![]() |
|
|
Vol. 18, Issue 3, 732-742, March 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

*Weis Center for Research, Geisinger Clinic, Danville, PA 17822; and
Department of Orthopaedics and Rehabilitation, Penn State College of Medicine, Hershey, PA 17033
Submitted February 16, 2006;
Revised November 9, 2006;
Accepted December 3, 2006
Monitoring Editor: Jean Gruenberg
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The members of the ACK family function in regulation of cell growth. Ark-1 has shown to inhibit EGFR signals and suppress cell division in embryo development (Hopper et al., 2000
). Overexpression of ACK2 in NIH3T3 cells severely impairs cell growth (Yang et al., 2001a
). Kos-1, the homologue to the N-terminus portion of Tnk1 and ACK, suppresses Ras-mediated cellular transformation (Hoare et al., 2003
). Gene33, the homologue to the carboxy terminus of ACK that includes Cdc42-binding and proline-rich domains, inhibits tyrosine phosphorylation and signaling of EGFR and ErbB2, thus blocking the mitogenic effect of EGFR and ErbB2 (Fiorentino et al., 2000
; Xu et al., 2005
). However, studies on the effect of ACK1 on Ras-GRF activity found that ACK1 activates Ras and is required for Ras-mediated cellular transformation in NIH3T3 cells (Nur-E-Kamal et al., 2005
). Recent studies have shown that ACK1 enhances tumor metastasis by mediating integrin signaling (van der Horst et al., 2005
) and promotes tumorigenesis by inhibiting tumor-suppression activity of WWOX (Mahajan et al., 2005
). The variety of these studies suggests a complexity of the effects of members of ACK family on cell growth and tumorigenesis.
Both ACK1 and ACK2 possess a highly conserved clathrin-binding motif and interact with clathrin (Teo et al., 2001
; Yang et al., 2001b
). Overexpression of ACK2 severely impairs transferrin receptor endocytosis, causes aberrant localization of AP-2, and induces changes in clathrin assembly. Furthermore, ACK2 interacts with SH3PX1, a member of sorting nexin family, via its proline-rich domain 1 and phosphorylates SH3PX1 to facilitate the degradation of EGF receptors (Lin et al., 2002
). In C. elegans, Ark-1 genetically interacts with UNC101, the homologue of mammalian clathrin-associated protein AP47, and SLI-1, the homologue of mammalian Cbl that is an E3 ubiquitin ligase for ubiquitination of EGFR, and negatively regulates EGFR signaling (Hopper et al., 2000
). These data suggest a role of ACK in EGFR degradation.
Here we show that ACK1 is an ubiquitin-binding protein and interacts with EGFR through a conserved EGFR-binding domain (EBD) at the carboxy terminus. The interaction of ACK1 with EGFR is dependent on EGF stimulation and kinase activity of EGFR. ACK1 colocalizes with EGFR during the internalization of EGFR. We have demonstrated that ACK1 plays a role in EGFR degradation by using ACK-RNA interference (RNAi) knockdown of endogenous ACK1 and overexpression of the ubiquitin-binding defective mutant. Our studies suggest that ACK1 is a component of EGFR signaling and regulates ligand-induced EGFR degradation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture and Transfection
COS7, 293, HeLa, CHO, breast cancer MDA-MB-231, nonsmall cell lung cancer H-358, the neuroblastoma Neuro-2a, SK-N-DZ, SH-SY5Y, and BE-2C cells were cultured in DMEM plus 10% fetal bovine serum. All cells were maintained in 5 or 10% CO2 at 37°C. For transfection, the cells were cultured overnight to 90% confluency. The transfection was performed with the LipofectAmine transfection kit according to the manufacturer's instructions (Invitrogen). For EGF treatment, the cells were serum-starved overnight (1216 h) and then treated with EGF (100 ng/ml) for the indicated time. After 48 h of transfection, the cells were lysed with precold mammlian cell lysis buffer (40 mM HEPES, pH 7.4, 100 mM NaCl, 1% Triton X-100, 25 mM glycerol phosphate, 1 mM sodium orthovanadate, 1 mM EDTA, 10 µg/ml aprotinin, and 10 µg/ml leupeptin) by rocking the plates at 4°C for 30 min. The cell lysates were cleared by centrifugation at 14,000 rpm in a microfuge for 4 min at 4°C before use.
Immunoprecipitation and Immunoblot
For immunoprecipitation, the precleared cell lysate was incubated with primary antibody on ice for 30 min, then protein A beads were added, and the mixture was incubated at 4°C for 2 h with rotation. The beads were washed with lysis buffer three times, and the immunoprecipitation complexes were ready either for enzymatic assays or directly dissolved in SDS-PAGE sample buffer for SDS-PAGE. The immunoblot was performed as instructed by ECL immunoblot kits (Amersham Pharmacia, Piscataway, NJ).
Expression and Purification of GST-Fusion Protein
GST-fusion proteins were expressed in Escherichia coli (JM109) and purified by affinity purification with glutathione-agarose beads as described previously (Yang et al., 2001b
).
The Pulldown Assays with GST-Fusion Proteins
The GST-fusion protein beads containing 2060 µg of GST-fusion protein (60 µg for microsequencing or 20 µg for immunoblotting) were incubated with the mammalian cell lysates (1020 mg for microsequencing or 1 mg for immunoblotting) at 4°C for 3 h with rotation. The beads were washed three times with the mammalian cell lysis buffer and resuspended with 2x SDS-PAGE sample buffer. For microsequencing, after separated by SDS-PAGE, the proteins that are precipitated by the GST-fusion protein were visualized by staining with 0.51% Coomassie Blue.
Immunofluorescence Staining
The cells were cultured in the glass coverslip-bottomed culture dishes (MatTek, Ashland, MA) to 5080% confluence. For EGF stimulation, the cells were serum-starved for 12 h before the treatment. After the culture medium was removed, the cells were rinsed with PBS twice, fixed with 3.7% paraformaldehyde at 25°C for 10 min, and permeabilized with 0.2% Triton X-100 in PBS at 25°C for 10 min. After washing with PBS, the cells were incubated with primary antibody at 37°C for 30 min. Then the cells were washed with PBS three times and incubated with secondary antibody that is conjugated with a fluorescent dye at 37°C for 30 min. Finally, the cells were washed with PBS three times (for 10 min each), and the immunofluorescence staining was visualized under a Zeiss inverted fluorescent microscope (Thornwood, NY).
RNAi
The ACK-RNAi experiment was performed according to the method described by Elbashir et al. (2001)
. The 21-nucleotide small interference RNA (siRNA) sequence (AAGAUGGUGACAGAGCUGGCA) corresponding to the coding region of the tyrosine kinase domain of ACK1 was selected. This nucleotide sequence was conserved in both ACK1 and ACK2 from human, mouse, and bovine. The short interfering RNA (siRNA) oligos were chemically synthesized (Dharmacon, Lafayette, CO). The negative control was set up using the 21-nucleotide RNA oligos (AAGUUCAGGUCGAUAUGUGCA), which does not match any DNA sequence in GenBank, as determined by NCBI Blast search. Transfection of the siRNA (final concentration 40 nM) into HEK293 or COS7 cells was carried out using LipofectAmine transfection kits (Invitrogen). The suppression of the expression of endogenous ACK1 by the siRNAs was determined by immunoblotting the anti-ACKPCC-immunoprecipitated ACK1 with anti-ACKPCC.
| RESULTS |
|---|
|
|
|---|
|
|
|
To determine whether the interaction of ACK1 with EGFR occurs on the plasma membrane, the cells were preincubated on ice and subsequently stimulated with EGF on ice, which prevents endocytosis of EGFR and restricts the activated EGFR on the plasma membrane. As shown in Figure 4A, although EGFR activation by EGF on ice was comparable to that at 37°C (the middle panel), endogenous ACK1 was not coimmunoprecipitated with EGFR upon EGF stimulation on ice (lanes 710), implying that the interaction of endogenous ACK1 with EGFR does not occur on plasma membrane. These data also suggest that activation of EGFR is necessary but not sufficient for the interaction of endogenous ACK1 with EGFR. However, when overexpression of exogenous ACK1 in cells, as shown in Figure 4B, the interaction of ACK1 with EGFR occurs upon ice incubation (lanes 25), which may result from the interaction of EGFR with excessive free ACK1. These data are consistent with the results shown in Figure 2 and suggest that endogenous ACK1 might be restrained in intracellular compartments. Interaction of endogenous ACK1 with EGFR may require transport of EGFR to endosomes or a subcellular location, which is dependent on activation of EGFR.
|
|
ACK1 Interacts with EGFR through a Domain That Is Conserved in Gene-33/Mig-6/RALT
Gene-33/Mig-6/RALT, the nonkinase member of ACK family, has been shown to interact with EGFR and ErbB2 through a domain at its carboxy terminus (Fiorentino et al., 2000
; Xu et al., 2005
). This domain is conserved in ACK1 (Figure 6A). We designate this domain as the EBD. We subcloned the ACK1 EBD domain into a GST-fusion protein vector and performed the GST-ACK1-EBD pulldown assay with EGF-stimulated COS7 cell lysates. As expected, GST-ACK1-EBD precipitated EGFR from EGF-stimulated COS7 cell lysates (Figure 6B, lanes 1012) but not from unstimulated cell lysates (Figure 6B, lane 9), whereas GST alone did not precipitate EGFR from either EGF stimulated or unstimulated cell lysates (lanes 58). These data indicate that the EBD domain is the domain responsible for interaction with EGFR in ACK1.
|
40 amino acid residues at either N-terminus (EBD-
N1) or C-terminus (EBD-
C) of the EBD domain did not eliminate the binding capacity of the EBD domain (Figure 6D, top panel, lanes 14). However, truncation of
40 amino acid residues at both N- and C- termini (EBD-
NC) resulted in elimination of the interaction of the EBD domain with EGFR. These data suggest that at least two regions, one is between G786 and P851 and the other is in either N-terminus or C-terminus of the EBD domain, are required for interaction with EGFR. Further truncation of 28 amino acid residues at the N-terminus of EBD-
N1 (EBD-
N2) also eliminated the EGFR binding capacity of the EBD domain (Figure 6D), implicating that one of the regions required for interaction with EGFR may locate between G786-G814. Interestingly, there are three visible proline-rich regions, two at each terminus and one between G786-G814, in the EBD domain (Figure 6A). Regarding this structure feature and the EGFR binding of the truncation mutants shown in Figure 6D, it is possible that these three proline-rich regions are critical for the EBD domain to interact with active EGFR, and two of the three proline-rich regions are required for the minimal interaction with EGFR. Thus, we suspect that the interaction of ACK1 with EGFR is indirect, which may be mediated by an SH3 domain-containing EGFR-adaptor protein. Further investigation will be performed to confirm this hypothesis by identification of EGFR-adaptor proteins that interact with the EBD domain.
ACK1 Functions in EGFR Degradation
The next question is the function of ACK1 in EGFR signaling. Previous studies have shown that ACK1 interacts with clathrin heavy chain and regulates receptor-mediated endocytosis (Teo et al., 2001
). Ligand-induced endocytosis and degradation of EGFR play an important role in down-regulation of the EGFR signal (Yarden, 2001
). In C. elegans, the ACK homologue Ark-1 interacts with clathrin-binding protein AP-47 and ubiquitin-ligase Cbl and suppresses EGFR signaling. We suspect that ACK1 may play a role in regulation of EGFR degradation in mammalian cells. In HEK293 cells, ACK1 is the only endogenous ACK kinase, and the ligand-induced degradation rate of EGFR is faster than that in COS7 cells (data not shown). It is anticipated that effect of ACK1-knockdown with ACK1-RNAi on EGFR degradation in HEK293 cells is more visible than in COS7 cells. Thus we used HEK293 cells for ACK1-knockdown experiments. As shown in Figure 7A, the transfection of ACK-RNAi oligos in HEK293 cells effectively knocked down the expression of ACK1 (right panel). The degradation of EGFR after EGF stimulation upon the ACK1-RNAi transfection was significantly inhibited (Figure 7A). We quantified the effect of ACK1-RNAi on EGFR degradation in Figure 7A, as shown in Figure 7B. The maximum ligand-induced degradation of EGFR within 1 h was
80% of total EGFR. The maximum degradation of EGFR upon ACK-RNAi dropped to
30% of total EGFR. Compare to the control oligos, ACK-RNAi inhibited
60% of the total degradation of EGFR. These data suggest that ACK1 plays an important role in ligand-induced EGFR degradation in HEK293 cells.
|
ACK1 Is a Ubiquitin-binding Protein and Regulates EGFR Degradation via Its Uba Domain
To define the molecular mechanism by which ACK1 regulates EGFR degradation, we have searched the functional domain in ACK1 that potentially mediates the effect of ACK1 on EGFR degradation. Analysis of the primary sequence of ACK1 indicates a putative ubiquitin association (Uba) domain localized at the very carboxy terminus (amino acid residues 970-1055; Figure 8A). Alignment of the putative Uba domain of ACK1 with the Uba domains of Cbl-b, c-Cbl, and Rad23 shows the conserved ubiquitin-binding residues in ACK1 (Figure 8A). It is known that ubiquitination and clathrin-coated vesicle endocytosis are required for the degradation of EGFR (Sorkin and Carpenter, 1993
; Levkowitz et al., 1998
; Waterman and Yarden 2001
; Haglund et al., 2003a
, 2003b
). To determine the interaction of the putative Uba domain of ACK1 with ubiquitinated proteins, we performed the GST-fusion protein pulldown experiments. The putative ACK1-Uba domain was fused with GST, expressed in E. coli, and purified with the glutathione (GSH)-conjugated agarose beads. The immobilized GST-ACK1-Uba was incubated with cell lysates to precipitate associated proteins. As controls, we also did the pulldown assays with the GST-Cbl-b-Uba, GST-c-Cbl-Uba, and GST-Hrs-UIM domains along with the GST-ACK1-Uba domain. The coprecipitated proteins were resolved by SDS-PAGE and visualized by Coomassie blue staining. There were seven bands, migrating at 42, 45, 50, 70, 58, 62, and 100 kDa, that specifically associated with the putative ACK1 Uba domain (data not shown). The microsequencing of these bands at the Harvard Microchemistry Facility indicates that they are 26S proteasome subunits (data not shown). The immunoblot of the GST-ACK1 Uba-associated proteins in COS7 cells with anti-proteasome S1 and S10B antibodies that recognizes proteasome subunits S1, S10B, S4, and S8 has confirmed the microsequencing data (Figure 8B, top and middle panels, lane 2). We also observed that the Uba domain of Cbl-b precipitated proteasome subunits from COS7 cell lysates (Figure 8B, top and middle panels, lane 3). Because the Uba domain is a known domain for binding to ubiquitin, we speculated that binding of the ACK1 and Cbl-b Uba domains to the proteasome subunits might be indirect and mediated by ubiquitinated proteins that were associated with proteasomes. Thus, we immunoblotted the Uba domain precipitated proteins with anti-ubiquitin antibody. As shown in Figure 8B, large amount of ubiquitinated proteins in COS7 cell lysates was precipitated by the ACK1 Uba domain (the third panel, lane 2), suggesting that ACK1 Uba domain is the ubiquitin-binding domain. Cbl-b Uba domain had the same capacity as the ACK1-Uba domain to bind to ubiquitinated proteins (the third panel, lane 3), whereas the Hrs-UIM domain had much weak binding affinity to ubiquitinated proteins (the third panel, lane 5). Furthermore, Hrs-UIM domain did not pull down 26S proteasome subunits (lane 5, the top and the middle panels), suggesting that association of the Uba domains of ACK1 and Cbl-b with proteasome subunits might be specific. Thus, it is possible that the ACK1 and Cbl-b Uba domains can directly interact with proteasomes. It has been shown that the Uba domain of hPLIC-2 directly interacts with the 26S proteasomes (Kleijnen et al., 2003
). Further investigation is needed to determine the direct association of the Uba domain with proteasomes. To our surprise, the Uba domain of c-Cbl was defective in binding to ubiquitinated proteins (the third panel, lane 4), which is consistent with the observation from Davies et al. (2004)
. To further verify the binding of ACK1 to ubiquitin, we used GSH-agarose bead-bound GST-mono-ubiquitin and GST-poly-ubiquitin to incubate with myc-ACK1 expressed COS7 cell lysates and determined the coprecipitation of ACK1 with mono- and poly-ubiquitin. As shown in Figure 8C, both GST-mono-ubiquitin and poly-ubiquitin precipitated myc-ACK1 from the cell lysates, indicating that ACK1 interacts with both mono- and poly-ubiquitin. We compared the binding of poly-ubiquitin to ACK1, Hrs, and c-Cbl and found that polyubiquitin bound to ACK1 with a higher affinity than to Hrs (Figure 8D, lanes 2 and 4) and had no binding to c-Cbl (Figure 8D, lane 3), which is consistent with results from the GST-Uba domain pulldown experiments in Figure 8B.
|
|
The ubiquitin-binding has been shown to play important roles of endocytic adaptor proteins, such as Hrs and Eps15, in regulation of EGFR endocytosis and degradation (Bache et al., 2003
; de Melker et al., 2004
). To define the role of the Uba domain of ACK1 in EGFR degradation, we transfected the wild type and the Uba domain-deletion mutant of ACK1 into COS7 cells and then determined ligand-dependent degradation of EGFR by immunoblotting the cell lysates with an anti-EGFR antibody (Figure 10A). The degradation of EGFR in the control (vector transfected) was
50% of the total EGFR in the cells after 3-h EGF stimulation (Figure 10B). Overexpression of ACK1 facilitated the degradation of EGFR up to
70% of the total EGFR in the cells (Figure 10B), confirming that ACK1 is an important regulator in EGFR degradation. However, overexpression of the Uba domain-deletion mutant ACK1
Uba decreased the maximum level of ligand-induced degradation of EGFR down to
30% of the total EGFR (Figure 10B). Consider the transfection efficiency (
80% in COS7 cells), we estimate that ACK1
Uba mutant blocked
60% of ligand-induced EGFR degradation in cells, which is consistent with the results in ACK-RNAi experiments (Figure 7). These data suggest that the ACK1 Uba domain plays an important role in regulating ligand-induced EGFR degradation. In addition, MG-132, a proteasome inhibitor, markedly inhibited ligand-induced EGFR degradation in COS7 cells (Figure 10A, lanes 1620, and B), raising a possibility that proteasome activity is required for EGFR degradation in COS7 cells. However, we did not observe a significant effect of MG-132 on ligand-induced degradation of EGFR in HeLa cells (data not shown), suggesting that proteasome-mediated EGFR degradation is limited in certain cell lines.
|
| DISCUSSION |
|---|
|
|
|---|
The interaction of ACK1 with EGFR is in a way that is very similar to that of Gene-33/Mig-6/RALT, a protein homologous to the carboxyl portion of ACK1, with ErbB2 (Fiorentino et al., 2000
; Xu et al., 2005
). For example, Gene-33 interacts only with activated ErbB2 and the ErbB2-interactive domain of Gene-33 is the conserved EBD domain (Fiorentino et al., 2000
). Gene-33 also interacts with EGFR through the EBD domain, however, independent of stimulation of EGF (Xu et al., 2005
). It is not clear why Gene-33 binds to ErbB2 dependent on tyrosine phosphorylation of the receptor, whereas to EGFR independent on tyrosine phosphorylation of the receptor. Because those binding assays were performed with transfection of exogenous EGFR and Gene-33, the overexpression level of the receptor and Gene-33 in the assays may be a cause for diversified receptor-binding properties of Gene-33. Nevertheless, it seems that Gene-33 and ACK1 share a conserved EGFR/ErbB2-interactive mechanism. It has been shown that overexpression of Gene-33 inhibited tyrosine phosphorylation of EGFR and ErbB2-initiated cell proliferation and Erk activation (Fiorentino et al., 2000
; Xu et al., 2005
), suggesting that Gene-33 is a negative regulator of EGFR or ErbB2 signaling. There is a research report showing that ACK1 is required for Ras-mediated cellular transformation (Nur-E-Kamal et al., 2005
). However, genetic analysis of ACK function in C. elegans has indicated a negative role of ACK in EGFR signaling (Hopper et al., 2000
). Further investigation of the role of ACK1 in EGFR-mediated cell proliferation is necessary to define the role of ACK1 in cellular mitogenesis.
We observed a striking difference in interaction with EGFR between endogenous ACK1 and exogenous overexpressed ACK1 (Figures 2
4): interaction of exogenous ACK1 with EGFR occurred as quickly as 1 min after EGF stimulation (Figure 2B), and consistent with this the interaction took place on plasma membrane (Figure 4), whereas interaction of endogenous ACK1 with EGFR occurred relatively slowly (maximal binding at 1 h after EGF stimulation; Figures 2A and 3), and consistent with this the interaction did not take place on plasma membrane (Figure 4). These data suggest a possibility that endogenous ACK1 is restrained in cells. The interaction of endogenous ACK1 with EGFR may require transport of EGFR to an ACK1-containing intracellular compartment (EEA1 positive endosomes?) or release of ACK1 from the restrained sites by EGF signaling. Overexpression eliminates the restraint of ACK1 and yields free ACK1 that is capable of binding to active EGFR. Because endogenous ACK1 interacts with EGFR at late stage of ligand-induced EGFR activation, ACK1 is likely to function at late phase of EGFR endocytosis on EEA1-positive endosomes.
Cbl, the E3 ubiquitin ligase for the ubiquitination of EGFR, the HGF-regulated tyrosine phosphorylation substrate (Hrs), and the tumor-suppressor gene 101 (Tsg101) have been reported as the key regulators in ubiquitination-mediated EGFR degradation (Levkowitz et al., 1999
; Yarden, 2001
; Bishop et al., 2002
; Lu et al., 2003
). Cbl directly interacts with EGFR phosphotyrosine residue (tyrosine 1045) via its SH2 domain upon the activation of EGFR and subsequently catalyzes the ubiquitination. Hrs recognizes the mono-ubiqitinated EGFR and brings EGFR-loaded CCVs to multivesicular bodies (MVBs) by interaction with Tsg101 in the endosomal sorting complex required for transport I (ESCRT-I). The EGFR in MVBs eventually transports to lysosomes for degradation. In C. elegans, the ACK homologue, Ark-1, is in the same pathway as that of Cbl for regulation of EGFR signaling (Hopper et al., 2000
). However, we did not observe an interaction between ACK1 and Cbl with coimmunoprecipitation assays in COS7 cells (data not shown). The results in Figures 2A, 3A, and 5B also suggest that ACK1 and c-Cbl interact with EGFR at different steps during ligand-induced endocytosis and degradation of EGFR. To dissect the signaling events of ACK1 in regulation of EGFR degradation, we need to determine the exact timing and location of the interaction of ACK1 with EGFR in future studies. Furthermore, we will address the biological consequence of ACK1-regulated EGFR degradation in future investigations. Because EGFR has a pivotal role in regulation of cell growth and overexpression of EGFR has been found in many types of solid tumors, the function of ACK1 in tumorigenesis related to EGFR degradation should be another interesting area to explore.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Wannian Yang (wyang1{at}geisinger.edu)
Abbreviations used: ACK1, activated Cdc42-associated tyrosine kinase 1; EBD, EGFR-binding domain; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; RNAi, RNA interference; SHP-1, SH2-containing phosphatase-1.
| REFERENCES |
|---|
|
|
|---|
Bishop, N., Horman, A., Woodman, P. (2002). Mammalian class E vps proteins recognize ubiquitin and act in the removal of endosomal protein-ubiquitin conjugates. J. Cell Biol 157, 91101.
Davies, G. C., Ettenberg, S. A., Coats, A. O., Mussante, M., Ravichandran, S., Collins, J., Nau, M. M., Lipkowitz, S. (2004). Cbl-b interacts with ubiquitinated proteins; differential functions of the UBA domains of c-Cbl and Cbl-b. Oncogene 23, 71047115.[CrossRef][Medline]
de Melker, A. A., van der Horst, G., Borst, J. (2004). c-Cbl directs EGF receptors into an endocytic pathway that involves the ubiquitin-interacting motif of Eps15. J. Cell Sci 117, 50015012.
Eisenmann, K. M., McCarthy, J. B., Simpson, M. A., Keely, P. J., Guan, J. L., Tachibana, K., Lim, L., Manser, E., Furcht, L. T., Iida, J. (1999). Melanoma chondroitin sulphate proteoglycan regulates cell spreading through Cdc42, Ack-1 and p130cas. Nat. Cell Biol 1, 507513.[CrossRef][Medline]
Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494498.[CrossRef][Medline]
Fiorentino, L., Pertica, C., Fiorini, M., Talora, C., Crescenzi, M., Castellani, L., Alema, S., Benedetti, P., Segatto, O. (2000). Inhibition of ErbB-2 mitogenic and transforming activity by RALT, a mitogen-induced signal transducer which binds to the ErbB-2 kinase domain. Mol. Cell. Biol 20, 77357750.
Haglund, K., Di Fiore, P. P., Dikic, I. (2003a). Distinct monoubiquitin signals in receptor endocytosis. Trends Biochem. Sci 28, 598603.[CrossRef][Medline]
Haglund, K., Sigismund, S., Polo, S., Szymkiewicz, I., Di Fiore, P. P., Dikic, I. (2003b). Multiple monoubiquitination of RTKs is sufficient for their endocytosis and degradation. Nat. Cell Biol 5, 461466.[CrossRef][Medline]
Hoare, K., Hoare, S., Smith, O. M., Kalmaz, G., Small, D., Stratford May, W. (2003). Kos1, a nonreceptor tyrosine kinase that suppresses Ras signaling. Oncogene 22, 35623577.[CrossRef][Medline]
Hopper, N. A., Lee, J., Sternberg, P. W. (2000). ARK-1 inhibits EGFR signaling in C. elegans. Mol. Cell 6, 6575.[CrossRef][Medline]
Kleijnen, M. F., Alarcon, R. M., Howley, P. M. (2003). The ubiquitin-associated domain of hPLIC-2 interacts with the proteasome. Mol. Biol. Cell 14, 38683875.
Levkowitz, G., et al. (1999). Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol. Cell 4, 10291040.[CrossRef][Medline]
Levkowitz, G., Waterman, H., Zamir, E., Kam, Z., Oved, S., Langdon, W. Y., Beguinot, L., Geiger, B., Yarden, Y. (1998). c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev 12, 36633674.
Lin, Q., Lo, C. G., Cerione, R. A., Yang, W. (2002). The Cdc42 target ACK2 interacts with sorting nexin 9 (SH3PX1) to regulate epidermal growth factor receptor degradation. J. Biol. Chem 277, 1013410138.
Linseman, D. A., Heidenreich, K. A., Fisher, S. K. (2001). Stimulation of M3 muscarinic receptors induces phosphorylation of the Cdc42 effector activated Cdc42Hs-associated kinase-1 via a Fyn tyrosine kinase signaling pathway. J. Biol. Chem 276, 56225628.
Lu, Q., Hope, L. W., Brasch, M., Reinhard, C., Cohen, S. N. (2003). TSG101 interaction with HRS mediates endosomal trafficking and receptor down-regulation. Proc. Natl. Acad. Sci. USA 100, 76267631.
Mahajan, N. P., Whang, Y. E., Mohler, J. L., Earp, H. S. (2005). Activated tyrosine kinase Ack1 promotes prostate tumorigenesis: role of Ack1 in polyubiquitination of tumor suppressor Wwox. Cancer Res 65, 1051410523.
Makkinje, A., Quinn, D. A., Chen, A., Cadilla, C. L., Force, T., Bonventre, J. V., Kyriakis, J. M. (2000). Gene 33/Mig-6, a transcriptionally inducible adapter protein that binds GTP-Cdc42 and activates SAPK/JNK. A potential marker transcript for chronic pathologic conditions, such as diabetic nephropathy. Possible role in the response to persistent stress. J. Biol. Chem 275, 1783817847.
Manser, E., Leung, T., Salihuddin, H., Tan, L., Lim, L. (1993). A non-receptor tyrosine kinase that inhibits the GTPase activity of p21cdc42. Nature 363, 364367.[CrossRef][Medline]
Mosesson, Y., Shtiegman, K., Katz, M., Zwang, Y., Vereb, G., Szollosi, J., Yarden, Y. (2003). Endocytosis of receptor tyrosine kinases is driven by monoubiquitylation, not polyubiquitylation. J. Biol. Chem 278, 2132321326.
Nur-E-Kamal, A., Zhang, A., Keenan, S. M., Wang, X. I., Seraj, J., Satoh, T, Meiners, S., Welsh, W. J. (2005). Requirement of activated Cdc42-associated kinase for survival of v-Ras-transformed mammalian cells. Mol. Cancer Res 3, 297305.
Satoh, T., Kato, J., Nishida, K., Kaziro, Y. (1996). Tyrosine phosphorylation of ACK in response to temperature shift-down, hyperosmotic shock, and epidermal growth factor stimulation. FEBS Lett 386, 230234.[CrossRef][Medline]
Sem, K. P., Zahedi, B., Tan, I., Deak, M., Lim, L., Harden, N. (2002). ACK family tyrosine kinase activity is a component of Dcdc42 signaling during dorsal closure in Drosophila melanogaster. Mol. Cell. Biol 22, 36853697.
Sorkin, A. and Carpenter, G. (1993). Interaction of activated EGF receptors with coated pit adaptins. Science 261, 612615.
Teo, M., Tan, L., Lim, L., Manser, E. (2001). The tyrosine kinase ACK1 associates with clathrin-coated vesicles through a binding motif shared by arrestin and other adaptors. J. Biol. Chem 276, 1839218398.
van der Horst, E. H., et al. (2005). Metastatic properties and genomic amplification of the tyrosine kinase gene ACK1. Proc. Natl. Acad. Sci. USA 102, 1590115906.
Waterman, H. and Yarden, Y. (2001). Molecular mechanisms underlying endocytosis and sorting of ErbB receptor tyrosine kinases. FEBS Lett 490, 142152.[CrossRef][Medline]
Xu, D., Makkinje, A., Kyriakis, J. M. (2005). Gene 33 is an endogenous inhibitor of epidermal growth factor (EGF) receptor signaling and mediates dexamethasone-induced suppression of EGF function. J. Biol. Chem 280, 29242933.
Yang, W. and Cerione, R. A. (1997). Cloning and characterization of a novel Cdc42-associated tyrosine kinase, ACK-2, from bovine brain. J. Biol. Chem 272, 2481924824.
Yang, W., Lin, Q., Guan, J. L., Cerione, R. A. (1999). Activation of the Cdc42-associated tyrosine kinase-2 (ACK-2) by cell adhesion via integrin beta1. J. Biol. Chem 274, 85248530.
Yang, W., Lin, Q., Zhao, J., Guan, J. L., Cerione, R. A. (2001a). The nonreceptor tyrosine kinase ACK2, a specific target for Cdc42 and a negative regulator of cell growth and focal adhesion complexes. J. Biol. Chem 276, 4398743993.
Yang, W., Lo, C. G., Despenza, T., Cerione, R. A. (2001b). The Cdc42 target ACK2 directly interacts with clathrin and influences clathrin assembly. J. Biol. Chem 276, 1746817473.
Yarden, Y. (2001). The EGFR family and its ligands in human cancer. signalling mechanisms and therapeutic opportunities. Eur. J. Cancer 37, Suppl 4, 38.
This article has been cited by other articles:
![]() |
Z. Liu, H. C. Adams III, and I. P. Whitehead The Rho-specific Guanine Nucleotide Exchange Factor Dbs Regulates Breast Cancer Cell Migration J. Biol. Chem., June 5, 2009; 284(23): 15771 - 15780. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Andrew, R. A. Mason, V. Memoli, and E. J. Duell Arsenic Activates EGFR Pathway Signaling in the Lung Toxicol. Sci., June 1, 2009; 109(2): 350 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chan, R. Tian, Y.-F. Lee, S. T. Sit, L. Lim, and E. Manser Down-regulation of Active ACK1 Is Mediated by Association with the E3 Ubiquitin Ligase Nedd4-2 J. Biol. Chem., March 20, 2009; 284(12): 8185 - 8194. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Moriyoshi pBT, a novel vector for tetracycline-regulated yeast three-hybrid assay Nucleic Acids Res., February 1, 2009; 37(2): e11 - e11. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huber, A. Martensson, G. M. Bokoch, D. Nemazee, and A. L. Gavin FGD2, a CDC42-specific Exchange Factor Expressed by Antigen-presenting Cells, Localizes to Early Endosomes and Active Membrane Ruffles J. Biol. Chem., December 5, 2008; 283(49): 34002 - 34012. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||