![]() |
|
|
Vol. 18, Issue 2, 536-546, February 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,

*Division of Cancer Biology and Department of Medicine, Evanston Northwestern Healthcare Research Institute, Evanston, IL 60201; and
Robert H. Lurie Comprehensive Cancer Center, Feinberg School of Medicine, and
Department of Biochemistry, Molecular Biology, and Cell Biology, Northwestern University, Evanston, IL 60201
Submitted May 22, 2006;
Revised November 14, 2006;
Accepted September 27, 2006
Monitoring Editor: John Cleveland
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The exact role of PcG proteins in tumorigenesis is still unclear. However, some of the polycomb proteins, such as Bmi-1 and EZH2, are known to regulate senescence and proliferation via well-known growth regulatory pathways (Jacobs et al., 1999
; Bracken et al., 2003
; Itahana et al., 2003
). For example, Bmi-1 negatively regulates INK4a/ARF locus (Jacobs et al., 1999
), which may impact both p16-pRb and ARF-p53-p21 pathways of cellular senescence (Dimri, 2005
). Indeed, Bmi-1 has been shown to regulate cellular senescence in murine and human cells (Jacobs et al., 1999
; Itahana et al., 2003
). Bmi-1 is also thought to prevent premature senescence of neural stem cells by repressing INK4a/ARF locus (Bruggeman et al., 2005
; Molofsky et al., 2005
). Premature senescence of cells may contribute to organismic aging (Campisi, 2005
). If so, the regulators of senescence are likely to play a role in aging. Indeed, down-regulation of Bmi-1 by the disruption of the SNF2-like gene PASG was shown to result in growth retardation and premature aging in a murine model (Sun et al., 2004
).
Bmi-1 is a particularly interesting oncoprotein; it not only regulates the INK4a/ARF locus, but can also immortalize human mammary epithelial cells (HMECs) (Dimri et al., 2002
). We recently reported that Bmi-1 expression is down-regulated during cellular senescence (Itahana et al., 2003
). Molecular pathways that regulate Bmi-1 expression during cellular senescence are unknown. Identification of such regulatory pathways is important for our understanding of the role of Bmi-1 and other PcG proteins in cell proliferation, oncogenesis, stem cell biology, and aging.
In addition to Bmi-1, mammalian cells also express Mel-18 (also known as polycomb group ring finger 2 or PCGF2), a closely related PcG protein (Ishida et al., 1993
). The Mel-18 gene product is structurally highly similar to Bmi-1. Its N-terminal region, which contains a RING finger domain, is 93% homologous to the similar region of Bmi-1 (Ishida et al., 1993
). The homology toward the C-terminal region, which contains a nuclear localization signal (NLS) and a proline-serinerich (PS) domain, is less conspicuous than the N-terminal region (Ishida et al., 1993
). Bmi-1 and Mel-18 are known to interact and are thought to be the constituents of PRC1 (polycomb repressive complex 1; Alkema et al., 1997
; Ringrose and Paro, 2004
). However, a recent study suggests that Mel-18 may not be part of PRC1, although it could structurally but not functionally replace Bmi-1 in the PRC1 complex (Cao et al., 2005
).
It is thought that Bmi-1 and Mel-18 regulate overlapping and unique sets of genes (Kanno et al., 1995
; Tetsu et al., 1998
, Akasaka et al., 2001
). However, unlike Bmi-1, it has been reported that Mel-18 can bind to a well-defined nucleotide sequence 5'-GACTNGACT-3' present in the promoter region of certain genes (Kanno et al., 1995
). One of the unique target genes of Mel-18 is c-Myc, which is transcriptionally repressed by Mel-18 (Kanno et al., 1995
; Tetsu et al., 1998
). The exact role of Mel-18 in senescence, proliferation, and oncogenesis is unclear. Although its structural similarities to Bmi-1 suggest it to be an oncoprotein, a few studies have indicated that Mel-18 may in fact function as a tumor suppressor (Kanno et al., 1995
; Tetsu et al., 1998
) and that it might negatively regulate self-renewal of HSCs (Kajiume et al., 2004
).
Despite the high similarity between Bmi-1 and Mel-18, we found that Mel-18 overexpression leads to accelerated or premature senescence in proliferating fibroblasts and that it is overexpressed in senescent fibroblasts. We also report that Mel-18 functions as a transcriptional repressor of Bmi-1 expression in human cells. Importantly, we found that the Bmi-1 promoter region contains a functional E-box through which c-Myc and Mel-18 regulate expression of Bmi-1. Because Mel-18 down-regulates c-Myc expression and Bmi-1 is a c-Myc target, our data suggest that Mel-18 regulates expression of Bmi-1 via repression of c-Myc during cellular senescence.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-gal) assay as described (Dimri et al., 1995
Molecular Reagents and Methods: Retroviral Expression and Short-Hairpin RNA Vectors
The vector containing cDNAs of Mel-18 and c-Myc were obtained from ATCC (American Type Culture Collection, Manassas, VA). Mel-18 cDNA was amplified and cloned either in pLPC retroviral vector obtained from Dr. J. Campisi (originally from Dr. T. deLange, Rockefeller University, New York) or in pBabe-puro vector (Dimri et al., 2000
). Bmi-1 and Mel-18 short-hairpin RNAs (shRNAs) were designed and cloned in the retroviral vector pRS (retro-super) obtained from Oligoengine (Seattle, WA). The sequences of shRNA were as follows: Mel-18 no. 1: CGACGCCACCACUAUCGUG; no. 2: AGACCAACAAAUACUGCCC; and Bmi-1 shRNA no. 1 GUUCACAAGACCAGACCAC and no. 2 GACCAGACCACUACUGAAU. A retroviral vector expressing c-Myc shRNA (clone no. SH2236-B-10) was obtained from Open Biosystems (Huntsville, AL).
Promoter-Reporter Vectors and Luciferase Assays
The promoter region of Bmi-1 was identified by BLAST comparison of the untranslated region of Bmi-1 cDNA with human genomic clones and analyzing the region further upstream of it. The putative promoter region was amplified using a BAC clone RP11-573G6 obtained from the Children's Hospital Oakland Research Institute, Oakland, CA. The promoter regions of different sizes were amplified by PCR and cloned in the pGL3 luciferase reporter vector (Promega, Madison, WI). The reporter assays were performed using a luciferase assay kit (Promega) as described (Dimri et al., 2002
).
Chromatin Immunoprecipitation Assays
Chromatin immunoprecipitation (ChIP) assays were performed using a kit from Upstate Cell Signaling Solutions (Charlottesville, VA). Briefly, chromatin that was cross-linked to transcription factors was immunoprecipitated using antibodies against c-Myc or Mel-18 (obtained from Santa Cruz Biotechnology, Santa Cruz, CA). The immunoprecipitated chromatin was amplified using 5'ACGGGCCTGACTACACCGACACT3' and 5'CTGAAGGCAGAGTGGAAACTGACAC3' primers, which flank the c-Myc binding site of the Bmi-1 promoter. The primers- 5'TTCAAAGGCATCTTCTGCAG3' and 5'CTTAACCGCCCAGATACATC3', which amplify a non-Myc binding region of the Bmi-1 promoter were used as a negative control.
Quantitative Real-Time RT-PCR Assays
The real-time RT-PCR (QRT-PCR) was carried out using Brilliant SYBR Green QRT-PCR Master Mix, 2-Step kit (Stratagene, La Jolla, CA). Briefly, total RNA was isolated using TRIzol reagent as described by manufacturer (Invitrogen, Carlsbad, CA), and treated with DNase (Promega) to remove any contaminating genomic DNA. The cDNA was generated using oligo dT primer mix and 2.0 µg of DNase treated total RNA. The cDNA was PCR-amplified using primers specific for GAPDH, c-Myc, and Bmi-1. The PCR amplification was carried out using Mx 3000P QPCR system (Stratagene). The PCR conditions consisted of an initial activation of SureStart Taq DNA polymerase at 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C for 1 min. The Ct (threshold cycle) value of Bmi-1 or c-Myc amplification was normalized to that of GAPDH control. The primers for QRT-PCR were as follows: GAPDH forward (F), 5' GCTGAACGGGAAGCTCACTG 3'; GAPDH reverse (R), 5'GTGCTCAGTGTAGCCCAGGA 3'; Bmi-1 F, 5' TGGAGAAGGAATGGTCCACTTC 3'; Bmi-1 R, 5' GTGAGGAAACTGTGGATGAGGA 3'; and c-Myc F, 5' TACATCCTGTCCGTCCAAGCA 3'; and c-Myc R, 5' TCAGCCAAGGTTGTGAGGTTG 3'.
Quantitative real-time PCR to detect primary transcription, referred to as PT RT-PCR (primary transcript real-time RT-PCR) was carried out as described (Murray, 2005
). Briefly, DNase-treated RNA was reverse-transcribed using random primer mix and amplified using primers that amplify a region of
200 base pairs of reverse-transcribed unspliced RNAs. The primers for PT RT-PCR were as follows: Bmi-1 F, 5' CGTGTATTGTTCGTTACCTGGA3' (present in Exon 2); Bmi-1 R, 5' GGCAAGAAATTAAACGGCTACC3' (present in Intron 3); c-Myc F, 5'GTCCAGAGACCTTTCTAACGTA3' (present in Intron 2); and c-Myc R, 5'AGAAGGTGATCCAGACTCTGAC3' (present in Exon 3).
Immunological Reagents, Western Blot Analysis, and Determination of Protein Half-Life
Bmi-1 was detected using either F6 mouse mAb from Upstate Cell Signaling Solutions or 1H6B10G7 mAb from Zymed (South San Francisco, CA). Mel-18 was detected by a rabbit polyclonal H-115 (Santa Cruz Biotechnology). The 9E10 mAb (Santa Cruz Biotechnology) against c-Myc was used to detect the expression of c-Myc tag in exogenously expressed proteins. p14ARF was detected using a rabbit polyclonal H-132 Ab (Santa Cruz Biotechnology). Western blot analyses to detect the expression of various proteins were performed as described (Dimri et al., 2000
; Itahana et al., 2003
). Protein half-life was determined using cyclohexamide (CHX) treatment to block the synthesis of new protein or by pulse-chase immunoprecipitation (IP) experiment using in vivo labeling of proteins with 35S-Express labeling mix (cat. no. NE-072, PerkinElmer Life and Analytical Sciences, Wellesley, MA) followed by chase with cold methionine/cysteine mix for different time points and IP using a specific antibody as described (Boyer et al., 1996
).
| RESULTS |
|---|
|
|
|---|
-gal staining (Figure 1A, bottom panel, and Supplementary Figure 1). To further explore the mechanism of induction of premature senescence by Mel-18, we examined the expression of various senescence-associated genes in control and Mel-18 and Bmi-1overexpressing MRC-5 fibroblasts (Figure 1A, right panel). Because, c-Myc has been reported to be down-regulated by Mel-18 (Tetsu et al., 1998
|
To confirm the results of overexpression studies, we further determined if knockdown of Mel-18 expression by RNA interference (RNAi) approach up-regulates Bmi-1 and extends the replicative life span. Indeed, stable overexpression of two different Mel-18 shRNAs extended the replicative life span in MRC-5 fibroblasts (Figure 1B). Mel-18 shRNA-expressing cells also exhibited considerably less numbers of senescent cells (Figure 1B). Consistent with overexpression studies, Western blot analysis of Mel-18 knockdown cells showed up-regulation of Bmi-1, down-regulation of p16, and a consequent increase in pRb phosphorylation (Figure 1B). We also used stable expression of two different shRNAs (Bmi-1 RNAi no. 1 and Bmi-1 RNAi no. 2) against Bmi-1 and determined the replicative life span of MRC-5 fibroblasts. Western blot analysis indicated that only Bmi-1 RNAi no. 2 was effective in down-regulating Bmi-1 expression (Supplementary Figure 2). Furthermore, our results indicated that similar to Mel-18 overexpression, Bmi-1 knockdown by RNAi no. 2 accelerates the entry of cells into senescence by up-regulating p16 and increasing the growth inhibitory form of pRb (Supplementary Figure 2).
Mel-18 Expression Is Up-regulated during Cellular Senescence in HDFs
We have previously reported that Bmi-1 expression is down-regulated during cellular or replicative senescence in HDFs (Itahana et al., 2003
). The molecular basis of Bmi-1 down-regulation during cellular senescence is not known. On the basis of our data, we surmised that Mel-18 expression might be up-regulated during senescence, which would result in down-regulation of Bmi-1 expression. Conversely, low levels of Mel-18 or absence of its expression in presenescent cells may permit high Bmi-1 expression in these cells. To address these hypotheses, we prepared total cell extract from presenescent (Presen), and senescent (Sen) cells of MRC5, BJ, and WI-38 fibroblast strains and examined Mel-18, Bmi-1, c-Myc, pRb, and p16 expression by Western blot analysis. The onset of senescence in these fibroblast strains was determined using SA-
-gal marker (Dimri et al., 1995
). Consistent with our previous results (Itahana et al., 2003
), Bmi-1 was down-regulated during cellular senescence (Figure 2A). Importantly, down-regulation of Bmi-1 also correlated with reduced c-Myc expression and a marked increase in Mel-18 expression in senescent cells (Figure 2A).
|
Mel-18 Regulates Bmi-1 and c-Myc Expression
To further confirm that Mel-18 regulates Bmi-1 expression and to gain insight into its mechanisms, we carried out Mel-18 overexpression and Mel-18 knockdown studies in multiple cell types. Our results indicated that similar to MRC-5 fibroblasts, stable overexpression of Mel-18 results in Bmi-1 down-regulation in MCF10A and MCF7 cells (Figure 3A). We also examined the expression of c-Myc in Mel-18overexpressing cells. Consistent with the published report (Tetsu et al., 1998
), Mel-18 overexpression led to down-regulation of c-Myc in multiple cell types (Figures 1A and 3A).
|
RING Finger of Mel-18 Is Required for the Down-Regulation of Bmi-1
To identify the structural domain(s) of Mel-18 required for Bmi-1 down-regulation, we generated
RF (lacks RING finger domain),
RFNLS (lacks RING finger and nuclear localization signal), and
PS (lacks a PS region) mutants (Figure 4A). These mutants were stably overexpressed in MCF10A cells (Figure 4B). Next, we examined the expression of c-Myc and Bmi-1 in cells stably overexpressing wild type or different mutants of Mel-18. The results (Figure 4B) indicated that wild-type Mel-18 and the
PS mutant, both of which contained intact RING finger domain down-regulated Bmi-1 expression, suggesting that the RING finger domain of Mel-18 is required for down-regulation of Bmi-1. As expected, overexpression of wild type and the
PS mutant also led to c-Myc down-regulation. Interestingly,
RF and
RFNLS mutants of Mel-18 up-regulated Bmi-1 and c-Myc expression (Figure 4B).
|
|
20 min (Figure 5B). Because CHX treatment leads to the generation of multiple bands of Bmi-1, which appear to have different half-lives, we confirmed the half-life of newly synthesized Bmi-1 by a pulse-chase IP experiment (Supplementary Figure 3). The results indicated that Bmi-1 has a half-life of
30 min in both vector control and Mel-18overexpressing cells. Collectively, these data indicate that Mel-18 does not significantly alter Bmi-1 protein stability. Because Mel-18 did not appear to regulate Bmi-1 expression via protein stability, we determined whether Mel-18 could regulate the transcription of the Bmi-1 gene. To examine this possibility, we first performed a QRT-PCR to determine the mRNA levels of Bmi-1 and c-Myc in control and Mel-18overexpressing MCF 10A and MCF7 cells. Our data indicated that Mel-18 down-regulates both Bmi-1 and c-Myc at the mRNA level (Figure 6A). Using QRT-PCR, we also determined whether knockdown of Mel-18 up-regulates mRNA levels of Bmi-1 and c-Myc in MCF10A cells. Our data indicated that knockdown of Mel-18 expression indeed leads to up-regulation of c-Myc and Bmi-1 at the mRNA level (Figure 6B). Thus, our results suggest that Mel-18 possibly regulates transcription of Bmi-1, perhaps via down-regulation of c-Myc at the mRNA level.
|
To determine if Bmi-1 is regulated by c-Myc via the E-box present in the Bmi-1 promoter, we first performed ChIP assay using vector control and Mel-18overexpressing MCF7 and MCF10A cells. The cross-linked chromatin was immunoprecipitated (IPed) using a rabbit polyclonal Ab against c-Myc and the control rabbit IgG, and the PCR was performed using primers (c-Myc primer set) that flank c-Myc binding sites in the Bmi-1 promoter. A primer set derived from further upstream sequences that does not flank the c-Myc binding site was used as a control primer set. The results indicated that c-Myc primer set was specifically able to amplify the PCR product of an expected size (200 base pairs) from the vector control cells (Figure 7A). The yield of the PCR product was much less in Mel-18overexpressing cells, indicating the down-regulation of c-Myc in Mel-18overexpressing cells (Figure 7A). The control primer set using c-Myc and IgG IPed extracts did not yield any PCR product indicating the specificity of binding of c-Myc to the E-box present in the Bmi-1 promoter (Figure 7A).
|
Next, three different Bmi-1 promoter-reporter constructs based on the pGL3 vector were generated (Figure 7B). pGL3-Bmi PrWT contained the +45 to 233 region of the Bmi-1 promoter and untranslated region of Bmi-1 mRNA. The second construct pGL3-Bmi PrMut contained a mutation in the Myc binding sequences (CACGTG changed to CGCGTG). The third construct pGL3-Bmi Pr
Myc contained a complete deletion of the c-Myc binding site. We determined the luciferase activity driven by wild-type or mutant promoters. The results indicated that wild-type promoter displays robust promoter activity, whereas the mutant promoters exhibited 50% less activity than the wild-type promoter (Figure 7B).
We further studied the regulation of the Bmi-1 promoter by c-Myc and Mel-18 (Figure 8, AC). The promoter-reporter constructs were cotransfected with increasing amounts of Mel-18overexpressing plasmid (Figure 8A), c-Myc overexpressing plasmid (Figure 8B), or a plasmid expressing c-Myc shRNA (Figure 8C). Analysis of the luciferase activity of these promoter-reporter constructs suggested that Mel-18 negatively regulates the Bmi-1 promoter through the c-Myc binding site, because the promoter that lacked the E-box or contained mutant c-Myc binding site did not respond to increasing concentrations of the Mel-18 expressing plasmid (Figure 8A). Furthermore, the transient cotransfection of c-Mycoverexpressing plasmid led to the up-regulation of activity of wild-type but not mutant promoters (Figure 8B). Similarly, knockdown of c-Myc expression by transfection of a plasmid expressing c-Myc shRNA down-regulated Bmi-1 promoter activity of the promoter that contained the wild-type c-Myc binding site (Figure 8C).
|
|
Bmi-1 Is a Bona Fide Target of c-Myc, and c-Myc Overexpression Rescues Mel-18mediated Repression of Bmi-1 Expression
To further confirm that the endogenous promoter of Bmi-1 is regulated by c-Myc, we studied the expression of Bmi-1 in MCF10A cells, which stably overexpress c-Myc under a retroviral promoter (Figure 10A), and in MCF10A cells where the expression of c-Myc was stably knockdown by the RNAi approach (Figure 10B). Our data suggest that the stable overexpression of c-Myc results in up-regulation of Bmi-1 expression (Figure 10B). Accordingly, we also found that knockdown of c-Myc expression using the RNAi approach results in a substantial down-regulation of endogenous Bmi-1 expression (Figure 10B).
|
| DISCUSSION |
|---|
|
|
|---|
Our novel observation suggests that Mel-18 is an upstream negative regulator of Bmi-1 function, which promotes proliferation, oncogenesis, and stem "cell-ness." Consistent with such an observation, Bmi-1 knockdown by RNAi as well as its down-regulation by Mel-18 overexpression in cells resulted in accelerated senescence. As senescence constitutes a tumor suppressor mechanism and is regulated by various tumor suppressors (Dimri, 2005
), our results clearly place Mel-18 in the tumor suppressor category. It is known that various tumor suppressors are either up-regulated (for example, p16) or the physiological activity of tumor suppressors is up-regulated during senescence (Dimri, 2005
). For example, DNA binding activity of p53 is up-regulated, and there is a relative increase in hypophosphorylated pRb compared with hyperphosphorylated pRb during senescence (Dimri, 2005
). Forced expression of p16, p14ARF, and other tumor suppressors has been shown to accelerate senescence in human cells (Dimri, 2005
). Consistent with these properties of tumor suppressors, we found that Mel-18 is up-regulated during senescence in human fibroblasts, which contributes to down-regulation of c-Myc and Bmi-1 oncoproteins. Accelerated senescence in Mel-18overexpressing fibroblasts is accompanied by down-regulation of Bmi-1, robust p16 up-regulation, and an increase in hypophosphorylated pRb.
In contrast to wild-type Mel-18, RING finger mutants up-regulate Bmi-1, suggesting potential dominant negative activity (DN) of these mutants. RING finger mutants may bind to the promoter of presumptive target(s), which may be Bmi-1 itself or the other target(s) that regulate Bmi-1, and inhibit the function of nuclear Mel-18. However, if this was the case,
RFNLS should not have exhibited a DN activity because it lacks the nuclear localization signal. We speculate that RING finger mutants may simply up-regulate Bmi-1 by inhibiting the function of endogenous Mel-18, by binding it and sequestering it in the cytoplasm. Detailed mechanism of Bmi-1 up-regulation by RING mutants remains to be studied.
Although, Mel-18 can regulate its target genes by binding to the promoter regions, the Bmi-1 promoter does not contain presumptive Mel-18 binding sequences. However, it remains possible that Mel-18 regulates Bmi-1 expression by repressing a positive regulator of Bmi-1. Indeed, we found that the Bmi-1 promoter contains an E-box to which a positive or negative regulator of Bmi-1 can bind. Identification of an E-box in the Bmi-1 promoter is very intriguing from an oncogenesis point of view. A number of E-box binding proteins are known, some of which act as repressors, whereas others act as activators of transcription. The c-Myc family of transcription factors, which bind to the E-box, are clearly implicated in oncogenesis. The c-Myc oncogene is amplified and/or overexpressed in a variety of malignancies (see Myc Cancer Gene web site: http://www.myccancergene.org). It acts as a transcription factor and regulates the expression of a number of genes (Zeller et al., 2003
; Adhikary and Eilers, 2005
). However, it is still unclear what the cancer-relevant bona fide targets of c-Myc are. Here, we identified Bmi-1 oncogene as an important target of c-Myc oncoprotein. Similar to our results, a very recent report has also implicated c-Myc in regulation of Bmi-1 expression and induction of telomere-independent senescence by reduced c-Myc levels and a consequent increase in p16 (Guney et al., 2006
).
c-Myc oncoprotein dimerizes with Max, which is usually in excess. Myc-Max complexes positively regulate expression of Myc target genes. Myc and Max also dimerizes with Mad1, Mxi-1, Mad3, Mad4, and Mnt (Adhikary and Eilers, 2005
). Heterodimers of these proteins also bind to the E-box and often negatively regulate the expression of the target genes. It is very likely that Bmi-1 is negatively regulated by Max-Mad and Mnt-Max complexes. Thus, our studies suggest that c-Myc and other E-box binding proteins may positively or negatively regulate Bmi-1, which in turn regulates proliferation, senescence, oncogenesis, and stem cell-ness. Besides E-box binding proteins, other transcription factors may also regulate the expression of Bmi-1. Indeed, a recent report suggests that E2F 1 also regulates Bmi-1 expression (Nowak et al., 2006
). Moreover, we did not find any positive correlation between Bmi-1 and c-Myc expression during quiescence, suggesting that under quiescence condition, transcription factors other than c-Myc regulate the expression of Bmi-1. Such regulators of Bmi-1 remain to be identified.
Our studies suggest that Mel-18 is a physiological regulator of Bmi-1 expression in human fibroblasts and mammary epithelial cells. On the basis of our data, we suspect that this inverse correlation between Bmi-1 and Mel-18 expression may persist with other cell types and various cancers. Indeed, our preliminary data suggest a strong negative correlation between Bmi-1 and Mel-18 expression in a significant number of breast tumors. It has been suggested that Bmi-1 may be a cancer stem cell marker (Lessard and Sauvageau, 2003
; Glinsky et al., 2005
); it will be interesting to explore whether Mel-18 down-regulation in certain specific cell types makes them susceptible to cancer stem cell conversion.
In summary, our studies suggest that the Mel-18-c-Myc-Bmi-1-p16-pRb pathway regulates cellular senescence and proliferation in human cells. Additionally, Mel-18 and Bmi-1 can also regulate p14ARF expression, which may contribute to the regulation of proliferation and senescence via p53-independent mechanisms. Although there has already been considerable interest in c-Myc, p16, p14ARF, and pRb, our data suggest that PcG protein Mel-18 and Bmi-1 are also valid targets for cancer therapy. For example, restoration of Mel-18 expression or ablation of Bmi-1 expression in tumors by various therapeutic approaches might help in cancer treatment. Lastly, because stem cell defect has been linked to various age-related pathologies (reviewed in Ho et al., 2005
; Rosenthal, 2005
), we speculate that Mel-18 may play an important role in the development of age-related ailments by virtue of down-regulating Bmi-1, a known regulator of stem cell-ness.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Goberdhan P. Dimri (g-dimri{at}northwestern.edu)
| REFERENCES |
|---|
|
|
|---|
Akasaka, T., van Lohuizen, M., van der Lugt, N., Mizutani-Koseki, Y., Kanno, M., Taniguchi, M., Vidal, M., Alkema, M., Berns, A., Koseki, H. (2001). Mice doubly deficient for the Polycomb Group genes Mel18 and Bmi1 reveal synergy and requirement for maintenance but not initiation of Hox gene expression. Development 128, 15871597.[Abstract]
Alkema, M. J., Bronk, M., Verhoeven, E., Otte, A., van't Veer, L. J., Berns, A., van Lohuizen, M. (1997). Identification of Bmi1-interacting proteins as constituents of a multimeric mammalian polycomb complex. Genes Dev 11, 226240.
Boyer, S. N., Wazer, D. E., Band, V. (1996). E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteosome pathway. Caner Res 56, 46204624.
Bracken, A. P., Pasini, D., Capra, M., Prosperini, E., Colli, E., Helin, K. (2003). EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer. EMBO J 22, 53235335.[CrossRef][Medline]
Bruggeman, S. W., et al. (2005). Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice. Genes Dev 19, 14381443.
Campisi, J. (2005). Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell 120, 513522.[CrossRef][Medline]
Cao, R., Tsukada, Y., Zhang, Y. (2005). Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol. Cell 20, 845854.[CrossRef][Medline]
Dimri, G. P. (2005). What has senescence got to do with cancer? Cancer Cell 7, 505512.[CrossRef][Medline]
Dimri, G. P., Itahana, K., Acosta, M., Campisi, J. (2000). Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14(ARF) tumor suppressor. Mol. Cell. Biol 20, 273285.
Dimri, G. P., et al. (1995). A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 92, 93639367.
Dimri, G. P., Martinez, J. L., Jacobs, J. J., Keblusek, P., Itahana, K., van Lohuizen, M., Campisi, J., Wazer, D. E., Band, V. (2002). The Bmi-1 oncogene induces telomerase activity and immortalizes human mammary epithelial cells. Cancer Res 62, 47364745.
Gil, J., Bernard, D., Peters, G. (2005). Role of polycomb group proteins in stem cell self-renewal and cancer. DNA Cell Biol 24, 117125.[CrossRef][Medline]
Glinsky, G. V., Berezovska, O., Glinskii, A. B. (2005). Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer. J. Clin. Invest 115, 15031521.[CrossRef][Medline]
Guney, I., Wu, S., Sedivy, J. M. (2006). Reduced c-Myc signaling triggers telomere-independent senescence by regulating Bmi-1 and p16INK4a. Proc. Natl. Acad. Sci. USA 103, 36453650.
Ho, A. D., Wagner, W., Mahlknecht, U. (2005). Stem cells and ageing. The potential of stem cells to overcome age-related deteriorations of the body in regenerative medicine. EMBO Rep. Jul S35S38 6 Spec No.
Ishida, A., Asano, H., Hasegawa, M., Koseki, H., Ono, T., Yoshida, M. C., Taniguchi, M., Kanno, M. (1993). Cloning and chromosome mapping of the human Mel-18 gene which encodes a DNA-binding protein with a new RING-finger motif. Gene 129, 249255.[CrossRef][Medline]
Itahana, K., Campisi, J., Dimri, G. P. (2004). Mechanisms of cellular senescence in human and mouse cells. Biogerontology 5, 110.
Itahana, K., Zou, Y., Itahana, Y., Martinez, J.-L., Beausejour, C., Jacobs, J.J.L., van Lohuizen, M., Band, V., Campisi, J., Dimri, G. P. (2003). Control of the replicative life span of human fibroblasts by p16 and the polycomb protein Bmi-1. Mol. Cell. Biol 23, 389401.
Iwama, A., et al. (2004). Enhanced self-renewal of hematopoietic stem cells mediated by the polycomb gene product Bmi-1. Immunity 21, 843851.[CrossRef][Medline]
Jacobs, J.J.L., Kieboom, K., Marino, S., DePinho, R. A., van Lohuizen, M. (1999). The oncogene and polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 397, 164168.[CrossRef][Medline]
Kajiume, T., Ninomiya, Y., Ishihara, H., Kanno, R., Kanno, M. (2004). Polycomb group gene mel-18 modulates the self-renewal activity and cell cycle status of hematopoietic stem cells. Exp. Hematol 32, 571578.[CrossRef][Medline]
Kanno, M., Hasegawa, M., Ishida, A., Isono, K., Taniguchi, M. (1995). mel-18, a Polycomb group-related mammalian gene, encodes a transcriptional negative regulator with tumor suppressive activity. EMBO J 14, 56725678.[Medline]
Kim, J. H., Yoon, S. Y., Jeong, S. H., Kim, S. Y., Moon, S. K., Joo, J. H., Lee, Y., Choe, I. S., Kim, J. W. (2004). Overexpression of Bmi-1 oncoprotein correlates with axillary lymph node metastases in invasive ductal breast cancer. Breast 13, 383388.[CrossRef][Medline]
Kleer, C. G., et al. (2003). EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proc. Natl. Acad. Sci. USA 100, 1160611611.
Lessard, J. and Sauvageau, G. (2003). Bmi-1 determines the proliferative capacity of normal and leukemic stem cells. Nature 423, 255260.[CrossRef][Medline]
Liu, S., Dontu, G., Mantle, I. D., Patel, S., Ahn, N. S., Jackson, K. W., Suri, P., Wicha, M. S. (2006). Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human mammary stem cells. Cancer Res 66, 60636071.
Molofsky, A. V., He, S., Bydon, M., Morrison, S. J., Pardal, R. (2005). Bmi-1 promotes neural stem cell self-renewal and neural development but not mouse growth and survival by repressing the p16Ink4a and p19Arf senescence pathways. Genes Dev 19, 14321437.
Molofsky, A. V., Pardal, R., Iwashita, T., Park, I. K., Clarke, M. F., Morrison, S. J. (2003). Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation. Nature 425, 962967.[CrossRef][Medline]
Murray, P. J. (2005). The primary mechanism of the IL-10-regulated antiinflammatory response is to selectively inhibit transcription. Proc. Natl. Acad. Sci. USA 102, 86868691.
Nowak, K., Kerl, K., Fehr, D., Kramps, C., Gessner, C., Killmer, K., Samans, B., Berwanger, B., Christiansen, H., Lutz, W. (2006). BMI1 is a target gene of E2F-1 and is strongly expressed in primary neuroblastomas. Nucleic Acids Res 34, 17451754.
Park, I.-K., Qian, D., Kiel, M., Becker, M., Pihalja, M., Weissman, I. L., Morrison, S. J., Clarke, M. (2003). Bmi-1 is required for the maintenance of adult self-renewing hematopoietic stem cells. Nature 423, 302305.[CrossRef][Medline]
Pickart, C. M. (2001). Mechanisms underlying ubiquitination. Annu. Rev. Biochem 70, 503533.[CrossRef][Medline]
Ringrose, L. and Paro, R. (2004). Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu. Rev. Genet 38, 413443.[CrossRef][Medline]
Rosenthal, N. (2005). Youthful prospects for human stem-cell therapy. In another few decades, revised attitudes toward stem cells could lead to disease prevention and life extension. EMBO Rep. Jul S30S34 6 Spec No.
Sherr, C. J., Bertwistle, D., Den Bestn, W., Kuo, M. L., Sugimoto, M., Tago, K., Williams, R. T., Zindy, F., Roussel, M. F. (2005). p53-Dependent and -independent functions of the Arf tumor suppressor. Cold Spring Harb. Symp. Quant. Biol 70, 129137.[CrossRef][Medline]
Sun, L. Q., Lee, D. W., Zhang, Q., Xiao, W., Raabe, E. H., Meeker, A., Miao, D., Huso, D. L., Arceci, R. J. (2004). Growth retardation and premature aging phenotypes in mice with disruption of the SNF2-like gene, PASG. Genes Dev 18, 10351046.
Tetsu, O., Ishihara, H., Kanno, R., Kamiyasu, M., Inoue, H., Tokuhisa, T., Taniguchi, M., Kanno, M. (1998). mel-18 negatively regulates cell cycle progression upon B cell antigen receptor stimulation through a cascade leading to c-myc/cdc25. Immunity 9, 439448.[CrossRef][Medline]
Valk-Lingbeek, M. E., Bruggeman, S. W., van Lohuizen, M. (2004). Stem cells and cancer: the polycomb connection. Cell 118, 409418.[CrossRef][Medline]
Varambally, S., et al. (2002). The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature 419, 624629.[CrossRef][Medline]
Waters, C. M., Littlewood, T. D., Hancock, D. C., Moore, J. P., Evan, G. I. (1991). c-myc protein expression in untransformed fibroblasts. Oncogene 6, 797805.[Medline]
Zeller, K. I., Jegga, A. G., Aronow, B. J., O'Donnell, K. A., Dang, C. V. (2003). An integrated database of genes responsive to the Myc oncogenic transcription factor: identification of direct genomic targets. Genome Biol 4, R69.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
L. Jiang, J. Li, and L. Song Bmi-1, stem cells and cancer Acta Biochim Biophys Sin, July 1, 2009; 41(7): 527 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Colecchia, D. Kottwitz, M. Wagner, C. V. Pfenninger, G. Thiel, I. Tamm, C. Peterson, and U. A. Nuber Tissue-specific regulatory network extractor (TS-REX): a database and software resource for the tissue and cell type-specific investigation of transcription factor-gene networks Nucleic Acids Res., June 1, 2009; 37(11): e82 - e82. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Douglas, J. H.-R. Hsu, L. Hung, A. Cooper, D. Abdueva, J. van Doorninck, G. Peng, H. Shimada, T. J. Triche, and E. R. Lawlor BMI-1 Promotes Ewing Sarcoma Tumorigenicity Independent of CDKN2A Repression Cancer Res., August 15, 2008; 68(16): 6507 - 6515. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. M. Li, D. K. Smith, W. Y. Leung, A. M. S. Cheung, E. W. F. Lam, G. P. Dimri, and K.-M. Yao FoxM1c Counteracts Oxidative Stress-induced Senescence and Stimulates Bmi-1 Expression J. Biol. Chem., June 13, 2008; 283(24): 16545 - 16553. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Lee, K.-S. Jang, D.-H. Shin, M.-Y. Oh, H.-J. Kim, Y. Kim, and G. Kong Mel-18 Negatively Regulates INK4a/ARF-Independent Cell Cycle Progression via Akt Inactivation in Breast Cancer Cancer Res., June 1, 2008; 68(11): 4201 - 4209. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Datta, M. J. Hoenerhoff, P. Bommi, R. Sainger, W.-J. Guo, M. Dimri, H. Band, V. Band, J. E. Green, and G. P. Dimri Bmi-1 Cooperates with H-Ras to Transform Human Mammary Epithelial Cells via Dysregulation of Multiple Growth-Regulatory Pathways Cancer Res., November 1, 2007; 67(21): 10286 - 10295. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, E. H.-Y. Cheng, and J. J.-D. Hsieh Bimodal degradation of MLL by SCFSkp2 and APCCdc20 assures cell cycle execution: a critical regulatory circuit lost in leukemogenic MLL fusions Genes & Dev., October 1, 2007; 21(19): 2385 - 2398. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-J. Guo, M.-S. Zeng, A. Yadav, L.-B. Song, B.-H. Guo, V. Band, and G. P. Dimri Mel-18 Acts as a Tumor Suppressor by Repressing Bmi-1 Expression and Down-regulating Akt Activity in Breast Cancer Cells Cancer Res., June 1, 2007; 67(11): 5083 - 5089. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||