![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 18, Issue 12, 4780-4793, December 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Centre National de la Recherche Scientifique, Unité Mixte de Recherche 144, Paris 75248, France; Institut Curie, Centre de Recherche, Paris 75248, France; Hybrigenics, 75014 Paris, France; and Centre National de la Recherche Scientifique, Centre de Recherche de Biochimie Macromoléculaire, 34293 Montpellier Cedex 5, France
Submitted December 22, 2006;
Revised July 18, 2006;
Accepted September 11, 2007
Monitoring Editor: Martin A. Schwartz
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 1995). Recent genetic analyses revealed that ezrin is essential for the morphogenesis of epithelial cells (Fiévet et al., 2007). In ezrin–/– mice, morphological defects in the apical domain of intestinal and retinal pigment epithelial cells have been observed (Saotome et al., 2004; Bonilha et al., 2006). In parietal cells, ezrin knockdown impairs the formation of canalicular apical membrane, resulting in severe achlorhydria (Tamura et al., 2005).
How ezrin participates in the assembly of the apical actin-rich structures such as microvilli is still poorly understood. The association of ezrin and the highly related proteins radixin and moesin with the cortical actin cytoskeleton is strictly regulated. ERM (ezrin, radixin, moesin) proteins contain a conserved globular N-terminal domain, called the FERM domain (Four point one ezrin, radixin, moesin), involved in the binding to both phosphatidylinositol 4,5 bisphosphate (PIP2; Barret et al., 2000) and plasma membrane proteins and a C-terminal F-actin–binding domain that resides in the last 34 amino acids (Turunen et al., 1994; Bretscher et al., 2002). In the cytoplasm, ERM proteins exist in a closed conformation because of an intramolecular interaction between the N-terminal domain and the last 100 amino acids called N- and C-ERMAD (ERM association domain), respectively (Gary and Bretscher, 1995). This intramolecular association masks the binding sites for plasma membrane proteins and F-actin. An activation step is required to disrupt this association that occurs through conformational changes induced by sequential binding to PIP2 and phosphorylation of a conserved C-terminal threonine residue (T567 in ezrin; Matsui et al., 1998; Fiévet et al., 2004).
A link between the signaling pathways triggered by the small GTPases of the Rho family and activation of ERM proteins has been suggested. The ability of ERM proteins to bind the cytoplasmic domain of CD44 is increased by activation of Rho (Hirao et al., 1996). In permeabilized fibroblasts, ERM proteins are required for the formation of focal adhesions and actin stress fibers in response to active RhoA and Rac (Mackay et al., 1997). A RhoA-dependent activation mechanism for ERM proteins has been proposed on the basis that overexpression of either RhoA or its direct effector, the phosphatidylinositol 4-phosphate 5-kinase, results in the elevation of PIP2 and induction of microvilli with a concomitant recruitment of activated ERM proteins (Hirao et al., 1996; Matsui et al., 1999; Yonemura et al., 2002). However, Rac1 activation in T-lymphocytes by chemokine or after TCR engagement leads to ERM protein inactivation with a concomitant microvillus breakdown (Faure et al., 2004; Nijhara et al., 2004). These observations suggest that Rho GTPases can function as upstream regulators of ERM proteins.
However, in vitro and in vivo studies have indicated that ERM proteins can act as upstream regulators of Rho GTPases by binding to the Rho GDP dissociation inhibitor (RhoGDI). This association is thought to displace RhoGDI from Rho GTPases, allowing them to be activated by their specific guanine nucleotide exchange factors (GEFs; Takahashi et al., 1997). An association of ERM proteins with the exchange factor Dbl in vitro as well as in vivo has been reported (Takahashi et al., 1998; Lee et al., 2004; Vanni et al., 2004). In epithelial cells, an active form of ezrin has been shown to activate the small GTPase Rac1 with a concomitant disassembly of adherens junctions (Pujuguet et al., 2003). A genetic analysis in Drosophila, however, has suggested that Drosophila moesin negatively regulates the Rho1 pathway (Speck et al., 2003). Therefore, these data reveal a complex relationship between ERM proteins and the small GTPases, supporting the idea that ERM proteins function both upstream and downstream of Rho GTPases.
Using a yeast two-hybrid screen we identified a novel GEF that interacts with ezrin and that activates the small GTPase RhoG. RhoG shares significant homology with Rac1 (72% identity) and is believed to function upstream of Rac1 and Cdc42 (Gauthier-Rouviere et al., 1998; Katoh et al., 2000, 2006). However, other studies suggest that RhoG signals in parallel of Rac1 and Cdc42 rather than upstream (Wennerberg et al., 2002; Prieto-Sanchez and Bustelo, 2003). Although several regulators of the RhoA, Rac1 and Cdc42 GTPases have been characterized few regulators of RhoG have been identified. As a consequence the processes controlled by activated RhoG are poorly understood. Trio, through its N-terminal DH/PH tandem, functions as a RhoG exchange factor and activation of RhoG by TrioGEF1 regulates neurite outgrowth (Blangy et al., 2000; Katoh et al., 2000; Estrach et al., 2002). SGEF, another exchange factor for RhoG, stimulates macropinocytosis in fibroblasts (Ellerbroek et al., 2004). Recent studies have identified ELMO as a specific effector of RhoG (Katoh and Negishi, 2003). ELMO has been implicated in cell migration, in phagocytosis of apoptotic cells, and in RhoG-mediated neurite outgrowth (Gumienny et al., 2001; Wu et al., 2001; Katoh and Negishi, 2003; deBakker et al., 2004; Grimsley et al., 2004). In these processes, ELMO cooperates with Dock180 to promote downstream Rac activation. Furthermore, an interaction between ERM proteins and ELMO has recently been reported (Grimsley et al., 2006).
Here we characterize the interaction between ezrin and a novel GEF, PLEKHG6 (pleckstrin homology domain containing family G with RhoGef domain member 6). PLEKHG6 displays an exchange activity toward RhoG and to a much lesser extent toward Rac1. We show that ezrin recruits PLEKHG6 to the apical surface of epithelial cells where it promotes the activation of RhoG. In addition to its interaction with PLEKHG6 and RhoG, ezrin also forms a ternary complex with PLEKHG6 and the RhoG effector ELMO, indicating that ezrin interacts with upstream and downstream regulators of RhoG. We demonstrate that the interaction of ezrin with PLEKHG6 is critical for PLEKHG6-induced morphological changes at the apical surface of epithelial cells but is not necessary for its catalytic activity. Moreover, we show that both ezrin and PLEKHG6 are required for macropinocytosis in epidermal growth factor (EGF)-stimulated A431 cells.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
); monoclonal anti-VSVG antibody (clone P5D4; Kreis, 1986); mouse monoclonal anti-Myc (clone 9E10); and affinity-purified rabbit polyclonal anti-green fluorescent protein (GFP) antibodies were raised in the laboratory; rat monoclonal anti-HA (clone 3F10
[PDB]
) and mouse monoclonal anti-GFP were from Roche (Meylan, France); mouse monoclonal anti-Rac1, Upstate Biotechnology (Lake Placid, NY); mouse monoclonal anti-
tubulin, Sigma-Aldrich (L'Isle D'Abeau Chesnes, France); rabbit polyclonal anti-Cdc42, Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase–conjugated goat anti-rabbit, anti-mouse and anti-rat secondary antibodies were from Jackson ImmunoResearch Laboratories (Soham, United Kingdom). Cy3- and Alexa 488–conjugated goat anti-rabbit and anti-mouse antibodies were from Jackson ImmunoResearch Laboratories. Rhodamine-phalloidin and Alexa Fluor 350 phalloidin were from Molecular Probes (Invitrogen, Carlsbad, CA). Glutathione-Sepharose 4B beads and protein A-Sepharose fast-flow beads were purchased from Amersham Pharmacia Biotech (Uppsala, Sweden). Tetramethylrhodamine isothiocyanate-dextran (TRITC-Dextran; 155,000 average mol wt) was purchased from Sigma-Aldrich. EGF was from BD Biosciences (Bedford, MA).
Plasmids
A cDNA for human PLEKHG6 (FLJ10665, Accession number NP_060643) was obtained from the National Institute of Technology and Evaluation (Japan). For expression in mammalian cells, cDNAs encoding the different Myc-tagged PLEKHG6 were inserted into the pcDNA3.1 vector (Invitrogen). Point mutations were generated by site-directed mutagenesis (QuickChange; Stratagene, La Jolla, CA). Ezrin plasmids for eukaryotic expression and GST-tagged ezrin plasmids were previously described (Gautreau et al., 2000; Srivastava et al., 2005). Hemagglutinin (HA)-tagged RhoG (wt and Q61L), GFP-tagged RhoG (T17N and F37A), and GFP-tagged Rac1(T17N) were a gift from Dr. P. Fort (Centre de Recherche de Biochimie Macromoléculaire, Montpellier, France). Myc-tagged Rac1(Q61L) and Cdc42(Q61L) were from Dr. A. Hall (Memorial Sloan-Kettering Cancer Center). The Pak CRIB-encompassing domain (amino acids 70–118) fused to glutathione S-transferase (GST) was from Dr. Lowe (GlaxoSmithKline, United Kingdom) (Thompson et al., 1998). GFP-tagged and GST-tagged ELMO plasmids were provided by Dr. K. Ravichandran (University of Virginia, Charlottesville, VA).
Yeast Two-Hybrid Screen
Yeast two-hybrid screens were performed with ezrin fragments as baits to screen a random-primed cDNA library from human placenta using a previously described mating protocol (Formstecher et al., 2005).
Cell Culture and Transfection
LLC-PK1 (CCL 101; American Type Culture Collection, Manassas, VA), JEG-3 (ACC463; DSMZ, Braunschweig, Germany), and the human epidermoid carcinoma A431 cells were maintained in DMEM containing 10% fetal bovine serum (FBS) under 10% CO2 at 37°C. LLC-PK1 cells stably transfected with the vector alone (pcB6), with cDNA coding for VSVG-tagged wt ezrin (clone E17) or VSVG-tagged ezrin T567D (clone D2) have previously been described (Gautreau et al., 2000). LLC-PK1 and NIH3T3 cells were transfected by electroporation as described previously (Gautreau et al., 2000). Transiently transfected cells were analyzed after 20 h of cDNA expression. 293T cells (2 x 106) were transiently transfected by the calcium phosphate method (Wigler et al., 1977) and analyzed 24 or 48 h after transfection.
Northern Blot
A premade Northern blot containing poly A+ RNA from different human tissues (Human 12-lane MTN Blot; Clontech-BD Biosciences; Palo Alto, CA) was hybridized with a PCR-amplified fragment of PLEKHG6 cDNA corresponding to nucleotides 1885–2518 and labeled with [-32P]CTP using the Megaprime DNA Labeling System (Amersham Pharmacia Biotech).
In Vitro Transcription/Translation Assay
Transcription and translation reactions were performed using the TNT Coupled Reticulocyte Lysate System according to the manufacturer's instructions (Promega, Madison, WI). Briefly, transcription of PLEKHG6-CT fragment (aa 579-790) was obtained using a PCR fragment as template amplified from PLEKHG6 cDNA carrying the 3' UTR (untranslated region). Primers used are the following: 5'CTTAATACGACTCACTATAGGGAAACAGACACCATGCTTGTGCCAGATGATACCTCAGAC-3'carrying the T7 promoter sequence followed by the Kozak sequence, and 5'-CGACCTGCAGCTCGAGCACA-3' was designed to include the 3'UTR. Translation was performed in the presence of [35S]methionine (Amersham Pharmacia Biotech).
The GST-pulldown assays were performed by incubating equal amounts of GST or GST fusion proteins immobilized to glutathione-Sepharose beads (Amersham Pharmacia Biotech) with 5 µl of 35S-labeled protein mixture in a final volume of 100 µl of binding buffer (20 mM sodium phosphate, pH 6, 150 mM NaCl, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol, 0.02% (vol/vol) Nonidet P-40) for 3 h at room temperature. Beads were washed three times with binding buffer, and bound proteins were eluted in Laemmli sample buffer, run on SDS-PAGE (15%), and visualized by autoradiography.
Pulldowns
293T cells transfected with the indicated plasmids were lysed with RIPA buffer (50 mM HEPES, pH 7.2, 10 mM EDTA, 150 mM NaCl, 1% (vol/vol) Nonidet P-40, 0.5% Na sodium deoxycholate (DOC), 0.1% SDS, 10 µg/ml pepstatin, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM PMSF). Clarified lysates were incubated with GST fusion proteins (20–30 µg) bound to glutathione-Sepharose beads for 3 h at 4°C. Beads were washed three times with lysis buffer, and bound proteins were eluted in Laemmli sample buffer and separated by SDS-PAGE. For the competition assay-purified ezrin-CT was added to the lysates and incubated for 3 h at 4°C with GST-ezrin-NT immobilized on glutathione-Sepharose beads. The amount of purified GST-ezrin-CT used was four times the amount of GST-ezrin-NT.
Immunoprecipitation and Immunoblotting
293T cells transfected with the indicated plasmids were lysed with RIPA buffer for 10 min. Clarified lysates from 293T cells were incubated with 2 µg of rabbit polyclonal antibodies (anti-VSVG or anti-GFP), together with protein A-Sepharose for 3 h at 4°C. Beads were processed as described above. All blots were performed on nitrocellulose membranes (Protran Hybond; Whatman, Dassel, Germany) and developed using horseradish peroxidase-conjugated secondary antibodies and an ECL detection kit (Amersham Pharmacia Biotech).
GTPase Activity Assays
LLC-PK1 cells transfected with the indicated plasmids were lysed with ice-cold lysis buffer (50 mM Tris pH 7.2, 1% Triton X-100, 0.5% Na DOC, 0.1% SDS, 500 mM NaCl, 10 mM MgCl2, 10 µg/ml pepstatin, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM PMSF). Bacterially produced GST-ELMO (100 µg) and GST-CRIB (20 µg) proteins bound to glutathione-Sepharose beads were incubated with lysates from LLC-PK1 cells for 1 h at 4°C. The beads were washed four times with washing buffer (50 mM Tris pH 7.2, 1% Triton X-100, 150 mM NaCl, 10 mM MgCl2, 10 µg/ml pepstatin, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 mM PMSF). The bound proteins were eluted in Laemmli sample buffer and separated by SDS- PAGE (15%). Densitometric analyses were performed with Scion Image (Frederick, MD).
Yeast Exchange Activity
The LexA, GAL4, TRIO-GEFD1, and βPIX constructs have been reported earlier (De Toledo et al., 2000). Complementary DNAs coding for PLEKHG6 domains fused to the Myc tag were inserted into the yeast expression vector pRs426Met (Tirode et al., 1997). Interactions were assayed in yeast strain TAT7 [Mata, trp1, his3, leu2, ura3, ade2, and LYS:(LexAop)8-lacZ] provided by Jacques Camonis, Institut Curie, Paris, France). Filter assays for β-galactosidase activity were performed as described (De Toledo et al., 2000).
Down-Regulation of Ezrin and PLEKHG6 by shRNA
For ezrin and PLEKHG6 silencing, A431 cells were transfected with the psiRNA-h7SK-GFPzeo vector to generate short hairpin RNA (shRNA) and the reporter GFP (Invivogen). The following oligonucleotides were used to target ezrin human sequence: Ez1 (coding sequence nucleotides 711-731) 5' ACCTCGATTGGCTTTCCTTGGAGTGATCAAGAGTCACTCCAAGGAA- AGCCAATCTT3' and Ez2 (coding sequence nucleotides 326-346) 5'ACCTCGAATCCTTAGCGATGAGATCTTCAAGAGAGATCTCATCGCT- AAGGATTCTT3'. The following oligonucleotides were used to target PLEKHG6 human sequence: Sequence 1 (nucleotides 1178-1198) 5'ACCTCGGAGTCATTCCTGCGACATATTCAAGAGATATGTCGCAGGAATGACTCCTT and Sequence 2 (nucleotides 1691-1711) 5'ACCTCGAAGGCAGAGGAGTATGTTCATCAAGAGTGAACATACTCCTCTGCCTTCTT3'. The sequence of scramble nucleotides (Scr) used was as follows: 5'ACCTCGATATGTGCGTACCTAGCATTCAAGAGATGCTAGGTACGCACATATTT3'. A431 cells were transfected with plasmid small interfering RNA (psiRNA) plasmids using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen).
RT-PCR
Total RNA, 2 µg, extracted from A431 cells transfected with scramble or PLEKHG6 psiRNA were used for the first-stand cDNA synthesis with the SuperScript reverse transcriptase according to the manufacturer's instructions (Invitrogen). Semiquantitative PCR was performed using, in the same reaction, the following oligos: PLEKHG6f: 5'CCACCCTGGACCTGACGTCC. PLEKHG6r: 5'TCAGTGGCCAGCTTTCAGGAACAGAG. GADPHf: 5'CCTCAACTACAGGTCTACA3'. GADPHr: 5'TTCTCGTGGTTCACACCCAT3'.
Macropinocytosis Assay
After transfection with psiRNAs, A431 cells were cultured for 3 d on glass coverslips. Before the macropinocytosis assay, cells were incubated for 3 h in serum-free DMEM medium plus 1 mM HEPES and 0.15% BSA. Cells were then incubated at 37°C for 5 min in the same medium containing 1 mg/ml TRITC-dextran and 100 ng/ml EGF. The cells were then quickly rinsed with ice-cold PBS, fixed with 4% paraformaldehyde, and processed for fluorescence.
Immunofluorescence
After fixation with 4% paraformaldehyde, cells were permeabilized with 0.5% Triton X-100 for 5 min and incubated with primary and secondary antibodies. Cells were examined using an epifluorescence microscope (DM 6000B Leica, Deerfield, IL) coupled to a CCD camera (Cool Snap, Roper Scientific, Tucson, AZ). Images were analyzed using Metaview Software (Universal Imaging, West Chester, PA).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
; Rossman et al., 2005). The PH domain of PLEKHG6 shows also significant homology with the PH domain of GEF720 (53% identity, 75% similarity), with the putative PH domains of CG7323 (36% identity, 54% similarity) and T08H4.1 (34% identity, 60% similarity; Figure 1B). Northern blot analysis of PLEKHG6 mRNA expression revealed that the highest expression level was in human placenta (Figure 1C). A low mRNA level was also observed in small intestine, lung, liver, kidney, thymus, and heart. In agreement with the predicted molecular weight, a protein with a relative molecular mass of 89 kDa was immunoprecipitated from lysates of human choriocarcinoma JEG-3, porcine kidney LLC-PK1, and human epidermoïd A431 cells using an antibody raised against a peptide located in the carboxy-terminal region of PLEKHG6 (Figure 1D). However, only the overexpressed PLEKHG6 but not the endogenous protein was detected by Western blot with this antibody in the total cellular lysate (Figure 1D). These results indicate that PLEKHG6 is expressed in very low amounts both at the mRNA and protein levels.
The C-terminal Region of PLEKHG6 Interacts with the N-terminal Domain of Ezrin
The interaction between PLEKHG6 and ezrin found in the yeast two-hybrid screen was confirmed using different approaches. First, the C-terminal region of PLEKHG6 (aa 579-790) was synthesized in vitro and incubated with various forms of bacterially purified GST-ezrin (Figure 2A). As shown in Figure 2B the C-terminal fragment of PLEKHG6 interacts with the N-terminal domain of ezrin as well as with ezrin deleted of the last 52 amino-acids (ezrin-
52) but not with the C-terminal domain of ezrin. To further analyze the interacting domains between ezrin and PLEKHG6, we performed pulldowns with various forms of GST-ezrin and lysates of 293T cells expressing different Myc-tagged forms of PLEKHG6 (Figure 2, A and C). We found that GST-ezrin-NT pulled down efficiently PLEKHG6-wt and PLEKHG6-NT but not PLEKHG6-CT (Figure 2C). Neither forms of PLEKHG6 were found to interact with the C-terminus of ezrin or full-length ezrin. These data indicate that the C-terminal region of PLEKHG6 is necessary and sufficient for its interaction with the N-terminal domain of ezrin. Moreover, they indicate that the binding site of PLEKHG6 on ezrin is masked due to the intramolecular interaction between the N- and C-terminal domains of ezrin. To confirm this observation, GST-ezrin-NT was incubated with lysates of cells expressing Myc-tagged PLEKHG6 in the absence or presence of the C-terminal domain of ezrin. As shown in Figure 2D, the interaction between Myc-PLEKHG6 and GST-ezrin-NT was inhibited by the addition of the C-terminal domain of ezrin. This indicates that PLEKHG6 interacts with ezrin only when the protein is in an open conformation. We also observed an interaction between PLEKHG6 and the N-terminal domain of radixin and a weak interaction with the N-terminal domain of moesin but not with the full-length proteins, indicating that as for ezrin the PLEKHG6 binding site on radixin and moesin is cryptic (data not shown).
|
) and to increase the level of active ezrin in the cells (Gautreau et al., 2000). We found that PLEKHG6 coimmunoprecipitates with ezrin T567D but not with ezrin wt (Figure 2E). Furthermore, ezrin T567D is coimmunoprecipitated with endogenous PLEKHG6 (Figure 2F). As expected, PLEKHG6-CT failed to coimmunoprecipitate with ezrin T567D (Figure 2E). Altogether, these results show that PLEKHG6, through its C-terminal domain, interacts only with an active form of ezrin.
PLEKHG6 Displays Guanine Nucleotide Exchange Activity Preferentially on RhoG
To establish that the identified PLEKHG6 had the capacity to activate Rho GTPases, we analyzed the morphological changes induced by PLEKHG6 in NIH3T3 cells. Transient expression of Myc-tagged PLEKHG6 promoted microvilli formation and membrane ruffles on the dorsal surface of the cells as well as a loss of stress fibers (Figure 3A). The effects induced by PLEKHG6, membrane ruffling, and loss of stress fibers suggested that the morphological changes observed might result from the activation of Rho GTPases of the Rac subfamily, including Rac1 and RhoG (Ridley et al., 1992; Gauthier-Rouviere et al., 1998). We therefore examined the ability of PLEKHG6 to activate RhoG and Rac1 in the yeast exchange assay (De Toledo et al., 2000). In this assay, yeast expressing wild-type RhoG or Rac1 and their respective effectors, kinectin or Pak, were transformed with the cDNA coding for PLEKHG6-wt or a mutant form (PLEKHG6-N351A, PLEKHG6-CT, PLEKHG6-NT, PLEKHG6-DHPH). The activation of the Rho GTPases by the GEFs leads to their interaction with their effectors and this interaction is monitored by the β-galactosidase activity. As shown in Figure 3B, wild-type PLEKHG6 activated RhoG to the same extent as the exchange factor Trio-GEFD1, which was used as positive control. PLEKHG6-N351A containing a single amino acid substitution of the highly conserved Asn351 in the DH domain had no exchange activity and therefore represents a catalytically dead form of PLEKHG6 (Whitehead et al., 1997; Aghazadeh et al., 1998; Debreceni et al., 2004). PLEKHG6 lacking the ezrin binding site (PLEKHG6-CT) exhibited an exchange activity toward RhoG, similar to that of the full-length protein (Figure 3B, left panel). However, neither the DH/PH tandem nor PLEKHG6-NT showed an exchange activity toward RhoG. No exchange activity for the DH/PH domains was observed in an in vitro assay (data not shown). Altogether this indicates that, whereas the C-terminal region of PLEKHG6 is dispensable for the guanine nucleotide exchange activity, the N-terminal region of PLEKHG6 is required. An exchange activity of PLEKHG6 was also observed toward Rac1 although to a much lesser extent than that of Trio-GEFD1 toward Rac1 (Figure 3B, right panel). However, the β-galactosidase activity induced by PLEKHG6-CT was stronger than that of PLEKHG6. Next, we measured the exchange activity of Myc-tagged PLEKHG6 by pulldown using GST-ELMO and GST-CRIB domains of Pak1 to evaluate the level of GTP-bound RhoG, Rac1, and Cdc42, respectively. Because endogenous RhoG cannot be detected with the available antibodies a low level of HA-RhoG was expressed in cells. Transient expression of PLEKHG6 increased significantly the amount of GTP-bound RhoG (Figure 3C, left panel). PLEKHG6-CT was still able to promote GTP-loading of RhoG, although to a lower extent than PLEKHG6-wt (Figure 3C, left panel). A low increase (2.3-fold) in GTP-bound Rac1 was observed upon expression of PLEKHG6-wt, but unlike what was observed in the yeast exchange assay, PLEKHG6-CT only slightly increased the level of GTP-bound Rac1 (1.6-fold; Figure 3C, right panels). No detectable increase in the amount of GTP-bound Cdc42 was detected upon expression of either PLEKHG6-wt or PLEKHG6-CT (Figure 3C, right panel). Together, these results indicate that PLEKHG6 has an exchange activity toward RhoG and to a much lesser degree toward Rac1.
|
,b). Myc-PLEKHG6-wt was expressed in 293T cells together with GFP-RhoGT17N or GFP-Rac1T17N, and immunoprecipitation with an anti-GFP antibody was performed (Figure 3D). PLEKHG6-wt coimmunoprecipitated with RhoGT17N, whereas only a very weak band was detected with Rac1T17N. This indicates that RhoG may be the main target of PLEKHG6.
Ezrin Determines the Subcellular Localization of PLEKHG6
We next analyzed the morphological changes triggered by PLEKHG6 in LLC-PK1 epithelial cells because in these cells ezrin plays an important role in the organization of the apical brush border microvilli (Gautreau et al., 2000). Because endogenous PLEKHG6 could not be detected by immunofluorescence (data not shown), we transiently expressed PLEKHG6 in LLC-PK1 cells. Myc-PLEKHG6-wt induced actin-rich apical ruffles and microvilli as shown by rhodamine-phalloidin staining (Figure 4A, top panel). Colocalization of ezrin and Myc-PLEKHG6-wt was observed in these structures (Figure 4B, top panel). The formation of the apical actin-rich structures was not detected in cells expressing Myc-PLEKHG6-CT, which does not interact with ezrin (Figure 4A, bottom panel). Instead, the cells were flattened and formed extensive lamellipodia (Figure 4, A and B, bottom panels). We also observed in these cells actin-rich patches probably corresponding to actin nucleation sites (Figure 4A, bottom panel). Altogether, these observations indicate that the recruitment of PLEKHG6 by ezrin controls actin cytoskeleton organization at the apical surface of the cells. Consistent with this, we found that the catalytically dead form Myc-PLEKHG6-N351A, which still interacts with ezrin (data not shown), colocalized with ezrin in the microvilli (see inset) and did not induce changes in cell morphology (Figure 5A, top panel). In contrast Myc-PLEKHG6-N351A-CT showed a diffuse cytoplasmic staining and had no effect on cell morphology as these cells bear regular microvilli at the apical surface (Figure 5A, bottom panel). We did not observe any morphological changes in cells expressing the DH/PH domains (data not shown), thus confirming that the DH/PH domains alone display no exchange activity.
|
|
PLEKHG6 Forms a Ternary Complex with Ezrin and RhoG
Our results suggested that ezrin/PLEKHG6 interaction is important for RhoG-mediated signaling pathways at the apical surface of the cells. Therefore, we determined whether ezrin and PLEKHG6 could form a ternary complex with RhoG. We transiently transfected 293T cells with GFP-RhoGT17N and VSVG-ezrin-29, which represents an open form of ezrin, in the presence or absence of Myc-PLEKHG6. As shown in Figure 6, a ternary complex was observed in the presence of wild-type PLEKHG6 but not PLEKHG6-CT. In the absence of PLEKHG6 we detected a very weak association of GFP-RhoGT17N with VSVG-ezrin-29. This interaction might be mediated by the endogenous PLEKHG6 or, alternatively, by a RhoGDI, which has been shown to interact with ezrin (Takahashi et al., 1997). Although equal amounts of total DNA were used in all transfections, we repeatedly found that the amount of GFP-RhoGT17N expressed in cells producing PLEKHG6-CT was very low, suggesting that RhoGT17N is less stable in presence of this mutant. Altogether these data indicated that a ternary complex between ezrin, PLEKHG6, and RhoG could form, with PLEKHG6 bridging RhoGT17N and ezrin.
|
), we analyzed the potential molecular association between the components of the RhoG pathway. We coexpressed in 293T cells GFP-ELMO with an open form of ezrin VSVG-ezrin-29 and Myc-tagged PLEKHG6-wt or PLEKHG6-CT, and we performed immunoprecipitations with either anti-GFP or -VSVG antibodies. Interestingly, we found that ELMO immunoprecipitated PLEKHG6 and ezrin-29 (Figure 7A, top panel, lane 2). A complex was also observed with PLEKHG6-CT that does not bind to ezrin, indicating that the interaction between PLEKHG6 and ELMO was not mediated by ezrin (Figure 7A, top panel, lane 3). These results indicate that PLEKHG6 and ezrin binding sites on ELMO are distinct, allowing the formation of a ternary complex. When immunoprecipitation of VSVG-ezrin was performed, we confirmed that a complex between ezrin-29, ELMO and PLEKHG6-wt could occur (Figure 7A, middle panel, lane 2). In the presence of PLEKHG6-CT only ELMO was immunoprecipitated with VSVG-ezrin-29 (Figure 7A, middle panel, lane 3). The amount of ELMO associated with ezrin-29 in the presence of PLEKHG6-CT was very low compared with PLEKHG6-wt, suggesting that PLEKHG6 may influence the interaction between ELMO and ezrin. To further confirm the interaction between ELMO and PLEKHG6, GST-ELMO immobilized on beads was incubated with lysates from 293T cells expressing different Myc-tagged forms of PLEKHG6. We found that GST-ELMO pulled down PLEKHG6-wt as well as PLEKHG6-CT, confirming that ELMO binding site on PLEKHG6 is distinct from that of ezrin (Figure 7B). We also observed that GST-ELMO binds to PLEKHG6-NT suggesting that the ELMO binding site on PLEKHG6 is likely to be located within their DH/PH domains (Figure 7B). Altogether these results indicate that ezrin is present in distinct complexes, because it interacts with PLEKHG6 or ELMO, it also forms a ternary complex with these two proteins. Moreover we show that PLEKHG6 and ELMO can interact together independently of ezrin.
|
). The uptake of TRITC-dextran was measured in cells expressing scramble, PLEKHG6, or ezrin shRNAs that were also GFP positive (Figure 8D). We observed a striking decrease in TRITC-dextran uptake in cells expressing PLEKHG6 (
23%) or ezrin shRNAs (27%) compared with cells expressing scrambled shRNAs (65%; Figure 8D). Interestingly, the inhibition of dextran uptake was similar in cells knocked down for either PLEKHG6 or ezrin, suggesting that these proteins are both required for macropinocytosis.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Phylogenetic trees of human GEFs indicate that PLEKHG6 together with GEF720 form a phylogenetic subgroup (Schmidt and Hall, 2002; Rossman et al., 2005). These two proteins share significant homologies in their DH/PH domains with the Dbl-related proteins from D. melanogaster (CG7323) and C. elegans (T08H4.1). Thus CG7323 and T08H4.1 may represent the invertebrate homologues of PLEKHG6 and GEF720. Because neither of these proteins has been characterized so far it is not known if they are functionally related.
Here, we demonstrate by different approaches that PLEKHG6 displays an exchange activity primarily toward RhoG although a very low exchange activity of PLEKHG6 toward Rac1 was observed. Consistent with these data we found a strong association of PLEKHG6 with nucleotide-free RhoG and a very weak association with nucleotide-free Rac1. Other GEFs for RhoG have been described, such as TrioGEF1, Kal-GEF1, and SGEF (Blangy et al., 2000; May et al., 2002; Ellerbroek et al., 2004), which in addition to their preferential activity toward RhoG, can also activate another Rho GTPase. Thus Kal-GEF1 and TrioGEF1 activates Rac1, whereas SGEF activates Cdc42.
We have observed an unusual regulation of the exchange activity of PLEKHG6. Unlike what is observed with most GEFs, we found that the DH/PH tandem of PLEKHG6 has no exchange activity either in vitro or in the yeast exchange assay or in cells. Furthermore, we observed that removal of the N-terminal domain leads to an inactive protein. For other GEFs, however, it has been reported that deletion of the N-terminal domain leads to constitutive activation by the relief of an intramolecular autoinhibition (Schmidt and Hall, 2002). This suggests that other mechanisms are involved in the activation of PLEKHG6. For example, conformational changes may be triggered by the interaction of proteins with the amino-terminal domain of PLEKHG6, thus controlling its activity. In contrast, we found that the ezrin-binding site in the C-terminus of PLEKHG6 is dispensable for its exchange activity, indicating that ezrin is not directly implicated in the regulation of PLEKHG6 activity.
Instead, our results demonstrate that the interaction between ezrin and PLEKHG6 is important for the localization of PLEKHG6 in a specific epithelial cell compartment. This interaction is regulated because it can only occur when ezrin is in an open conformation acting as a membrane-cytoskeleton linker. In epithelial cells, the pool of ezrin that is associated with the cortical actin cytoskeleton is mainly present at the apical membrane domains in structures such as microvilli. Indeed, we observed that both PLEKHG6 and PLEKHG6-N351A colocalize with ezrin at the apical pole of the cells, whereas mutants of PLEKHG6 lacking the C-terminal ezrin-binding site do not.
Consistent with this specific localization, PLEKHG6 induces the remodeling of the apical actin structures in epithelial cells with formation of apical ruffles and microvilli triggered by the activation of RhoG. In support of this, dominant negative mutants of RhoG efficiently inhibit the specific PLEKHG6-induced morphogenic effects. Interestingly, in cells knocked down for ezrin, PLEKHG6 does not induce dorsal ruffles but lamellipodia, as does PLEKHG6-CT, which fails to interact with ezrin. These observations suggest that when the interaction ezrin/PLEKHG6 is abolished, PLEKHG6 or PLEKHG6-CT may elicit actin cytoskeleton rearrangements through different effectors depending on which compartment RhoG is activated.
In our model we have observed distinct complexes involving components of the RhoG pathway. A ternary complex between ezrin, PLEKHG6 and RhoG was found, indicating that RhoG is recruited to the apical compartment by PLEKHG6 when associated with ezrin. This was supported by immunofluorescence data showing a pool of RhoG in the microvilli. In agreement with a previous report describing an interaction between ELMO and ERM proteins (Grimsley et al., 2006), we found that ezrin interacts with ELMO. Furthermore, we observed a ternary complex between ezrin, PLEKHG6, and ELMO, suggesting that ezrin recruits upstream and downstream regulators of RhoG. Interestingly, we also found an interaction between PLEKHG6 and ELMO that was not mediated by ezrin. These findings suggest that PLEKHG6 may interact directly with the RhoG effector ELMO. We cannot, however, exclude that the interaction between PLEKHG6 and ELMO occurs through RhoG. The interaction of GEFs with Rho GTPases effectors has already been reported. For example, the interaction of Dbl with Pak has been shown to have a positive feedback on the Dbl exchange activity toward Cdc42 (Wang et al., 2004). Other studies indicate that GEFs can also interact with and activate the effector in an exchange activity–independent manner, as shown for Kal-GEF1, and Pix that can interact with and activate Pak (Daniels et al., 1999; Schiller et al., 2005). Therefore, the interaction of PLEKHG6 with ELMO may serve to activate specific RhoG downstream pathways. Alternatively, a regulatory feedback loop might exist, whereby ELMO could regulate the exchange activity of PLEKHG6. Altogether our data indicate that ezrin coordinates the association between the upstream and downstream regulators of RhoG pathways in a specific subcellular compartment allowing the local activation of RhoG.
We demonstrate here that the formation of dorsal ruffles triggered by PLEKHG6, is important for efficient macropinocytosis in A431 cells. In this process, ezrin is required for the formation of dorsal ruffles by PLEKHG6 and therefore for RhoG activation in a specific cellular compartment. Moreover we show that the interaction between ezrin and PLEKHG6 is necessary for macropinocytosis. Indeed, down-regulation of either PLEKHG6 or ezrin inhibits to the same extent the dextran uptake in EGF-stimulated A431 cells. SGEF, an exchange factor for RhoG has been shown to stimulate macropinocytosis in NIH3T3 cells (Ellerbroek et al., 2004) and to mediate Salmonella entry into cells through the reorganization of the actin cytoskeleton (Patel and Galan, 2006). This suggests that activation of RhoG may participate not only to cytoskeleton reorganization but also to processes involved in internalization of molecules. Interestingly, the highest level of PLEKHG6 mRNA is observed in placenta, a tissue in which ezrin is abundant (West et al., 1989). Placental microvilli are very dynamic structures actively involved in nutrient exchange. Therefore, the interaction between ezrin and PLEKHG6 described here could play an important role in functions associated with the placental microvilli.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Monique Arpin (marpin{at}curie.fr).
Abbreviations used: DH, Dbl-homology; EGF, epidermal growth factor; ERM, ezrin, radixin, moesin; GDI, guanine dissociation inhibitor; GEF, guanine nucleotide exchange factor; GFP, green fluorescent protein; GST, glutathione S-transferase; PH, pleckstrin homology; PLEKHG6, pleckstrin homology domain containing, family G (with RhoGef domain) member 6; TRITC-dextran, tetramethylrhodamine isothiocyanate-dextran.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Barret, C., Roy, C., Montcourrier, P., Mangeat, P., and Niggli, V. (2000). Mutagenesis of the phosphatidylinositol 4,5-biphosphate (PIP2) binding site in the NH2-terminal domain of ezrin correlates with its altered cellular distribution. J. Cell Biol 151, 1067–1079.
Berryman, M., Franck, Z., and Bretscher, A. (1993). Ezrin is concentrated in the apical microvilli of a wide variety of epithelial cells whereas moesin is found primarily in endothelial cells. J. Cell Sci 105, 1025–1043.[Abstract]
Berryman, M., Gary, R., and Bretscher, A. (1995). Ezrin oligomers are major cytoskeletal components of placental microvilli: a proposal for their involvement in cortical morphogenesis. J. Cell Biol 131, 1231–1242.
Blangy, A., Vignal, E., Schmidt, S., Debant, A., Gauthier-Rouviere, C., and Fort, P. (2000). TrioGEF1 controls Rac- and Cdc42-dependent cell structures through the direct activation of rhoG. J. Cell Sci 113, (Pt 4), 729–739.[Abstract]
Bonilha, V. L., Rayborn, M. E., Saotome, I., McClatchey, A. I., and Hollyfield, J. G. (2006). Microvilli defects in retinas of ezrin knockout mice. Exp. Eye Res 82, 720–729.[CrossRef][Medline]
Bretscher, A., Edwards, K., and Fehon, R. G. (2002). ERM proteins and merlin: integrators at the cell cortex. Nat. Rev. Mol. Cell Biol 3, 586–599.[CrossRef][Medline]
Daniels, R. H., Zenke, F. T., and Bokoch, G. M. (1999). alphaPix stimulates p21-activated kinase activity through exchange factor-dependent and -independent mechanisms. J. Biol. Chem 274, 6047–6050.
De Toledo, M., Colombo, K., Nagase, T., Ohara, O., Fort, P., and Blangy, A. (2000). The yeast exchange assay, a new complementary method to screen for Dbl-like protein specificity: identification of a novel RhoA exchange factor. FEBS Lett 480, 287–292.[CrossRef][Medline]
deBakker, C. D. et al. (2004). Phagocytosis of apoptotic cells is regulated by a UNC-73/TRIO-MIG-2/RhoG signaling module and armadillo repeats of CED-12/ELMO. Curr. Biol 14, 2208–2216.[CrossRef][Medline]
Debreceni, B., Gao, Y., Guo, F., Zhu, K., Jia, B., and Zheng, Y. (2004). Mechanisms of guanine nucleotide exchange and Rac-mediated signaling revealed by a dominant negative trio mutant. J. Biol. Chem 279, 3777–3786.
Ellerbroek, S. M., Wennerberg, K., Arthur, W. T., Dunty, J. M., Bowman, D. R., DeMali, K. A., Der, C., and Burridge, K. (2004). SGEF, a RhoG guanine nucleotide exchange factor that stimulates macropinocytosis. Mol. Biol. Cell 15, 3309–3319.
Estrach, S., Schmidt, S., Diriong, S., Penna, A., Blangy, A., Fort, P., and Debant, A. (2002). The human Rho-GEF trio and its target GTPase RhoG are involved in the NGF pathway, leading to neurite outgrowth. Curr. Biol 12, 307–312.[CrossRef][Medline]
Faure, S., Salazar-Fontana, L. I., Semichon, M., Tybulewicz, V. L., Bismuth, G., Trautmann, A., Germain, R. N., and Delon, J. (2004). ERM proteins regulate cytoskeleton relaxation promoting T cell-APC conjugation. Nat. Immunol 5, 272–279.[CrossRef][Medline]
Feig, L. A., and Cooper, G. M. (1988a). Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol. Cell. Biol 8, 3235–3243.
Feig, L. A., and Cooper, G. M. (1988b). Relationship among guanine nucleotide exchange, GTP hydrolysis, and transforming potential of mutated ras proteins. Mol. Cell. Biol 8, 2472–2478.
Fiévet, B., Louvard, D., and Arpin, M. (2007). ERM proteins in epithelial cell organization and functions. Biochim. Biophys. Acta 1773, 653–660.[Medline]
Fiévet, B. T., Gautreau, A., Roy, C., Del Maestro, L., Mangeat, P., Louvard, D., and Arpin, M. (2004). Phosphoinositide binding and phosphorylation act sequentially in the activation mechanism of ezrin. J. Cell Biol 164, 653–659.
Formstecher, E. et al. (2005). Protein interaction mapping: a Drosophila case study. Genome Res 15, 376–384.
Gary, R., and Bretscher, A. (1995). Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol. Biol. Cell 6, 1061–1075.[Abstract]
Gauthier-Rouviere, C., Vignal, E., Meriane, M., Roux, P., Montcourier, P., and Fort, P. (1998). RhoG GTPase controls a pathway that independently activates Rac1 and Cdc42Hs. Mol. Biol. Cell 9, 1379–1394.
Gautreau, A., Louvard, D., and Arpin, M. (2000). Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J. Cell Biol 150, 193–203.
Grimsley, C. M., Kinchen, J. M., Tosello-Trampont, A. C., Brugnera, E., Haney, L. B., Lu, M., Chen, Q., Klingele, D., Hengartner, M. O., and Ravichandran, K. S. (2004). Dock180 and ELMO1 proteins cooperate to promote evolutionarily conserved Rac-dependent cell migration. J. Biol. Chem 279, 6087–6097.
Grimsley, C. M., Lu, M., Haney, L. B., Kinchen, J. M., and Ravichandran, K. S. (2006). Characterization of a novel interaction between ELMO1 and ERM proteins. J. Biol. Chem 281, 5928–5937.
Gumienny, T. L. et al. (2001). CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration. Cell 107, 27–41.[CrossRef][Medline]
Haigler, H. T., McKanna, J. A., and Cohen, S. (1979). Rapid stimulation of pinocytosis in human carcinoma cells A-431 by epidermal growth factor. J. Cell Biol 83, 82–90.
Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M., Sasaki, T., Takai, Y., Tsukita, S., and Tsukita, S. (1996). Regulation mechanism of ERM (Ezrin/Radixin/Moesin) protein/plasma membrane association: possible involvement of phosphatidylinositol turnover and rho-dependent signaling pathway. J. Cell Biol 135, 37–51.
Katoh, H., Hiramoto, K., and Negishi, M. (2006). Activation of Rac1 by RhoG regulates cell migration. J. Cell Sci 119, 56–65.
Katoh, H., and Negishi, M. (2003). RhoG activates Rac1 by direct interaction with the Dock180-binding protein Elmo. Nature 424, 461–464.[CrossRef][Medline]
Katoh, H., Yasui, H., Yamaguchi, Y., Aoki, J., Fujita, H., Mori, K., and Negishi, M. (2000). Small GTPase RhoG is a key regulator for neurite outgrowth in PC12 cells. Mol. Cell Biol 20, 7378–7387.
Kreis, T. E. (1986). Microinjected antibodies against the cytoplasmic domain of vesicular stomatitis virus glycoprotein block its transport to the cell surface. EMBO J 5, 931–941.[Medline]
Lee, J. H., Katakai, T., Hara, T., Gonda, H., Sugai, M., and Shimizu, A. (2004). Roles of p-ERM and Rho-ROCK signaling in lymphocyte polarity and uropod formation. J. Cell Biol 167, 327–337.
Mackay, D.J.G., Esch, F., Furthmayr, H., and Hall, A. (1997). Rho- and Rac-dependent assembly of focal adhesion complexes and actin filaments in permeabilized fibroblasts: an essential role for ezrin/radixin/moesin proteins. J. Cell Biol 138, 927–938.
Matsui, T., Maeda, M., Doi, Y., Yonemura, S., Amano, M., Kaibuchi, K., Tsukita, S., and Tsukita, S. (1998). Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J. Cell Biol 140, 647–657.
Matsui, T., Yonemura, S., Tsukita, S., and Tsukita, S. (1999). Activation of ERM proteins in vivo by Rho involves phosphatidyl-inositol 4-phosphate 5-kinase and not ROCK kinases. Curr. Biol 9, 1259–1262.[CrossRef][Medline]
May, V., Schiller, M. R., Eipper, B. A., and Mains, R. E. (2002). Kalirin Dbl-homology guanine nucleotide exchange factor 1 domain initiates new axon outgrowths via RhoG-mediated mechanisms. J. Neurosci 22, 6980–6990.
Nijhara, R., van Hennik, P. B., Gignac, M. L., Kruhlak, M. J., Hordijk, P. L., Delon, J., and Shaw, S. (2004). Rac1 mediates collapse of microvilli on chemokine-activated T lymphocytes. J. Immunol 173, 4985–4993.
Patel, J. C., and Galan, J. E. (2006). Differential activation and function of Rho GTPases during Salmonella-host cell interactions. J. Cell Biol 175, 453–463.
Prieto-Sanchez, R. M., and Bustelo, X. R. (2003). Structural basis for the signaling specificity of RhoG and Rac1 GTPases. J. Biol. Chem 278, 37916–37925.
Pujuguet, P., Del Maestro, L., Gautreau, A., Louvard, D., and Arpin, M. (2003). Ezrin regulates E-cadherin-dependent adherens junction assembly through Rac1 activation. Mol. Biol. Cell 14, 2181–2191.
Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992). The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70, 401–410.[CrossRef][Medline]
Rossman, K. L., Der, C. J., and Sondek, J. (2005). GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors. Nat. Rev. Mol. Cell Biol 6, 167–180.[CrossRef][Medline]
Saotome, I., Curto, M., and McClatchey, A. I. (2004). Ezrin is essential for epithelial organization and villus morphogenesis in the developing intestine. Dev. Cell 6, 855–864.[CrossRef][Medline]
Schiller, M. R., Blangy, A., Huang, J., Mains, R. E., and Eipper, B. A. (2005). Induction of lamellipodia by Kalirin does not require its guanine nucleotide exchange factor activity. Exp. Cell Res 307, 402–417.[CrossRef][Medline]
Schmidt, A., and Hall, A. (2002). Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev 16, 1587–1609.
Speck, O., Hughes, S. C., Noren, N. K., Kulikauskas, R. M., and Fehon, R. G. (2003). Moesin functions antagonistically to the Rho pathway to maintain epithelial integrity. Nature 421, 83–87.[CrossRef][Medline]
Srivastava, J., Elliott, B. E., Louvard, D., and Arpin, M. (2005). Src-dependent ezrin phosphorylation in adhesion-mediated signaling. Mol. Biol. Cell 16, 1481–1490.
Takahashi, K., Sasaki, T., Mammoto, A., Hotta, I., Takaishi, K., Imamura, M., Nakano, K., Kodama, A., and Takai, Y. (1998). Interaction of radixin with Rho small G protein GDP/GTP exchange protein Dbl. Oncogene 16, 3279–3284.[CrossRef][Medline]
Takahashi, K., Sasaki, T., Mammoto, A., Takaishi, K., Kameyama, T., Tsukita, S., Tsukita, S., and Takai, Y. (1997). Direct interaction of the Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates the activation of the Rho small G protein. J. Biol. Chem 272, 23371–23375.
Tamura, A., Kikuchi, S., Hata, M., Katsuno, T., Matsui, T., Hayashi, H., Suzuki, Y., Noda, T., and Tsukita, S. (2005). Achlorhydria by ezrin knockdown: defects in the formation/expansion of apical canaliculi in gastric parietal cells. J. Cell Biol 169, 21–28.
Thompson, G., Owen, D., Chalk, P. A., and Lowe, P. N. (1998). Delineation of the Cdc42/Rac-binding domain of p21-activated kinase. Biochemistry 37, 7885–7891.[CrossRef][Medline]
Tirode, F., Malaguti, C., Romero, F., Attar, R., Camonis, J., and Egly, J. M. (1997). A conditionally expressed third partner stabilizes or prevents the formation of a transcriptional activator in a three-hybrid system. J. Biol. Chem 272, 22995–22999.
Turunen, O., Wahlström, T., and Vaheri, A. (1994). Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J. Cell Biol 126, 1445–1453.
Vanni, C., Parodi, A., Mancini, P., Visco, V., Ottaviano, C., Torrisi, M. R., and Eva, A. (2004). Phosphorylation-independent membrane relocalization of ezrin following association with Dbl in vivo. Oncogene 23, 4098–4106.[CrossRef][Medline]
Wang, L., Zhu, K., and Zheng, Y. (2004). Oncogenic Dbl, Cdc42, and p21-activated kinase form a ternary signaling intermediate through the minimum interactive domains. Biochemistry 43, 14584–14593.[CrossRef][Medline]
Wennerberg, K., Ellerbroek, S. M., Liu, R. Y., Karnoub, A. E., Burridge, K., and Der, C. J. (2002). RhoG signals in parallel with Rac1 and Cdc42. J. Biol. Chem 277, 47810–47817.
West, M. A., Bretscher, M. S., and Watts, C. (1989). Distinct endocytotic pathways in epidermal growth factor-stimulated human carcinoma A431 cells. J. Cell Biol 109, 2731–2739.
Whitehead, I. P., Campbell, S., Rossman, K. L., and Der, C. J. (1997). Dbl family proteins. Biochim. Biophys. Acta 1332, F1–F23.[Medline]
Wigler, M., Silverstein, S., Lee, L. S., Pellicer, A., Cheng, Y., and Axel, R. (1977). Transfer of purified herpes virus thymidine kinase gene to cultured mouse cells. Cell 11, 223–232.[CrossRef][Medline]
Wu, Y. C., Tsai, M. C., Cheng, L. C., Chou, C. J., and Weng, N. Y. (2001). C. elegans CED-12 acts in the conserved crkII/DOCK180/Rac pathway to control cell migration and cell corpse engulfment. Dev. Cell 1, 491–502.[CrossRef][Medline]
Yonemura, S., Matsui, T., Tsukita, S., and Tsukita, S. (2002). Rho-dependent and -independent activation mechanisms of ezrin/radixin/moesin proteins: an essential role for polyphosphoinositides in vivo. J. Cell Sci 115, 2569–2580.
This article has been cited by other articles:
|
|
 |
|
  S. Fujimoto, M. Negishi, and H. Katoh RhoG Promotes Neural Progenitor Cell Proliferation in Mouse Cerebral Cortex Mol. Biol. Cell, December 1, 2009; 20(23): 4941 - 4950. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Meller, L. Vidali, and M. A. Schwartz Endogenous RhoG is dispensable for integrin-mediated cell spreading but contributes to Rac-independent migration J. Cell Sci., June 15, 2008; 121(12): 1981 - 1989. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
