Wang and Hong, 2002
). To test this phenomenon in our HeLa cell system, HeLa cells were transfected with either CA-GFP-Rab34 or DN-GFP-Rab34, fixed, and stained with an anti-LAMP-1 antibody to visualize lysosomes. To quantitate lysosomal position relative to the nucleus, we used a system of concentric circles drawn from the cell center, as described in Materials and Methods (Figure 3). Lysosomal position was then calculated as the percent of LAMP-1 fluorescence in a given cell within either the inner, middle, or outer third of the cell itself. We found that CA-GFP-Rab34 caused a significant shift of LAMP-1 fluorescence to the inner third of the cell as compared with DN-GFP-Rab34: 63% of the LAMP-1 fluorescence was found in the inner third of cells transfected with CA-GFP-Rab34 versus 35% for DN-GFP-Rab34 (p < 0.01). This finding suggests that the work of Wang and Hong (2002)
in Normal Rat Kidney cells can be generalized into our HeLa cell system.
|
Rab34 Is Required for Secretion of VSVG-GFP at the Golgi
Because Rab34 is localized to the Golgi, we wanted to test whether Rab34 may be involved in the secretory pathway. As a reporter for constitutive secretion, we used the ts045 temperature-sensitive mutant of the VSV glycoprotein fused to one of GFP (VSVG-GFP), or monomeric Cherry (VSVG-Cherry). The temperature-sensitive mutant is retained in the ER at 40°C, and is released into the secretory pathway upon temperature shift to 32°C. To study the potential role of Rab34 in the secretory pathway, HeLa cells were either transfected with VSVG-Cherry alone, or cotransfected with VSVG-Cherry, and one of wt-GFP-Rab34, CA-GFP-Rab34, or DN-GFP-Rab34 at 40°C. The following day, protein synthesis was inhibited with cycloheximide, and at t = 0 the cells were shifted to the permissive temperature of 32°C for various times. In cells expressing VSVG-Cherry alone or in combination with wt-GFP-Rab34, the VSVG protein was found in the ER at t = 0, predominantly at the Golgi at t = 30 min, with a small amount of protein still in the ER, and entirely at the plasma membrane at t = 180 min (Figure 4). Only a very small number of cells coexpressing VSV-Cherry and wt-GFP-Rab34 exhibited a delay of VSVG-Cherry transport to the plasma membrane. In contrast, HeLa cells expressing DN-GFP-Rab34 exhibited a marked decrease in VSVG-Cherry transport from the Golgi to the plasma membrane (Figure 4). Only 16.7% of cells expressing DN-GFP-Rab34 had transported all VSVG-Cherry to the plasma membrane, compared with 83% of cells expressing wt-GFP-Rab34, or 85% of cells expressing VSVG-Cherry alone (p < 0.001; Figure 4B). These results strongly suggest that Rab34 is required for secretion of VSVG-Cherry from the Golgi. Cells expressing CA-GFP-Rab34 also exhibited limited inhibition of VSVG-Cherry secretion to the plasma membrane, with 56.7% of cells completely transporting VSVG to the cell surface (Figure 4B). The effect of CA-GFP-Rab34 on VSVG-Cherry secretion suggests that there is a requirement for Rab34 to maintain the ability to cycle between the GTP- and GDP-bound states for normal trafficking of VSVG-Cherry to the plasma membrane. This phenomenon has been observed for other small GTPases as well, including Rac and Arf6 (Arrieumerlou et al., 2000
; Klein et al., 2006
).
|
To further define the precise site of action of Rab34, we performed a time course experiment along with quantitative colocalization of VSVG-GFP and either the Golgi or the plasma membrane. To this end, HeLa cells transfected with control siRNA or siRNA against Rab34 were transfected with VSVG-GFP and followed at the permissive temperature for either 0, 30, or 180 min. At each time point, cells were fixed and either immunostained for the Golgi with an anti-GM130 antibody or stained for the plasma membrane with rhodamine-conjugated WGA. Immediately after a temperature shift to 32°C, all VSVG-GFP was found in the ER in both control and knockdown cells, and after 30 min, the majority of VSVG-GFP had traveled to the Golgi (Figure 5A, i–iv and vii–x). In control cells, at 180 min after temperature shift, virtually all VSVG-GFP was found at the plasma membrane (Figure 5Av). In contrast, in cells depleted of Rab34, very little VSVG-GFP was found at the plasma membrane, and the majority of the protein was retained in the Golgi (Figure 5A, compare v and vi). At 180 min after temperature shift, Pearson's coefficients for VSVG-GFP and WGA for control cells and knockdown cells of 0.82 and 0.44, respectively, show that although the majority of VSVG-GFP in control cells colocalized with the plasma membrane, much less of the GFP signal colocalized with WGA in cells depleted of endogenous Rab34 (p < 0.001; Figure 5B). Furthermore, although in control cells very little GFP signal was seen colocalizing with GM130 at the Golgi (Pearson's coefficient of 0.16), a significant amount of GFP signal remains in the Golgi in cells depleted of Rab34 3 h after release from the ER (Pearson's coefficient of 0.47, p < 0.001; Figure 5, C and B, compare xi and xii). The large increase in Pearson's coefficients from 0 to 30 min after temperature shift shows that VSVG-GFP is efficiently transported to the Golgi in both control and knockdown cells (for example, Pearson's coefficient for GFP and GM130 increases from 0.23 to 0.73, and from 0.29 to 0.78 in control and knockdown cells, respectively). Because Pearson's coefficients for 0 and 30 min time points do not differ significantly between control cells and those lacking Rab34, it appears that ER-to-Golgi transport is not affected by Rab34 knockdown, suggesting that Rab34 functions at a post-Golgi step in the secretory pathway. The small proportion of VSVG-GFP that is still transported to the plasma membrane in knockdown cells is probably due to either incomplete knockdown of Rab34 in these cells or to the existence of both Rab34-dependent and -independent pathways from the Golgi to the plasma membrane.
|
|
Rab34 Is Not Involved in ER-to-Golgi Transport
Although confocal microscopy suggested that Rab34 was not involved in the transport of proteins from the ER to the Golgi, we sought to examine this step of the secretory pathway biochemically using endogenous MHC class I protein as a reporter. HeLa cells transfected with either scrambled siRNA or siRNA targeting Rab34 were metabolically labeled with a pulse of [35S]methionine, and then chased with cold methionine for 0–60 min. Total MHC class I was immunoprecipitated from cell lysates and subsequently digested with endoH. EndoH cleaves N-linked oligosaccharides on proteins in the ER, but cannot cleave the high-mannose oligosaccharides found on proteins that have progressed to the medial Golgi (Orlean et al., 1991
). Thus, proteins in the ER are endoH sensitive, and proteins that have progressed to the Golgi are endoH resistant. This difference can be seen as a mobility shift on a polyacrylamide gel. As seen by the rates of acquisition of endoH resistance by endogenous MHC class I protein, depletion of endogenous Rab34 has no effect on ER-to-Golgi transport in HeLa cells (Supplementary Figure S1). Taken with the VSVG-GFP secretion data, these results show that Rab34 specifically functions at a post-Golgi step of the secretory pathway. Further, because EndoH resistance is acquired in the medial Golgi, Rab34 must function at a transport step at or beyond the medial Golgi.
| DISCUSSION |
|---|
|
|
|---|
From the Golgi, our data demonstrate two roles for Rab34, which need not be completely independent of one another. First, we found that active Rab34 is capable of shifting lysosomes to the juxtanuclear region, which is consistent with published literature (Wang and Hong, 2002
). Our finding with the greatest functional significance, however, is that Rab34 is required for the intra-Golgi transport of the model protein cargo, VSVG-GFP, as it traverses the secretory pathway. Using three separate methods—namely siRNA, dominant-negative Rab34, and rescue of the siRNA-mediated defect—we have shown that Rab34 is a novel member of the secretory pathway. HeLa cells depleted of Rab34 by RNAi or dominant-negative Rab34 expression exhibited a marked decrease in transport of VSVG-GFP from the Golgi to the plasma membrane. The defect seen in siRNA-transfected cells can be rescued by expression of mouse Rab34, indicating that this phenomenon is specifically due to Rab34 depletion. This result establishes Rab34 as an essential player in a ubiquitous cellular function.
Both fluorescence microscopy of VSVG-GFP transport and rates of acquisition of endoH resistance of endogenous MHC showed that secretory transport from the ER to the medial Golgi remains intact in the absence of Rab34, because the medial Golgi is the site of high mannose glycosylation of transmembrane proteins (Orlean et al., 1991
). This result, in combination with those described above, shows that Rab34 acts either within or immediately after the Golgi stack.
Because Rab34 is involved in intra-Golgi protein transport, one would expect that an effect would be seen on both the trafficking of VSVG and the trafficking of the M6PR, because this transport step is upstream of TGN sorting. Because no clear effect was seen on the steady-state distribution of the M6PR, two possibilities exist. One is that the effect on the M6PR is subtler than the effect on VSVG. Our data in Figure 4D may provide clues that although a gross change in M6PR distribution is not occurring, a smaller-scale change in M6PR trafficking may be present in HeLa cells transfected with Rab34 mutants. Further work involving dynamic measurements of M6PR trafficking to the endosomal system in the presence of Rab34 mutants and compartmental markers is required in order to elucidate a potential function for Rab34 in this pathway. A second possibility is that Rab34 exhibits cargo selectivity within the Golgi. Although this may be an intriguing possibility, much more work needs to be done to attempt to define a mechanism by which this could occur.
Although our data support the finding that Rab34 is capable of moving lysosomes toward the MTOC, the functional implications of lysosomal position remain unknown. From the Golgi, at least two pathways for vesicle traffic depart—the classic secretory pathway to the plasma membrane, for which we have shown Rab34 to be necessary, and another pathway to the late endosome/lysosome. This second pathway is necessary for the delivery of acid hydrolases to the maturing lysosome (Ghosh et al., 2003
). Because Rab34 appears to be involved in the transport of proteins through the Golgi along the secretory pathway, it is tempting to hypothesize that it is also involved in trafficking to the lysosome and that increased Golgi-to-lysosome traffic by active Rab34 may be occurring while lysosomes shift toward the Golgi. However, as discussed above, dominant-negative and CA Rab34 did not grossly affect the localization of the M6PR in HeLa cells, although a more subtle effect could not be ruled out. Thus, the significance of the phenotype characterized by Rab34 induced movement of lysosomes toward the MTOC remains to be determined.
Although the mechanism by which Rab34 affects lysosomal position has been shown to require interaction with RILP, which links Rab34 to the dynein/dynactin microtubule motor system (Wang and Hong, 2002
), the mechanism by which Rab34 effects secretion from the Golgi is less clear. To date, only two effectors have been identified for Rab34—RILP, and hmunc13, which is a well-described PKC superfamily member that is involved in both vesicle priming and the induction of apoptosis at the Golgi in response to phorbol ester treatment (Augustin et al., 1999
; Song et al., 1999
). To determine the mechanism of Rab34 function in constitutive secretion, we first sought to define the precise site of action of Rab34 in the secretory pathway. BFA treatment revealed that Rab34 depletion arrests VSVG-GFP transport within the Golgi itself, not at the TGN. This result mechanistically separates the function of Rab34 from that of known mediators of TGN exit.
The exit of proteins from the TGN has been reported to involve PKD, as well as Golgi-resident sphingolipids and PI4P (Rosenwald et al., 1992
; Echard et al., 2000
; Liljedahl et al., 2001
; Hausser, 2005
). Dominant-negative PKD inhibits the fission of transport carriers from the TGN, and its expression results in extensive tubulation of the TGN, indicative of a release failure of these extending tubules from the TGN (Liljedahl et al., 2001
). Although it is known that Golgi-resident diacylglycerol is responsible for the recruitment of PKD to the Golgi, the molecular mechanism of PKD-mediated transport carrier fission has not been completely defined (Baron and Malhotra, 2002
). It is known, however, that PKD can activate phosphatidylinositol 4-kinase III-β, resulting in an increase in TGN PI4P, which is in turn required for vesicle fission (Hausser, 2005
). It has also been shown that inhibition of de novo sphingolipid synthesis inhibits VSVG transport along the secretory pathway (Rosenwald et al., 1992
). The importance of sphingolipids in this process is not known, but the Golgi is a key store of ceramide and sphingolipids (Rosenwald et al., 1992
). Our work establishes that Rab34 functions upstream of these components of the secretory pathway.
Rab6A is involved in transport of VSVG through the Golgi itself (Echard et al., 2000
). Interestingly, it is CA Rab6A, not DN Rab6A, that inhibits secretion through the Golgi. This sets up an intriguing possibility whereby Rab6A and Rab34 may act in opposition to one another, because active Rab6A or loss of Rab34 inhibit secretion. It is possible that these two inputs could allow the cell to control constitutive secretion at the Golgi in response to various stimuli. Future experiments will seek to define the precise molecular events of Rab34-mediated transport, as well as defining cellular regulators of Rab34 activity.
Finally, it is interesting to examine our results in the light of the findings by Wang and Hong (2002)
showing that Rab34 regulates lysosomal positioning from the Golgi. Their data describe a pathway whereby Rab7-positive lysosomes migrate along microtubules to the peri-Golgi region via an association between Rab7, RILP, and Golgi-bound Rab34 (Wang and Hong, 2002
). This region appears to be particularly active, housing the Golgi, TGN, recycling endosomes, lysosomes, and various other components of the endomembrane system. In addition, at this same location within the cell, our lab has previously shown that hmunc13 interacts with GTP-bound Rab34 via its second munc homology domain (Speight and Silverman, 2005
). Although it is premature to indulge in significant speculation at this point, it seems possible that a situation exists whereby regulated formation of a molecular platform occurs involving protein interactions between Rab34, Rab7, RILP, hmunc13, and probably as yet other unidentified proteins.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Mel Silverman (melvin.silverman{at}utoronto.ca).
Abbreviations used: BFA, brefeldin A; CA-GFP-Rab34, GFP-tagged constitutively active Rab34; DN-GFP-Rab34, GFP-tagged dominant-negative Rab34; EndoH, endoglycosidase H; GFP, green fluorescent protein; HRas-Tail-RFP, RFP-tagged tail of H-Ras; MHC, major histocompatibility complex; M6PR, mannose 6-phosphate receptor; PI4P, phosphoinositol 4-phosphate; PKD, protein kinase D; RFP, red fluorescent protein; TGN, trans-Golgi network; TPA, 2-O-tetradecanoyl-phorbol 13-acetate; VSVG, vesicular stomatitis virus G protein; WGA, wheat germ agglutinin; wt-GFP-Rab34, GFP-tagged wild-type Rab34.
| REFERENCES |
|---|
|
|
|---|
Arrieumerlou, C., Randriamampita, C., Bismuth, G., and Trautmann, A. (2000). Rac is involved in early TCR signaling. J. Immunol 165, 3182–3189.
Augustin, I., Rosenmund, C., Sudhof, T. C., and Brose, N. (1999). Munc13-1 is essential for fusion competence of glutamatergic synaptic vesicles. Nature 400, 457–461.[CrossRef][Medline]
Baron, C. L., and Malhotra, V. (2002). Role of diacylglycerol in PKD recruitment to the TGN and protein transport to the plasma membrane. Science 295, 325–328.
Chege, N. W., and Pfeffer, S. R. (1990). Compartmentation of the Golgi complex: brefeldin-A distinguishes trans-Golgi cisternae from the trans-Golgi network. J. Cell Biol 111, 893–899.
Chen, W., Feng, Y., Chen, D., and Wandinger-Ness, A. (1998). Rab11 is required for trans-Golgi network-to-plasma membrane transport and a preferential target for GDP dissociation inhibitor. Mol. Biol. Cell 9, 3241–3257.
Choy, E., Chiu, V. K., Silletti, J., Feoktistov, M., Morimoto, T., Michaelson, D., Ivanov, I. E., and Philips, M. R. (1999). Endomembrane trafficking of ras: the CAAX motif targets proteins to the ER and Golgi. Cell 98, 69–80.[CrossRef][Medline]
De Matteisa, M. A., Lunab, A., Di Tullioa, G., Cordaa, D., Kokc, J. W., Luinia, A., and Egeab, G. (1999). PDMP blocks the BFA-induced ADP-ribosylation of BARS-50 in isolated Golgi membranes. FEBS Lett 459, 310–312.[CrossRef][Medline]
Echard, A., Opdam, F.J.M., de Leeuw, H.J.P.C., Jollivet, F., Savelkoul, P., Hendriks, W., Voorberg, J., Goud, B., and Fransen, J.A.M. (2000). Alternative splicing of the human Rab6A gene generates two close but functionally different isoforms. Mol. Biol. Cell 11, 3819–3833.
Ghosh, P., Dahms, N. M., and Kornfeld, S. (2003). Mannose 6-phosphate receptors: new twists in the tale. Nat. Rev. Mol. Cell Biol 4, 202–212.[CrossRef][Medline]
Grosshans, B. L., Ortiz, D., and Novick, P. (2006). Rabs and their effectors: achieving specificity in membrane traffic. Proc. Natl. Acad. Sci. USA 103, 11821–11827.
Hausser, A., S. P., Martens, S., Link, G., Toker, A., and Pfizenmaier, K. (2005). Protein kinase D regulates vesicular transport by phosphorylating and activating phosphatidylinositol-4 kinase IIIbeta at the Golgi complex. Nat. Cell Biol 7, 851–853.[CrossRef][Medline]
Huber, L. A., Pimplikar, S., Parton, R. G., Virta, H., Zerial, M., and Simons, K. (1993). Rab8, a small GTPase involved in vesicular traffic between the TGN and the basolateral plasma membrane. J. Cell Biol 123, 35–45.
Keller, P., T. D., Diaz, E., White, J., and Simons, K. (2001). Multicolour imaging of post-Golgi sorting and trafficking in live cells. Nat. Cell Biol 3, 140–149.[CrossRef][Medline]
Kim, J. H., Lingwood, C. A., Williams, D. B., Furuya, W., Manolson, M. F., and Grinstein, S. (1996). Dynamic measurement of the pH of the Golgi complex in living cells using retrograde transport of the verotoxin receptor. J. Cell Biol 134, 1387–1399.
Klein, S., Franco, M., Chardin, P., and Luton, F. (2006). Role of the Arf6 GDP/GTP cycle and Arf6 GTPase-activating proteins in actin remodeling and intracellular transport. J. Biol. Chem 281, 12352–12361.
Kurokawa, K., and Matsuda, M. (2005). Localized RhoA activation as a requirement for the induction of membrane ruffling. Mol. Biol. Cell 16, 4294–4303.
Liljedahl, M., Maeda, Y., Colanzi, A., Ayala, I., Van Lint, J., and Malhotra, V. (2001). Protein kinase D regulates the fission of cell surface destined transport carriers from the trans-Golgi network. Cell 104, 409–420.[CrossRef][Medline]
Lippincott-Schwartz, J., Donaldson, J. G., Schweizer, A., Berger, E. G., Hauri, H. P., Yuan, L. C., and Klausner, R. D. (1990). Microtubule-dependent retrograde transport of proteins into the ER in the presence of brefeldin A suggests an ER recycling pathway. Cell 60, 821–836.[CrossRef][Medline]
Orlean, P., Kuranda, M. J., and Albright, C. F. (1991). Analysis of glycoproteins from Saccharomyces cerevisiae. Methods Enzymol 194, 682–697.[Medline]
Rosenwald, A. G., Machamer, C. E., and Pagano, R. E. (1992). Effects of a sphingolipid synthesis inhibitor on membrane transport through the secretory pathway. Biochemistry 31, 3581–3590.[CrossRef][Medline]
Roy, S., Plowman, S., Rotblat, B., Prior, I. A., Muncke, C., Grainger, S., Parton, R. G., Henis, Y. I., Kloog, Y., and Hancock, J. F. (2005). Individual palmitoyl residues serve distinct roles in H-ras trafficking, microlocalization, and signaling. Mol. Cell. Biol 25, 6722–6733.
Song, Y., Ailenberg, M., and Silverman, M. (1999). Human munc13 is a diacylglycerol receptor that induces apoptosis and may contribute to renal cell injury in hyperglycemia. Mol. Biol. Cell 10, 1609–1619.
Speight, P., and Silverman, M. (2005). Diacylglycerol-activated Hmunc13 serves as an effector of the GTPase Rab34. Traffic 6, 858–865.[CrossRef][Medline]
Stauffer, T. P., Ahn, S., and Meyer, T. (1998). Receptor-induced transient reduction in plasma membrane PtdIns(4,5)P2 concentration monitored in living cells. Curr. Biol 8, 343–346.[CrossRef][Medline]
Sun, P., Yamamoto, H., Suetsugu, S., Miki, H., Takenawa, T., and Endo, T. (2003). Small GTPase Rah/Rab34 is associated with membrane ruffles and macropinosomes and promotes macropinosome formation. J. Biol. Chem 278, 4063–4071.
Tisdale, E. J., Bourne, J. R., Khosravi-Far, R., Der, C. J., and Balch, W. E. (1992). GTP-binding mutants of rab1 and rab2 are potent inhibitors of vesicular transport from the endoplasmic reticulum to the Golgi complex. J. Cell Biol 119, 749–761.
Varnai, P., and Balla, T. (1998). Visualization of phosphoinositides that bind pleckstrin homology domains: calcium- and agonist-induced dynamic changes and relationship to myo-[3H]inositol-labeled phosphoinositide pools. J. Cell Biol 143, 501–510.
Wang, T., and Hong, W. (2002). Interorganellar regulation of lysosome positioning by the Golgi apparatus through Rab34 interaction with Rab-interacting lysosomal protein. Mol. Biol. Cell 13, 4317–4332.
Zerial, M., and McBride, H. (2001). Rab proteins as membrane organizers. Nat. Rev. Mol. Cell Biol 2, 107–117.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. K. Johannsdottir, R. Mancini, J. Kartenbeck, L. Amato, and A. Helenius Host Cell Factors and Functions Involved in Vesicular Stomatitis Virus Entry J. Virol., January 1, 2009; 83(1): 440 - 453. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||