![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 18, Issue 12, 4837-4846, December 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Laboratory of Molecular Medicine, Department of Surgery, and Department of Physiology and Cell Biology, Davis Heart and Lung Research Institute, The Ohio State University Medical Center, Columbus, OH 43210
Submitted March 23, 2007;
Revised August 1, 2007;
Accepted September 11, 2007
Monitoring Editor: Carl-Henrik Heldin
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Laframboise et al., 2007). The phenotypic switch of CFs to myofibroblasts, with acquisition of specialized contractile features, is essential for connective-tissue remodeling during normal and pathological wound healing (Frangogiannis, 2006). Cardiac myofibroblasts are specialized contractile fibroblasts formed by irreversible acquisition of contractile proteins such as smooth muscle actin (SMA). In normal wound healing, differentiation to myofibroblasts is necessary for repair and stabilization, but these cells eventually undergo apoptosis. If myofibroblasts remain in the injured area for an extended period of time, excessive extracellular matrix (ECM) production occurs, resulting in fibrosis that in turn leads to loss of myocardial compliance (Weber and Brilla, 1991; Brilla, 2000; Burlew and Weber, 2002). Such a condition is commonly noted in patients who have suffered from myocardial infarction and those suffering from heart failure and often leads to further loss of cardiac function (Capasso et al., 1990; Sun et al., 2000). Regardless of etiology, cardiac fibrosis is a major contributor to cardiac remodeling associated with cardiomyopathies. It is characterized by expansion of the interstitial compartment due to increased deposition of extracellular matrix by activated myofibroblasts. Apart from their role in structural remodeling, myofibroblasts might contribute to arrhythmogenesis by direct modulation of myocardial conduction (Miragoli et al., 2006). The phenotypic switch of CFs to myofibroblasts is therefore of key clinical significance, and the mechanisms underlying such transformation has been of critical interest (Cucoranu et al., 2005; Swaney et al., 2005; Naugle et al., 2006).
We have recently demonstrated that reoxygenation of a focal ischemic site of the heart, in addition to being a trigger for reperfusion injury, induces tissue remodeling (Roy et al., 2003a,b; Sen et al., 2006). Focal ischemia in the heart results in a hypoxic area containing a central focus of near-zero O2 pressure bordered by tissue with diminished but nonzero O2 pressures. These border zones extend for several millimeters from the hypoxic core, with the O2 pressures progressively increasing from the focus to the normoxic region (Sen et al., 2006). Moderate hypoxia is associated with a 30–60% decrease (
1–3%O2) in pO2 (Siaghy et al., 2000). During chronic hypoxia in the heart, cells lower their normoxic set-point (Khanna et al., 2006) such that the return to normoxic pO2 after chronic hypoxia results in perceived hyperoxia (Roy et al., 2003a,b, 2006a; Kuhn et al., 2006, 2007; Sen et al., 2006). Compared with myocytes, CFs are relatively more resistant to oxygen toxicity (Zhang et al., 2001; Liao et al., 2004). As a result, the infarct site, devoid of myocytes, continues to be populated by CFs (Kuhn et al., 2006, 2007). Perceived hyperoxia induces differentiation of CFs to myofibroblasts at the infarct site (Sen et al., 2006). We have previously noted that CFs, isolated from adult murine ventricle, cultured in 10 or 20% O2 (high O2, relative to the pO2 to which cells are adjusted in vivo), compared with 3% O2 (mildly hypoxic), exhibit reversible growth inhibition and a phenotypic switch indicative of differentiation (Roy et al., 2003a). These observations led to the hypothesis that marginal relative elevation in pO2, compared with pO2 to which cells are adjusted during chronic moderate hypoxia, serve as a signal to trigger CF differentiation. In this study, we sought to characterize the novel O2-sensitive molecular mechanisms responsible for triggering the differentiation of CFs to myofibroblasts. This work provides first evidence demonstrating that the cell cycle inhibitor p21waf1/cip1/sdi1, the significance of which in the heart is poorly understood, is sufficient to induce a phenotypic switch of CFs to myofibroblasts. This novel observation is likely to be highly significant to understand fibrosis across various organs.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
,b).
mRNA Quantitation
mRNA was quantified by real-time PCR assay using double-stranded DNA-binding dye SYBR green-I, as described previously (Roy et al., 2003a,b, 2006a,b). The primer sets used for individual genes were as follows: mCDKN1A (p21) F: 5' ACAGGAGCAAAGTGTGCCGTTGT 3'; mCDKN1A (p21) R: 5' GCTCAGACACCAGAGTGCAAGACA 3'; mGAPDH F: 5' ATGACCACAGTCCATGCCATCACT 3'; mGAPDH R: 5' TGTTGAAGTCGCAGGAGACAACCT 3'; mActa2 F: 5' GGCACCACTGAACCCTAAGG 3'; and mActa2 R: 5' TCTCCAGAGTCCAGCACAAT 3'.
Immunofluorescence Microscopy
F-actin (phalloidin, dilution 1:40, Molecular Probes), 
-smooth muscle actin (SMA, Sigma) and p21Cip1/WAF1/Sdi1 (hereafter p21; Santa Cruz) immunostaining and microscopy (Zeiss Axiovert 200M) were performed as described (Roy et al., 2003a,b; Roy et al., 2003b).
Western Blot
Western blot was performed as described previously (Roy et al., 2003a,b). Primary antibodies against SMA (1:4000, Sigma, St. Louis, MO), β-actin (1:5000 Sigma), and p21 (1:200 dilution) were used to detect the corresponding antigens.
CAT and EGFP Reporter Assays
The mouse SMA-CAT promoter-reporter construct used in this study has been described previously (Foster et al., 1992). pVSMP8-EGFP was developed in our laboratories by Dr. Arthur Strauch. The VSMP8 promoter moiety consists of the 5'-flanking and first intronic regions of the mouse SMA gene (Min et al., 1990). Commercial immunoassays were used to measure chloramphenicol acetyltransferase (CAT) reporter proteins as directed by the manufacturer (Promega, Madison, WI).
Cell Counting
Cells were seeded at 5000 cells/well in four-well plates. Before counting, cells were trypsinized and resuspended in a single cell suspension. Counting was performed using a Z1 series Coulter counter as described (Roy et al., 2003a).
Cell Cycle Analysis
Cell cycle profiles were determined using a flow cytometer (Krishan, 1975) and CellQuest software (BD Biosciences, San Jose, CA).
Small Interference RNA Delivery
Lipofectamine 2000 reagent (Invitrogen Corporation, Carlsbad, CA) was used to transfect cells with 100 nM small interference RNA (siRNA) pool (Dharmacon RNA Technologies, Lafayette, CO) for 48 h as described (Khanna et al., 2006). For control, siControl nontargeting siRNA pool (mixture of four siRNA, designed to have 
4 mismatches with known mouse genes) was used.
Survival Model for Coronary Artery Occlusion and Reperfusion
C57BL/6, p21–/– and corresponding wild-type mice were subjected to ischemia-reperfusion of the heart as described previously (Roy et al., 2003b, 2006a; Kuhn et al., 2006). The studies were approved by the Institutional Laboratory Animal Care and Use Committee of The Ohio State University. Mice were anesthetized, intubated, and mechanically ventilated on a positive pressure respirator with room air. The body temperature was maintained at 36–37°C with a heated small-animal operating table. Left thoracotomy was performed via the fifth intercostal space to expose the heart. A 30-min occlusion of left anterior descending coronary artery (LAD) was followed by reperfusion. Laser Doppler flow measurement was used to verify ischemia and reperfusion. On successful reperfusion, the thorax was closed and negative thoracic pressure was reestablished for survival. The mice were killed 7 d after reperfusion. Hearts were either collected frozen in OCT compound for laser capture or in Formalin for histological analyses.
Laser Microdissection and Pressure Catapulting
Laser microdissection and pressure catapulting (LMPC) was performed using the Microlaser System from PALM Microlaser Technologies AG (Bernreid, Germany) as described (Kuhn et al., 2006; Roy et al., 2006a). Briefly, murine hearts with experimental ischemia-reperfusion were isolated, frozen in OCT compound, and then cut into 10-µm sections using a cryo-microtome. The sections were placed on PEN (polyethylene napthalate) membrane glass slides (PALM Microlaser Technologies AG) that had been RNAsin- (Ambion, Austin, TX) and UV-treated, for cutting and catapulting as described by our group recently (Kuhn et al., 2006, 2007). Sections were stained using a modified hematoxylin QS procedure (Kuhn et al., 2006, 2007), and the infarct site was identified as reported. Matched area of myocyte+ control (C) and infarct (I) area were captured in chaotropic RNA lysis solution followed by mRNA quantitation as described (Kuhn et al., 2006; Roy et al., 2006a). RNA extraction, reverse transcription and mRNA quantitation using real-time PCR were performed as described (Kuhn et al., 2006; Roy et al., 2006a).
Histochemistry
Formalin-fixed tissues were embedded in paraffin and sectioned (4 µm) followed by Masson Trichrome staining. This procedure results in blue-black nuclei and blue collagen and cytoplasm. Muscle fibers stained red.
Statistics
In vitro data are reported as mean ± SD of at least three experiments. Comparisons among multiple groups were made by analysis of variance ANOVA. p < 0.05 was considered statistically significant. For in vivo studies data are reported as mean ± SEM of at least three experiments. Data from infarct (I) and corresponding control (C) regions of the same heart were tested on a paired basis. Comparisons among multiple groups were made by analysis of variance ANOVA. p < 0.05 was considered statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Furthermore, we have established that comparison of results from CFs cultured at 5% O2 (in vivo normoxia) with those cultured under standard conditions of 20% O2 (hyperoxia) ambience represents an useful approach to study O2-sensitive changes in the CFs relevant to perceived hyperoxia (Roy et al., 2003a,b). In this study, we utilize the same approach. O2-sensitive mechanisms, relevant to perceived hyperoxia in vivo (Roy et al., 2003b, 2006a; Kuhn et al., 2006, 2007; Sen et al., 2006), were investigated by comparing results obtained from CFs cultured at 5% O2 compared with matched cells of the same isolation cultured at 20% O2. Next, the in vivo relevance of the in vitro findings were tested in a standardized model of ischemia-reperfusion (Roy et al., 2003b, 2006a; Kuhn et al., 2006, 2007). Irreversible acquisition of contractile proteins such as SMA represents a hallmark of the differentiation of CFs to myofibroblasts. Using CFs isolated from adult murine ventricles, we noted that exposure to hyperoxia potently induced Acta2, the gene that encodes SMA (Figure 1A). O2-induced expression of Acta2 was associated with elevated expression of the corresponding protein, SMA (Figure 1B). To test whether the induction of Acta2 by elevated O2 was transcriptionally regulated, vascular smooth muscle promoter (VSMP)-reporter constructs were utilized. Clearly, hyperoxic exposure induced both VSMP-green fluorescent protein (GFP; Figure 1D) as well as VSMP-CAT (Figure 1C) reporters. These findings indicate that the transcription of SMA is sensitive to hyperoxic exposure. Next, we sought to examine whether hyperoxic challenge influenced Acta2 and its protein product. The stability of Acta2 mRNA and corresponding SMA protein were studied in cells treated with actinomycin D or cyclohexamide, respectively. Under conditions of hyperoxia Acta2 mRNA was significantly more stable than Acta2 mRNA in CFs grown at 5% O2 (Figure 2A). Consistently, exposure to hyperoxia slowed the degradation of SMA resulting in higher levels of SMA in hyperoxia-challenged CFs (Figures 2, B and C).
|
|
Our previous work had identified that p21 deficiency abrogates hyperoxia-induced growth arrest of CFs (Roy et al., 2003a). p21 being a well-characterized cell cycle inhibitor, the observation was not unexpected. The observation, however, did kindle our interest to question the functional significance of p21 in the heart. Cellular differentiation is typically associated with growth-arrest. Therefore, we sought to test whether p21 is implicated in hyperoxia-induced differentiation of CFs to myofibroblasts. To test the significance of p21 in hyperoxia-induced differentiation of CFs to myofibroblasts, it was necessary that we have access to approaches that would reliably down-regulate p21 levels in CFs. To that end, we adopted two strategies. First, we studied CFs isolated from the ventricle of adult p21–/– mice. CFs from these mice and their corresponding wild-type littermates showed striking differences in p21 mRNA (Figure 3A) and protein (Figure 3B) levels. When grown under 20% O2 hyperoxic conditions p21 in CFs was densely localized in the nucleus. Because knock-out models may suffer from confounding factors such as genomic changes to compensate for the loss of p21, we chose to employ a p21 knockdown model. The knockdown approach utilized in this study resulted in substantial lowering of p21 expression even in CFs cultured in 20% O2 ambience (Figure 3C). Compared with wild-type mice, Acta2 mRNA level in CFs grown under hyperoxic conditions was significantly lower in CFs from p21–/– mice (Figure 3D). In contrast to the observation in CFs from wild-type mice (Figure 1B), exposure of CFs from p21–/– mice to 20% O2 lowered the expression of SMA (Figure 3, E and F). These findings indicate a key role of p21 in mediating hyperoxia-induced differentiation of CFs to myofibroblasts. Further support for this contention was obtained from the study of CFs from wild-type mice subjected to p21 knockdown. Compared with CFs grown in 20% O2 and treated with scrambled siRNA, CFs with p21 knockdown contained lower levels of both Acta2 mRNA as well as SMA expression (Figure 3, G and H).
|
), results of the current study led to the conclusion that p21 is central to hyperoxia-induced growth arrest, which precedes differentiation of CFs to myofibroblasts.
|
|
). To examine whether TGFβ1 is implicated in p21-dependent differentiation of CFs, p21-infected cells were transfected with siRNA against TGFβ1. TGFβ1 knockdown did not lower p21-dependent expression of Acta2, indicating that p21-induced Acta2 expression is independent of TGFβ1 (Figure 6B). Although there is no known p21 binding site in the Acta2 regulatory sequences represented in the CAT reporter construct, the Acta2 regulatory sequence has binding sites for p53 and YB-1. Our group has previously demonstrated that the cold-shock domain protein YB-1 potently represses -SMA gene transcription in fibroblasts. YB-1 also exhibits additional RNA-binding properties that regulate the translational efficiency of -SMA mRNA (Kelm et al., 1999; Zhang et al., 2005). Our observation that p21 overexpression significantly down-regulates YB-1 protein expression (Figure 6C) supports the hypothesis that p21 decreases YB-1 levels in cells, thereby withdrawing repressory control of YB-1 on the transcription as well as translation of -SMA.
|
). As such, portions of the infarct tissue from which myocytes have been lost to death retain CFs. Recently we have developed a laser capture–based technique to selectively study gene and protein expression in specific regions of the infarcted heart (Kuhn et al., 2006, 2007; Roy et al., 2006a). The approach enabled us to collect tissue elements from the myocyte–/CF+ infarct region and compare it with results from myocyte+/CF+ tissue elements collected <0.5 mm away from the infarct region (Figure 7A). Ischemia-reperfusion resulted in marked p21 induction in the myocyte–/CF+ infarct region (Figure 7B). Consistent with our hypothesis that the surviving CFs at the infarct site undergo phenotypic switch to form myofibroblasts, Acta2 mRNA (Figure 7C) as well as SMA protein (Figure 7, D and E) expression were markedly up-regulated in the CF-rich infarct region. Of note, ischemia-reperfusion induced up-regulation of Acta2 mRNA in the infarct region was completely abrogated in p21-deficient mice (Figure 7F). This observation establishes that p21 is a central regulator of reperfusion-induced phenotypic switch of CFs to myofibroblasts in the infarct region.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), which actively cross-talk with myocytes to determine the quantity and quality of extracellular matrix. Compared with myocytes, CFs are relatively more resistant to oxidant insult (Zhang et al., 2001). Under certain pathological conditions such as aortic regurgitation, CFs produce abnormal proportions of noncollagen extracellular matrix, specifically fibronectin, with relatively little change in collagen synthesis (Borer et al., 2002). A characteristic feature of CFs is their ability to differentiate forming myofibroblasts. Phenotypic switching of CFs to myofibroblast is controlled by a variety of growth factors, cytokines, and mechanical stimuli (Powell et al., 1999; Serini and Gabbiani, 1999; Tomasek et al., 2002). Activation of CFs and cardiac ECM remodeling is necessary after myocardial injury. However, limiting prolonged fibroblast activation and subsequent detrimental extracellular matrix production is a potential approach to preserving left ventricular function. Thus, understanding of the molecular mechanisms regulating differentiation of CFs to myofibroblast may provide a means to inhibit maladaptive tissue remodeling in response to profibrotic stimuli and facilitate the endogenous healing response to injury (Tomasek et al., 2002).
The current study provides novel mechanistic insight into how relative hyperoxic shock, as noted during ischemia-reoxygenation of the heart, may serve as a trigger for the phenotypic switch of CFs to myofibroblasts. Recently, the NADPH oxidase family member Nox4 has been implicated in the differentiation of CFs to myofibroblasts. The reactive oxygen species superoxide mediated the TGFβ1-induced CF differentiation process (Cucoranu et al., 2005). The mechanism described in the current study is distinct from that report because relative hyperoxia-induced transformation of CFs to myofibroblasts has been noted in CFs derived from NADPH oxidase–deficient mice (Roy et al., 2003b). Furthermore, differentiation of CFs to myofibroblasts in response to hyperoxic challenge was not sensitive to antioxidant strategies such as catalase overexpression or treatment of cells with N-acetylcysteine (Roy et al., 2003b). The present work presents first evidence identifying p21 as being singularly sufficient to trigger a phenotypic switch of CFs to myofibroblasts. This finding is consistent with the notion proposed by Nabel (2002) that many of the signaling pathways that control cellular decisions related to tissue remodeling are regulated by nuclear interactions of cell cycle proteins. She rationalized that molecules targeting cyclin-dependent kinases (CDK) or CDK inhibitors (CKI) represent a new class of therapeutic agents that influence tissue remodeling in several organ systems. p21 is a CKI, and the results reported herein are in agreement with the proposal put forth by Nabel.
The cyclin-dependent kinase inhibitor p21 is a major player in cell cycle control. Although induction of p21 predominantly leads to cell cycle arrest, repression of p21 is known to have a variety of outcomes, depending on the context. p21-activated kinases regulate cytoskeletal remodeling (Kumar et al., 2006). Functions of p21, beyond its role as a cell cycle brake, have been hypothesized (Coqueret, 2003). Results of this study identify p21 as a key regulator of the differentiation of CFs to myofibroblasts. TGFβ is a well-known natural inducer of growth inhibition and differentiation in CFs (Frangogiannis et al., 2000; Bujak and Frangogiannis, 2007). Growth arrest caused by TGFβ is mediated through interactions of CDK and CKI. TGFβ induces increased levels of p21 (Li et al., 1995; Reynisdottir et al., 1995; Bachman et al., 2004; Wada et al., 2005). In vascular smooth muscle cells, specific inhibition of p21 protein markedly reduced the production and secretion of the matrix proteins fibronectin and laminin both in the presence and absence of TGFβ stimulation (Weiss and Randour, 2002). Thus, consistent with the findings of the current study noting a lack of TGFβ1 involvement in p21-induced Acta2 expression, the literature suggest that TGFβ is upstream of p21 in the signaling cascade leading to cell cycle arrest and differentiation.
Myofibroblast differentiation is a complex process, regulated by at least a cytokine (TGFβ1) and an extracellular matrix component (the ED-A splice variant of cellular fibronectin), as well as the presence of mechanical tension (Desmouliere et al., 2005). Mechanical tension controls granulation tissue contractile activity and myofibroblast differentiation (Hinz et al., 2001). The myocardium responds to chronic pressure or volume overload by activation and proliferation of CFs and their differentiation into myofibroblasts. Mechanical stretch has been shown to induce p21 in CFs (Liao et al., 2004). Although it is thought that such induction may be responsible for stretch-induced G2/M arrest of CFs, the functional significance of p21 in CF differentiation was not tested. Results of the current study demonstrate that down-regulation of YB-1, a potent repressor of SMA gene transcription, represents a plausible mechanism by which p21 induces SMA expression. TP53, a key protein involved in the transcription of p21 directly interacts with YB-1 and regulates gene expression (Okamoto et al., 2000). Findings reported in this work raise the possibility that mechanical stretch and hyperoxic challenge both cause differentiation of CFs by a common downstream mechanism, e.g., induction of p21. As a CKI, p21 is functional when it is localized in the nucleus. Interestingly, pancreatic myofibroblasts have been observed to contain elevated levels of p21. Withdrawal of p21 from the nucleus to the cytoplasm correlated with dedifferentiation of pancreatic myofibroblast to fibroblast (Manapov et al., 2005). Although these results are not relevant to cells of the heart, they represent valuable reference material, suggesting that the observation of this study identifying p21 as a key determinant of CF differentiation may have broader significance explaining the molecular mechanisms underlying fibrosis across organ types.
The growth-suppressive activities of hyperoxia are known to be mediated, in part, through induction of p21. Using SV40-transformed type II epithelial cells exposed to hyperoxia, Corroyer et al. (1996) were the first to show that hyperoxia induces p21. Subsequent studies in a variety of nontransformed cell lines confirmed that hyperoxia inhibited cell proliferation through induction of p21. Hyperoxia also increased p21 mRNA and protein in terminal bronchiole epithelium and alveolar endothelial and type I and II epithelial cells of adult and newborn mice (Staversky et al., 2002). We recently showed that hyperoxia inhibited cell proliferation of CFs from adult wild-type, but not from p21-deficient mice. Consistent results have been noted in the lung (O'Reilly et al., 2001). This study presents first evidence that beyond causing growth arrest, p21 may act as a trigger for the differentiation of CFs. Thus, p21 may be viewed as a major mediator of ventricular remodeling of the reoxygenated heart.
One of the key determinants of the response of CFs in the clinical context of myocardial damage is its transformation from a quiescent cell primarily responsible for ECM homeostasis, to an activated or differentiated cell that plays a central role in wound healing or fibrosis, depending on the circumstances. The current study identifies a novel opportunity to differentiate CFs by modulating p21 expression. This finding has direct implications in wound healing and in limiting fibrosis after myocardial infarction. The contribution of cardiac fibrosis as an independent risk factor in the outcome of heart failure has been evaluated (Brown et al., 2005). At present, the candidate drug therapies that derive benefit from actions on CFs include inhibitors of angiotensin-aldosterone systems, endothelin receptor antagonists, statins, anticytokine therapies, matrix metalloproteinase inhibitors, and novel antifibrotic/anti-inflammatory agents (Brown et al., 2005). That low oxygen ambience serves as a cue to trigger angiogenesis is a well-accepted notion. Studies related to perceived hyperoxia establish that the sensing of O2 environment is not limited to hypoxia. It demonstrates that in addition to being a trigger for injury as is widely recognized, reoxygenation insult triggers remodeling response via a p21-dependent mechanism. Understanding the underlying mechanisms of this healing response should prove to be instrumental in developing productive therapeutic approaches targeting the CKI pathway.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Chandan K. Sen (chandan.sen{at}osumc.edu).
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Borer, J. S., Truter, S., Herrold, E. M., Falcone, D. J., Pena, M., Carter, J. N., Dumlao, T. F., Lee, J. A., and Supino, P. G. (2002). Myocardial fibrosis in chronic aortic regurgitation: molecular and cellular responses to volume overload. Circulation 105, 1837–1842.
Brilla, C. G. (2000). Renin-angiotensin system mediated mechanisms: cardioreparation and cardioprotection. Heart 84, (Suppl 1), i18–i19. discussion, i50.
Brown, R. D., Ambler, S. K., Mitchell, M. D., and Long, C. S. (2005). The cardiac fibroblast: therapeutic target in myocardial remodeling and failure. Annu. Rev. Pharmacol. Toxicol 45, 657–687.[CrossRef][Medline]
Bujak, M., and Frangogiannis, N. G. (2007). The role of TGF-beta signaling in myocardial infarction and cardiac remodeling. Cardiovasc. Res 74, 184–195.
Burlew, B. S., and Weber, K. T. (2002). Cardiac fibrosis as a cause of diastolic dysfunction. Herz 27, 92–98.[CrossRef][Medline]
Capasso, J. M., Palackal, T., Olivetti, G., and Anversa, P. (1990). Severe myocardial dysfunction induced by ventricular remodeling in aging rat hearts. Am. J. Physiol 259, H1086–H1096.[Medline]
Coqueret, O. (2003). New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment? Trends Cell Biol 13, 65–70.[CrossRef][Medline]
Corroyer, S., Maitre, B., Cazals, V., and Clement, A. (1996). Altered regulation of G1 cyclins in oxidant-induced growth arrest of lung alveolar epithelial cells. Accumulation of inactive cyclin E-DCK2 complexes. J. Biol. Chem 271, 25117–25125.
Cucoranu, I., Clempus, R., Dikalova, A., Phelan, P. J., Ariyan, S., Dikalov, S., and Sorescu, D. (2005). NAD(P)H oxidase 4 mediates transforming growth factor-beta1-induced differentiation of cardiac fibroblasts into myofibroblasts. Circ. Res 97, 900–907.
Desmouliere, A., Chaponnier, C., and Gabbiani, G. (2005). Tissue repair, contraction, and the myofibroblast. Wound Repair Regen 13, 7–12.[CrossRef][Medline]
Eghbali, M., Czaja, M. J., Zeydel, M., Weiner, F. R., Zern, M. A., Seifter, S., and Blumenfeld, O. O. (1988). Collagen chain mRNAs in isolated heart cells from young and adult rats. J. Mol. Cell. Cardiol 20, 267–276.[CrossRef][Medline]
Foster, D. N., Min, B., Foster, L. K., Stoflet, E. S., Sun, S., Getz, M. J., and Strauch, A. R. (1992). Positive and negative cis-acting regulatory elements mediate expression of the mouse vascular smooth muscle alpha-actin gene. J. Biol. Chem 267, 11995–12003.
Frangogiannis, N. G. (2006). The mechanistic basis of infarct healing. Antioxid. Redox Signal 8, 1907–1939.[CrossRef][Medline]
Frangogiannis, N. G., Michael, L. H., and Entman, M. L. (2000). Myofibroblasts in reperfused myocardial infarcts express the embryonic form of smooth muscle myosin heavy chain (SMemb). Cardiovasc Res 48, 89–100.
Hinz, B., Mastrangelo, D., Iselin, C. E., Chaponnier, C., and Gabbiani, G. (2001). Mechanical tension controls granulation tissue contractile activity and myofibroblast differentiation. Am. J. Pathol 159, 1009–1020.
Kelm, R. J., Jr, Cogan, J. G., Elder, P. K., Strauch, A. R., and Getz, M. J. (1999). Molecular interactions between single-stranded DNA-binding proteins associated with an essential MCAT element in the mouse smooth muscle alpha-actin promoter. J. Biol. Chem 274, 14238–14245.
Khanna, S., Roy, S., Maurer, M., Ratan, R. R., and Sen, C. K. (2006). Oxygen-sensitive reset of hypoxia-inducible factor transactivation response: Prolyl hydroxylases tune the biological normoxic set point. Free Radic Biol. Med 40, 2147–2154.[CrossRef][Medline]
Krishan, A. (1975). Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining. J. Cell Biol 66, 188–193.
Kuhn, D., Roy, S., Radtke, J., Khanna, S., and Sen, C. K. (2007). Laser microdissection and capture of pure cardiomyocytes and fibroblasts from infarcted heart regions: perceived hyperoxia induces P21 in peri-infarct myocytes. Am. J. Physiol. Heart Circ. Physiol 292, H1245–H1253.
Kuhn, D. E., Roy, S., Radtke, J., Gupta, S., and Sen, C. K. (2006). Laser microdissection and pressure-catapulting technique to study gene expression in the reoxygenated myocardium. Am. J. Physiol. Heart Circ. Physiol 290, H2625–H2632.
Kumar, R., Gururaj, A. E., and Barnes, C. J. (2006). p21-activated kinases in cancer. Nat. Rev. Cancer 6, 459–471.[CrossRef][Medline]
Laframboise, W. A., Scalise, D., Stoodley, P., Graner, S., Guthrie, R. D., Magovern, J., and Becich, M. (2007). Cardiac fibroblasts influence cardiomyocyte phenotype in vitro. Am. J. Physiol. Cell Physiol 292, (5), C1799–C1808.
Li, C. Y., Suardet, L., and Little, J. B. (1995). Potential role of WAF1/Cip1/p21 as a mediator of TGF-beta cytoinhibitory effect. J. Biol. Chem 270, 4971–4974.
Liao, X. D., Wang, X. H., Jin, H. J., Chen, L. Y., and Chen, Q. (2004). Mechanical stretch induces mitochondria-dependent apoptosis in neonatal rat cardiomyocytes and G2/M accumulation in cardiac fibroblasts. Cell Res 14, 16–26.[CrossRef][Medline]
Manapov, F., Muller, P., and Rychly, J. (2005). Translocation of p21(Cip1/WAF1) from the nucleus to the cytoplasm correlates with pancreatic myofibroblast to fibroblast cell conversion. Gut 54, 814–822.
Min, B. H., Foster, D. N., and Strauch, A. R. (1990). The 5'-flanking region of the mouse vascular smooth muscle alpha-actin gene contains evolutionarily conserved sequence motifs within a functional promoter. J. Biol. Chem 265, 16667–16675.
Miragoli, M., Gaudesius, G., and Rohr, S. (2006). Electrotonic modulation of cardiac impulse conduction by myofibroblasts. Circ. Res 98, 801–810.
Nabel, E. G. (2002). CDKs and CKIs: molecular targets for tissue remodelling. Nature Rev. Drug Disc 1, 587–598.[CrossRef][Medline]
Naugle, J. E., Olson, E. R., Zhang, X., Mase, S. E., Pilati, C. F., Maron, M. B., Folkesson, H. G., Horne, W. I., Doane, K. J., and Meszaros, J. G. (2006). Type VI collagen induces cardiac myofibroblast differentiation: implications for postinfarction remodeling. Am. J. Physiol. Heart Circ. Physiol 290, H323–H330.
O'Reilly, M. A., Staversky, R. J., Watkins, R. H., Reed, C. K., de Mesy Jensen, K. L., Finkelstein, J. N., and Keng, P. C. (2001). The cyclin-dependent kinase inhibitor p21 protects the lung from oxidative stress. Am. J. Respir Cell. Mol. Biol 24, 703–710.
Okamoto, T., Izumi, H., Imamura, T., Takano, H., Ise, T., Uchiumi, T., Kuwano, M., and Kohno, K. (2000). Direct interaction of p53 with the Y-box binding protein, YB- 1, a mechanism for regulation of human gene expression. Oncogene 19, 6194–6202.[CrossRef][Medline]
Powell, D. W., Mifflin, R. C., Valentich, J. D., Crowe, S. E., Saada, J. I., and West, A. B. (1999). Myofibroblasts. I. Paracrine cells important in health and disease. Am. J. Physiol 277, C1–C9.[Medline]
Reynisdottir, I., Polyak, K., Iavarone, A., and Massague, J. (1995). Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell cycle arrest in response to TGF-beta. Genes Dev 9, 1831–1845.
Roy, S. et al. (2003a). Oxygen sensing by primary cardiac fibroblasts: a key role of p21(Waf1/Cip1/Sdi1). Circ. Res 92, 264–271.
Roy, S., Khanna, S., Kuhn, D. E., Rink, C., Williams, W. T., Zweier, J. L., and Sen, C. K. (2006a). Transcriptome analysis of the ischemia-reperfused remodeling myocardium: temporal changes in inflammation and extracellular matrix. Physiol. Genomics 25, 364–374.
Roy, S., Khanna, S., Nallu, K., Hunt, T. K., and Sen, C. K. (2006b). Dermal wound healing is subject to redox control. Mol. Ther 13, 211–220.[CrossRef][Medline]
Roy, S., Khanna, S., Wallace, W. A., Lappalainen, J., Rink, C., Cardounel, A. J., Zweier, J. L., and Sen, C. K. (2003b). Characterization of perceived hyperoxia in isolated primary cardiac fibroblasts and in the reoxygenated heart. J. Biol. Chem 278, 47129–47135.
Sen, C. K., Khanna, S., and Roy, S. (2006). Perceived hyperoxia: oxygen-induced remodeling of the reoxygenated heart. Cardiovasc. Res 71, 280–288.
Serini, G., and Gabbiani, G. (1999). Mechanisms of myofibroblast activity and phenotypic modulation. Exp. Cell Res 250, 273–283.[CrossRef][Medline]
Siaghy, E. M., Devaux, Y., Sfaksi, N., Carteaux, J. P., Ungureanu-Longrois, D., Zannad, F., Villemot, J. P., Burlet, C., and Mertes, P. M. (2000). Consequences of inspired oxygen fraction manipulation on myocardial oxygen pressure, adenosine and lactate concentrations: a combined myocardial microdialysis and sensitive oxygen electrode study in pigs. J. Mol. Cell. Cardiol 32, 493–504.[CrossRef][Medline]
Staversky, R. J., Watkins, R. H., Wright, T. W., Hernady, E., LoMonaco, M. B., D'Angio, C. T., Williams, J. P., Maniscalco, W. M., and O'Reilly, M. A. (2002). Normal remodeling of the oxygen-injured lung requires the cyclin-dependent kinase inhibitor p21(Cip1/WAF1/Sdi1). Am. J. Pathol 161, 1383–1393.
Sun, Y., Zhang, J. Q., Zhang, J., and Lamparter, S. (2000). Cardiac remodeling by fibrous tissue after infarction in rats. J. Lab. Clin. Med 135, 316–323.[CrossRef][Medline]
Swaney, J. S., Roth, D. M., Olson, E. R., Naugle, J. E., Meszaros, J. G., and Insel, P. A. (2005). Inhibition of cardiac myofibroblast formation and collagen synthesis by activation and overexpression of adenylyl cyclase. Proc. Natl. Acad. Sci. USA 102, 437–442.
Tomasek, J. J., Gabbiani, G., Hinz, B., Chaponnier, C., and Brown, R. A. (2002). Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol 3, 349–363.[CrossRef][Medline]
Wada, T., Pippin, J. W., Terada, Y., and Shankland, S. J. (2005). The cyclin-dependent kinase inhibitor p21 is required for TGF-beta1-induced podocyte apoptosis. Kidney Int 68, 1618–1629.[CrossRef][Medline]
Weber, K. T., and Brilla, C. G. (1991). Pathological hypertrophy and cardiac interstitium. Fibrosis and renin-angiotensin-aldosterone system. Circulation 83, 1849–1865.
Weiss, R. H., and Randour, C. J. (2002). Attenuation of matrix protein secretion by antisense oligodeoxynucleotides to the cyclin kinase inhibitor p21(Waf1/Cip1). Atherosclerosis 161, 105–112.[CrossRef][Medline]
Zhang, A., Liu, X., Cogan, J. G., Fuerst, M. D., Polikandriotis, J. A., Kelm, R. J., Jr, and Strauch, A. R. (2005). YB-1 coordinates vascular smooth muscle alpha-actin gene activation by transforming growth factor beta1 and thrombin during differentiation of human pulmonary myofibroblasts. Mol. Biol. Cell 16, 4931–4940.
Zhang, X., Azhar, G., Nagano, K., and Wei, J. Y. (2001). Differential vulnerability to oxidative stress in rat cardiac myocytes versus fibroblasts. J. Am. Coll. Cardiol 38, 2055–2062.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
) mice or corresponding wild-type (
) mice. Cells were cultured at 20% O2 for 5 d followed by infection. CFs from p21–/– were made p21+ by infecting the cells with Adp21 viral vector. Data shown represents % inhibition of oxygen-induced cell growth compared with the respective controls (CFs grown at 5% O2). Mean ± SD; n = 4. *p < 0.01 compared with AdLacZ-infected cells from p21–/– mice. Delivery of p21 to CFs from p21–/– mice restored oxygen-induced growth arrest.
