![]() |
|
|
Vol. 18, Issue 3, 795-805, March 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



Departments of *Pharmacology and
Pediatrics, University of Wisconsin, Madison, WI 53706
Submitted October 2, 2006;
Revised December 4, 2006;
Accepted December 18, 2006
Monitoring Editor: Carole Parent
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In professional migratory cells such as neutrophils, G protein-coupled cell surface receptors recognize external chemotactic gradients (Van Haastert and Devreotes, 2004
; Huttenlocher, 2005
) and are responsible for initiating the translation of spatial information about the chemotactic gradient into an internal gradient of signaling molecules that relay either "front"- or "back"-specific responses. For example, previous work has shown that phosphatidylinositol-3,4,5-trisphosphate (PIP3) is asymmetrically recruited to the membrane adjacent to the highest concentration of chemoattractant (Servant et al., 2000
; Kimmel and Parent, 2003
) where it stimulates positive feedback mechanisms that promote the frontness signal. Subsequent reinforcement of frontness and backness signals dictate cell polarity, where pseudopod formation is biased according to the direction of the chemotactic gradient, with the leading edge characterized by the asymmetric accumulation of actin, phosphoinositide 3-kinase, Cdc42, and Syk (Weiner et al., 1999
; Funamoto et al., 2002
; Li et al., 2003
; Schymeinsky et al., 2005
, 2006
) as well as the establishment of lipid microenvironments (Manes et al., 1999
; Gomez-Mouton et al., 2001
, 2004
; Kindzelskii et al., 2004
).
We have previously shown that the intracellular, calcium-dependent protease calpain is constitutively active in resting neutrophils and that global inhibition of calpain activity enhances random neutrophil migration or chemokinesis (Lokuta et al., 2003
). Interestingly, the increase in chemokinesis caused by calpain inhibition is accompanied by an impaired chemotactic response (Lokuta et al., 2003
). Of the 16 identified mammalian calpain isoforms, only calpain 1 (µ-calpain) and calpain 2 (m-calpain) and their shared small regulatory subunit, CSS1, have been implicated as regulators of cell migration (Huttenlocher et al., 1997
; Dourdin et al., 2001
; Glading et al., 2001
; Goll et al., 2003
). Recent work has also identified an isoform-specific function of calpain 2 in regulating membrane protrusion at the leading edge of migrating cells (Franco et al., 2004a
). Together with the ability of calpain to regulate Rho-GTPase activity (Lokuta et al., 2003
), integrin activation (Huttenlocher et al., 1996
; Palecek et al., 1998
; Rock et al., 2000
), and cytoskeletal organization (Dourdin et al., 2001
; Bhatt et al., 2002
; Franco et al., 2004b
), these data raise the possibility that calpains may play a role in establishing frontness during chemotaxis.
In this report, we demonstrate that neutrophils and neutrophil-like HL-60 cells express both calpain 1 (µ-calpain) and calpain 2 (m-calpain) and that these isoforms are asymmetrically distributed to distinct intracellular regions upon chemoattractant stimulation in both neutrophils and HL-60 cells. Using time-lapse microscopy and dimethyl sulfoxide (DMSO)-differentiated HL-60 cells (dHL-60) retrovirally infected with green fluorescent protein (GFP)-tagged wild-type calpain 2, we show that enrichment of calpain 2 at the cell front occurs early upon exposure to a gradient of chemoattractant and is persistent during pseudopod formation and chemotaxis. We also show that the localization of calpain 2 is sensitive to positional changes in the chemotactic gradient. We demonstrate that calpain 2, but not calpain 1, is recruited to lipid raft domains in activated neutrophils. Finally, we show that ectopic expression of calpain 2 in dHL-60 cells enhances chemotaxis, whereas expression of a protease-dead calpain 2 induces multiple lateral pseudopodia and impairs chemotaxis. Together, our data suggest that calpain 2 is a novel component of the frontness signal that limits pseudopod formation to promote neutrophil polarization during chemotaxis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA Isolation and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from primary neutrophils, undifferentiated and differentiated HL-60 cells, and human embryonic kidney (HEK) 293 cells by using RNA STAT-60 (Tel-Test, Friendswood, TX). After treatment with DNase (Promega, Madison, WI), RT-PCR was performed with 1 µg of RNA and 40 U of Rnasin (Promega) by using the one-step RT-PCR kit (QIAGEN, Valencia, CA) and calpain 1 or calpain 2 gene-specific primers (Witkowski et al., 2002
; De Tullio et al., 2003
) against a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control. All primers were verified in BLAST searches of the nonredundant database to ensure that each sequence was specific for the target gene. Primers spanned at least one exon boundary of each target sequence to eliminate products from genomic DNA contamination. Gene forward primer (5'-3') reverse primer (5'-3'): Capn 1, GATGGAGCTACCCGCACAGAC GTGGAGGGCACCACCACATAC; Capn 2, AGGCATACGCCAAGATCAAC GGATGCGGATCAGTTTCTGT; and GAPDH, GAGTCAACGGATTTGGTCGTAT AGTCTTCTGGGTGGCAGTGAT.
The following thermal cycling parameters were used: 50°C for 30 min, 95°C for 15 min, 94°C for 1 min, 55°C for 1 min, 72°C for 1 min (35 cycles), and a final extension at 72°C for 10 min. Each RT-PCR sample was resolved by electrophoresis on a 4.25% nondenaturing polyacrylamide gel, stained with ethidium bromide, and analyzed using a Bio-dock system (UVP, Upland, CA). Data are representative of RT-PCR from three separate RNA preparations.
Protein Extraction, Antibodies, and Immunoblots
Primary neutrophils and dHL-60 cells were either untreated or stimulated with 11.25 nM Complement factor 5a (C5a) (Sigma-Aldrich) or 100 nM N-formyl-L-methionyl-L-leucyl-L-phenylalanine (fMLP) (Sigma-Aldrich) for 15 min and treated with lysis buffer (0.5% sodium deoxycholate, 1% NP-40, and 0.1% SDS in phosphate-buffered saline (PBS) supplemented with protease inhibitor cocktail (P-8340; Sigma-Aldrich), phosphatase inhibitor cocktail (P-5726; Sigma-Aldrich), 2 mM phenylmethylsulfonyl fluoride (PMSF), 100 mM sodium orthovanadate, 900 mM benzamidine, and 1 mM phenantroline). Lysates were subjected to three freeze-thaw cycles by using a dry ice methanol bath and solubilized on ice for 30 min. Samples were clarified by centrifugation, and protein concentration was determined using a BCA protein assay (Pierce Chemical, Rockford, IL). Sixty-five micrograms of total protein was used for immunoblots by using standard conditions (Harlow and Lane, 1999
). Immunoblots against purified calpain 1 and calpain 2 protein (Calbiochem, San Diego, CA) were used to confirm isoform specificity for each antibody. Primary antibodies were diluted into 2.5% nonfat dry milk and used at the following dilutions: rabbit-
-calpain 1 (Triple Point RP3, 1:500; Abcam, Cambridge, MA), rabbit-
-calpain 2 (Triple Point RP1, 1:500; Abcam), and rabbit-
-calpain 2 (3989, 1:100; Sigma-Aldrich). IRDye 800CW goat
-rabbit (1:10,000; Rockland, Gilbertsville, PA) was used as the secondary antibody. Western blots were imaged with an Odyssey Infrared Imaging system (LI-COR, Lincoln, NE). For Western blot experiments,
-calpain 1 (Triple Point, Abcam) was used for all cells, whereas
-calpain 2 (Triple Point, Abcam) was used for primary neutrophils and
-calpain 2 (Sigma-Aldrich) was used for HL-60 and HEK cells. Detection of calpain 2 in dHL60 cells required the calpain 2 antibody (Sigma-Aldrich) and extensive solubilization of the cell lysates.
Expression Constructs
Wild-type calpain 1 and 2 constructs were generated by subcloning human calpain 1 (a generous gift from Dr. Joan Fox, Cleveland Clinic, Cleveland, OH) and human calpain 2 (a kind gift from Dr. Alan Wells, University of Pittsburgh, Pittsburgh, PA) cDNAs into the pCDNA 3.1 FLAG vector (Invitrogen, Carlsbad, CA). QuikChange site-directed mutagenesis (Stratagene, La Jolla, CA) of the wild-type calpain 2 FLAG construct was used to generate calpain 2 protease dead (PD) FLAG (H262A) (Arthur et al., 1995
) by using the primer pair 5'-GCTGGTGAAGGGCGCCGCGTACTCGGTCACCGGAGCC-3' and 5'-GGCTCCGGTGACCGAGTACGCGGCGCCCTTCACCAGC-3'. Calpain 1, calpain 2, and calpain 2 PD-FLAG were subsequently subcloned into the pMX-IRES GFP retroviral vector (a generous gift from Dr. Clive Svendsen, University of Wisconsin, Madison, WI). The pMX-calpain 2-GFP was generated by subcloning into pEGFP-N1 (Clonetech, Mountain View, CA) and subsequently the empty pMX retroviral vector. QuickChange site directed mutagenesis (Stratagene) of the wild-type pMX-calpain 2-GFP was used to generate pMX-calpain 2 PD-GFP (C105S) (Arthur et al., 1995
) by using the primer pair 5'-CCCTAGGTGACTCCTGGCTGCTGGC-3'and 5'-GCCAGCAGCCAGGAGTCACCTAGGG-3'. The accuracy of all constructs was verified by DNA sequencing before use.
Immunofluorescence
Primary neutrophils or dHL-60 cells were resuspended in Dulbecco's phosphate-buffered saline (DPBS) alone, or DPBS containing 11.5 nM C5a or 100 nM fMLP and were allowed to adhere for 10 min to glass coverslips coated with 10 µg/ml fibrinogen. For calpain 1, cells were fixed with 6.6% paraformaldehyde, 0.05% glutaraldehyde in PBS, pH 7.2, quenched with 0.15 M glycine for 15 min, and permeabilized with 0.5% Triton X-100 for 15 min. For calpain 2, cells were fixed and pemeabilized with 6.6% paraformaldehyde, 0.05% glutaraldehyde, and 0.25 mg/ml saponin in PBS, pH 7.2, for 15 min and quenched with 0.15 M glycine for 15 min. Nonspecific binding was blocked with PBS containing 10% heat-inactivated FBS and 0.25 mg/ml saponin at 4°C overnight. Cells were then stained for 30 min with either
-calpain 1 (2H-7; a kind gift from Dr. Ronald Mellgren, University of Toledo, Toledo, OH),
-calpain 2 (Triple Point, Abcam), or
-FLAG (M2; Sigma-Aldrich) and costained with rhodamine-labeled phalloidin (Invitrogen). Rhodamine-labeled goat
-mouse (Invitrogen), fluorescein isothiocyanate (FITC) sheep
-mouse (Jackson ImmunoResearch Laboratories, West Grove, PA), and FITC goat
-rabbit IgG (Jackson ImmunoResearch Laboratories) were used as the secondary antibodies. All antibody incubations were performed at room temperature, and cells were washed extensively in PBS between each incubation step. Cells were mounted in mounting media and viewed on a Nikon Eclipse TE300 inverted fluorescence microscope using a 60x differential interference contrast microscopy objective. Fluorescent images were digitally acquired using a cooled charge-coupled device video camera (Hamamatsu Photonics, Bridgewater, NJ) and processed with MetaMorph version 5.0 (Molecular Devices, Sunnyvale, CA). Localization studies were performed on at least three independent samples.
For immunofluorescence of lipid rafts, primary neutrophils were resuspended in DPBS alone, or DPBS containing 10 mM methyl-
-cyclo-dextran (Sigma-Aldrich) and incubated for 15 min at 37° and 5% CO2. Each sample was stimulated with 100 nM fMLP and allowed to adhere for 10 min to glass coverslips coated with 10 µg/ml fibrinogen. The cells were fixed with 6.6% paraformaldehyde, 0.05% glutaraldehyde, and 0.25 mg/ml saponin in PBS, pH 7.2, for 15 min and quenched for 15 min with 0.15 M glycine. Nonspecific binding was blocked overnight with PBS containing 10% heat-inactivated FBS, 0.25 mg/ml saponin at 4°C. Cells were incubated for 1 h with
-ganglioside marker (GM)-3 antibody (Seikagaku America, Rockville, MD) and
-calpain 2 (Triple Point, Abcam), washed with PBS, incubated with the appropriate secondary antibody for 30 min, and processed as described above.
Retroviral Infection
Phoenix viral packaging cells were transiently transfected by calcium-phosphate precipitation (Jordan et al., 1996
), and viral supernatant was harvested and filtered through a 0.45-µm membrane 48 h posttransfection. For infection, 1 x 106 HL-60 cells were resuspended in the viral supernatant supplemented with 1 µg/ml polybrene (Sigma-Aldrich), plated, centrifuged at 1141 x g for 90 min in an Allegra 6R table top centrifuge (Beckman Coulter, Fullerton, CA), and cultured at 32°C for 6 h. The viral supernatant was then replaced with fresh media, and the cells grown overnight at 37°C. The next day, a second spin infection was performed using viral supernatant collected from a second plate of Phoenix cells 72 h posttransfection. Populations of GFP-positive cells were obtained by fluorescence-activated cell sorting (FACS) and verified for expression by Western blotting.
Talin Proteolysis
dHL-60 cells were either untreated or stimulated with 11.25 nM C5a for 2, 5, and 10 min. Cell lysates were taken and analyzed by immunoblot analysis as described above using the 8d4 talin antibody (Sigma-Aldrich). To determine the effect of overexpression of calpain 2 constructs on talin proteolysis, dHL-60 cells expressing either control, calpain 2, or calpain 2 PD-FLAG were either untreated or stimulated with 11.25 nM C5a. Cell lysates were obtained and processed as described. Representative blots are shown from three independent experiments.
Lamellipod Assay
dHL-60 cells that express control vector or wild-type calpain 2 were plated on coverslips coated with 2.5 µg/ml fibrinogen, stimulated with 11 nM C5a for 10 min, fixed, permeabilized, and stained with rhodamine-labeled phalloidin. Fluorescent microscopy images were obtained and analyzed using MetaMorph version 5.0 cell imaging software. For each cell, a line was drawn around the entire periphery of the cell, or the region of F-actin highlighted by rhodamine-labeled phalloidin to determine the length in micrometers. Lamellipod percentage for each cell was calculated by dividing the length of the region containing F-actin by length of the entire cell periphery and multiplying by 100. Data were collected from
50 cells from four separate experiments and compared by a two-tailed, paired Student's t test. A value of p
0.05 was taken as significant.
Chemotaxis Assay
For each experiment, 5 x 105 dHL-60 cells were plated in Gey's media for 10 min on a glass coverslip coated with 2.5 µg/ml fibrinogen (Sigma-Aldrich) and 50 µg/ml fibronectin (purified from human plasma as described previously; Ruoslahti et al., 1982
). An Eppendorf FemptoTip was loaded with 58 µM C5a, and a chemotactic gradient was formed by slow release of the chemoattractant from the tip into the media using an Eppendorf FemptoJet microinjection system as described previously (Servant et al., 1999
). For experiments involving actin disruption, dHL-60s were pretreated for 15 min in Gey's media containing 3 µM latrunculin A (Sigma-Aldrich). Chemotaxis was recorded using a Nikon Eclipse TE300 inverted fluorescence microscope with a cooled charge-coupled device video camera (Hamamatsu Photonics) by using a 60 or 100x differential interference contrast microscopy (DIC) objective and captured into MetaMorph version 5.0 (Molecular Devices) at 10-s intervals for 10 min. Localization studies were performed on at least three independent samples from multiple cell lines.
Cell Tracking
Cell centroid positions were marked in Scion Image (Scion, Frederick, MD), and cell movement was determined as a function of time in Excel version 8.0 (Microsoft, Redmond, WA). The mean square displacement [d2(t)] was calculated as a function of time and expressed in micrometers per minute for each cell in the field from at least three independent experiments.
Transwell Assay
Analysis of dHL-60 chemotaxis by transwell assay was performed as described previously (Lokuta et al., 2003
), except that 11 nM C5a and Gey's media were used as described previously (Hauert et al., 2002
). Cells that migrated across the filter were counted and expressed relative to control. The results are from a minimum of three separate experiments.
Lipid Raft Preparations
To analyze detergent-insoluble complexes in flotation gradients, 1 x 108 primary neutrophils were untreated or stimulated with 100 nM fMLP for 15 min in Gey's media. Cells were then lysed in 300 µl of cold TNE buffer (50 mM Tris-HCl, pH 7.4, 300 mM NaCl, 5 mM EDTA, 0.2% Triton X-100, 2 mM PMSF, 100 mM sodium orthovanadate, 900 mM benzamidine, 1 mM phenantroline, and protease inhibitor cocktail [P-8340; Sigma-Aldrich]), sheared three times with a 21-gauge needle, brought to 35% (vol/vol) Optiprep (Nycomed, Oslo, Norway), and received 20 strokes in a dounce homogenizer. The sample was overlaid with 3.5 ml of 30% (vol/vol) Optiprep and 250 µl of TNE buffer in a SW60 tube and then centrifuged 4 h at 170,000 x g at 4°C. After the spin, nine 500-µl fractions were collected from top to bottom, and 70-µl samples were analyzed by SDS-PAGE and Western blot by using the following primary antibodies:
-receptor for activated C kinase (RACK)1 (BD Biosciences PharMingen, San Diego, CA),
-CD43 (1G10),
-calpain 1 (Triple Point, Abcam), and
-calpain 2 (107-82; Sigma-Aldrich). For the SDS-PAGE detection of GM-1, samples were run and transferred using previously described methods (Badizadegan et al., 2000
; Rodighiero et al., 2001
). Dot blots for CD-45 (BRA-55; Sigma-Aldrich) were carried out using the protocol provided with the Bio-Dot microfiltration apparatus (Bio-Rad) by using a 50-µl sample from each fraction and visualized by Western blot.
Flow Cytometry
Undifferentiated and DMSO-differentiated HL-60 cells expressing either control GFP, pMX-calpain 2-GFP, or pMX-calpain 2 PD-GFP fusion constructs were washed and resuspended in FACS buffer (cold 2% fetal calf serum and 0.2% NaN3 in 1X DPBS). Cells (1 x 106) in 100 µl of FACS buffer were either left unstained or incubated with a 20-µl aliquot of phycoerythrin (PE)-conjugated
-CD54 (intercellular adhesion molecule [ICAM]-1) antibody (5555511; BD Biosciences PharMingen), PE-conjugated
-CD11b (Mac-1) antibody (555388 BD; BD Biosciences PharMingen), or PE-conjugated mouse IgG1 (555749; BD Biosciences PharMingen) for 1 h at room temperature in the dark. Cells were washed twice with FACS buffer, resuspended in 300 µl of FACS buffer, counted using a BD Biosciences FACSCalibur flow cytometer, and analyzed with FlowJo 6.4.6 software (Tree Star, Ashland, OR).
Online Supplemental Material
Time-lapse microscopy of dHL-60 cells that express pMX-calpain 2-GFP migrating toward a pipette tip (Figure 3A) is shown in Supplemental Video 1. Time-lapse microscopy of dHL-60 cells expressing pMX-calpain 2-GFP migrating toward a pipette tip whose position is changed (Figure 3D) is shown in Supplemental Video 2. DIC time-lapse microscopy of dHL-60 cells (Figure 6) that express either control (Supplemental Video 3), calpain 2 wild type (Supplemental Video 4), or calpain 2 PD (Supplemental Video 5) are shown. Time-lapse microscopy of dHL-60 cells that express pMX-calpain 2 PD-GFP migrating toward a pipette tip is shown in Supplemental Video 6. Images for Supplemental Videos 1, 2, and 6 were captured at 10-s intervals. Images for Supplemental Videos 35 were captured at 5-s intervals. All time-lapse microscopy images were captured using a 60x objective with a Nikon Eclipse TE300 inverted fluorescence microscope with a cooled charge-coupled device video camera (Hamamatsu Photonics) by using DIC microscopy and captured into MetaMorph version 5.0 (Molecular Devices). Movies were converted into QuickTime movie format and prepared using CinaPak compression.
| RESULTS |
|---|
|
|
|---|
|
Calpain 2 Localizes to the Leading Edge of Neutrophil-like HL-60 Cells
To complement our work with primary neutrophils, we have also used the neutrophil-like HL-60 cell line (Collins et al., 1977
). HL-60 cells are a promyelocytic leukemia cell line that can be differentiated into a neutrophil-like state by culturing with 1.25% DMSO (Collins et al., 1978
). On differentiation, HL-60 cells become sensitive to myeloid-specific histochemical stains and display a similar morphology, polarity, and protein expression profile as primary neutrophils (Collins et al., 1979
; Gallagher et al., 1979
; Hauert et al., 2002
). Most importantly, dHL-60 cells are responsive to various chemoattractrants (Collins et al., 1979
; Gallagher et al., 1979
; Hauert et al., 2002
), which makes them a valid, widely used model system to study neutrophil chemotaxis (Servant et al., 2000
; Weiner et al., 2002
; Gomez-Mouton et al., 2004
; Van Keymeulen et al., 2006
; Wong et al., 2006
). Using immunofluorescence, we found that treatment with a uniform concentration of chemoattractant triggers the asymmetric distribution of endogenous calpain 1 and calpain 2 in dHL-60 cells (Figure 1E) similar to primary neutrophils (Figure 1D) with calpain 2 enriched at the leading edge.
To further assess the role of calpain 2 in neutrophil chemotaxis, stable HL-60 cell lines that express C-terminal FLAG-tagged wild-type or protease-dead (PD) calpain 2 coupled to ribosome entry site (IRES)-driven expression of GFP were generated (Figure 2A). Cell populations were sorted by flow cytometry, differentiated with DMSO, and protein expression was confirmed by immunoblotting (Figure 2B). In accordance with our findings for the localization of endogenous calpain 2 in primary neutrophils and dHL-60 cells (Figure 1, D and E), FLAG-tagged calpain 2 also localized to the leading edge in response to chemoattractant stimulation, whereas calpain 1 staining was diffuse and localized away from the leading edge (Figure 2C). Calpain 2 PD also localized to membrane protrusions but did not display as strong enrichment at the leading edge compared with wild-type calpain 2 (Figure 2C).
|
Calpain 2 Localization Is a Dynamic Marker of Frontness during Chemotaxis
To examine calpain 2 localization in live cell imaging studies, we generated stable HL-60 cell lines that express either C-terminal GFP-tagged wild-type or protease-dead (PD) calpain 2 (Figure 3). Cell populations were sorted by flow cytometry, differentiated with DMSO, and expression of each construct was confirmed by immunoblotting (Supplemental Figure 1A). Using MAC-1 surface expression as a marker of differentiation in a FACS-based assay (Carrigan et al., 2005
), we demonstrated that DMSO-induced differentiation of HL-60 cells results in the upregulation of Mac-1 (gray) (Carrigan et al., 2005
) as well as ICAM-1 (black) and that overexpression of wild-type calpain 2 or PD did not alter the up-regulation of these receptors at the cell surface (Supplemental Figure 1, B and C). This indicates that overexpression of wild-type calpain 2 or PD did not alter differentiation. Using time-lapse fluorescent microscopy in a micropipette-based assay, dHL-60 cells expressing calpain 2-GFP demonstrated asymmetric localization of calpain 2 toward the chemoattractant source (Figure 3 and Supplemental Video 1). Calpain 2 signal from the GFP channel overlayed with DIC images of the cell revealed that the majority of calpain 2-GFP was localized toward the leading edge (Figure 3B). This was in contrast to cells that expressed GFP alone, which demonstrated a diffuse distribution of GFP (data not shown).
|
Our findings suggest that calpain 2 may be involved in a positive feedback loop that reinforces frontness. To test this hypothesis, we examined the role of actin assembly in the recruitment of calpain 2 to the cell front. After pretreatment with latrunculin A, calpain 2-GFP failed to translocate toward the highest concentration of chemoattractant, and cell polarization was abrogated (Figure 3E). These findings indicate that calpain 2 translocation occurs in an actin-dependent manner and suggests calpain 2 functions downstream of actin polymerization to reinforce frontness.
Calpain 2 Localizes to GM-3rich Lipid Rafts at the Leading Edge
Previous studies have demonstrated that leukocytes establish GM-1rich lipid rafts at the rear and GM-3rich rafts at the leading edge of the cell in response to chemoattractant stimulation. These lipid rafts serve as organizing centers during chemotaxis, sequestering signaling proteins to specific regions of the cell (Manes et al., 1999
; Gomez-Mouton et al., 2001
; Pierini et al., 2003
; Gomez-Mouton et al., 2004
; Kindzelskii et al., 2004
). Our data indicate that calpain 2 is recruited to the cell front upon chemoattractant stimulation, suggesting that calpain 2 activity may be sequestered by localization to lipid rafts. To determine whether calpain 2 localizes to lipid rafts, detergent-resistant membranes (DRMs) were isolated in resting and stimulated primary neutrophils. Isolation of DRMs from resting neutrophils showed that both calpain 1 and calpain 2 partition with soluble cellular components such as RACK1 and CD45 into nonraft fractions (Figure 4A). Chemoattractant stimulation with fMLP induced the partitioning of calpain 2, but not calpain 1, into the DRM fraction with lipid raft markers CD43 and GM-1 (Figure 4A). Although calpain 1 did not move into the lipid raft fraction, it became diffusely distributed throughout the soluble fractions after neutrophil activation. Biochemical characterization does not distinguish between front and rear raft fractions because both GM-1rich lipid rafts and GM-3rich rafts partition to the same fraction in standard lipid raft preparations. To determine whether calpain 2 is associated with GM-3rich rafts at the leading edge of the cell, we performed immunostaining. The results revealed colocalization of calpain 2 with GM-3 lipid rafts at the leading edge of the cell after chemoattractant stimulation (Figure 4B), suggesting that calpain 2 specifically translocates to GM-3containing lipid rafts at the leading edge of neutrophils. In addition, treatment with the lipid raft disrupting drug methyl-
-cyclo-dextran disrupted calpain 2 localization and prevented its colocalization with F-actin after chemoattractant stimulation (Figure 4C). Together, these findings demonstrate that calpain 2, but not calpain 1, partitions to cholesterol-rich membrane domains, and this localization may function to restrict calpain 2 activity to specific regions of the leading edge of the cell during chemotaxis.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We previously showed that inhibition of calpain 1, but not calpain 2, in resting neutrophils induces random motility in the absence of exogenous activators and that calpain 2 is not required for random migration induced by uniform chemoattractant stimulation (Lokuta et al., 2003
). Interestingly, the increase in random migration induced by calpain inhibition is accompanied by a diminished chemotactic response, and our findings now suggest that calpain 2 is a key isoform involved in chemotaxis. In accordance with their distinct functional roles, calpain 2, but not calpain 1, localizes to the leading edge during chemotaxis. The spatial segregation of signaling molecules to different subcellular regions during neutrophil chemotaxis is not uncommon. For example, members of the small Rho-GTPase family, such as Rac and Cdc42, have been shown to localize to the leading edge (Srinivasan et al., 2003
), whereas Rho translocates to the cell rear (Xu et al., 2003
). Accordingly, Rac and Cdc42 are essential for polarization and directional migration, whereas Rho is responsible for rear retraction (Niggli, 1999
; Alblas et al., 2001
). Therefore, spatial restriction of calpain 2 to the cell front suggests that calpain 2 plays a role in the amplification of frontness signaling at the leading edge during neutrophil chemotaxis.
Further analysis of calpain 2 function during chemotaxis indicates that calpain 2 promotes frontness by stabilizing lamellipod formation in the direction of chemoattractant (Figures 3, 5, and 6). Calpain 2 is an immediate-early marker of the cell front, and its localization is sensitive to positional changes in the chemotactic gradient. In addition, dHL-60 cells that overexpress calpain 2 generate a prominent pseudopod at the leading edge, demonstrate persistent polarity in a gradient of chemoattractant, and display enhanced chemotaxis. In contrast, expression of protease-dead calpain 2 impairs neutrophil chemotaxis by compromising pseudopod formation at the leading edge. Our findings in neutrophils are consistent with a recent study that demonstrates a key role for calpain 2 in regulating membrane protrusion and leading edge formation in fibroblasts (Franco et al., 2004a
). It is intriguing to speculate that calpain 2 may function in a pathway analogous to PIP3 and Cdc42, which localize to the cell front and function not only to promote pseudopod formation at the leading edge but also to regulate Rho-mediated contractility at the cell rear (Van Keymeulen et al., 2006
).
Previous studies have shown that stimulation of T-cells with phorbol 12-myristate 13-acetate partitions calpain activity to the membrane (Rock et al., 2000
) and that calpain 2, but not calpain 1, associates with lipid rafts in T-cells. In accordance with these findings, our work demonstrates that calpain 2, but not calpain 1, also targets to GM-3rich lipid rafts at the leading edge of activated neutrophils. Targeting of calpain 2 to lipid rafts may serve to restrict calpain 2 activity at the leading edge and most likely acts as a scaffold to bring calpain 2 in proximity with key regulators of calpain activity such as calcium, phosphoinositides, and pH (Guroff, 1964
; Saido et al., 1992
; Arthur and Crawford, 1996
; Melloni et al., 1996
; Shiraha et al., 2002
; Glading et al., 2004
). Recent work suggests that the calcium channel TrpC localizes to lipid raft domains at the leading edge (Kindzelskii et al., 2004
), which would place it in proximity to calpain 2 and possibly provide a mechanism to regulate calpain 2 activity locally. Furthermore, both calpain 2 and phosphoinositides localize to the leading edge and several groups have shown that binding of phospholipids to the C2-like region in calpain domain III can lower the calcium concentration required for calpain activation (Saido et al., 1992
; Melloni et al., 1996
; Tompa et al., 2001
; Shao et al., 2006
). Finally, previous studies have shown the localization of the mammalian Na+-H+ exchanger NHE1 to the leading edge and have implicated the exchanger in regulating calpain activity (Denker and Barber, 2002
). A recent study using Dictyostelium discoideum demonstrated that a NHE1 homologue, DdNHE1, also localizes to the leading edge and is required for cell polarization during chemotaxis in a cAMP gradient (Patel and Barber, 2005
). Together, spatial restriction of calpain 2 within lipid rafts may provide a mechanism to allow for the localized activation of calpain 2 at the leading edge during neutrophil chemotaxis.
A critical but unanswered question is the identity of the key effectors of calpain 2 activity at the cell front. Recent studies indicate that calpain 2-mediated talin proteolysis is a key mechanism that mediates adhesion dynamics in fibroblasts (Franco et al., 2004b
). Talin also localizes to the leading edge during neutrophil chemotaxis and is associated with lipid rafts in activated neutrophils (Yan and Berton, 1998
). Calpain-mediated proteolysis of talin also occurs in neutrophils stimulated with chemoattractant and has been implicated in regulating the association of
2 integrin with the actin cytoskeleton (Sampath et al., 1998
). Accordingly, our findings suggest that ectopic expression of calpain 2 in dHL-60 cells increases talin proteolysis in response to chemoattractant and that this proteolysis is reduced by expression of calpain 2 PD. However, despite the well-respected relationship between calpain and talin, it is likely that additional calpain substrates play a role in calpain 2 effector pathways during chemotaxis.
In summary, we show that calpain 1 and calpain 2 are asymmetrically distributed upon chemoattractant stimulation with calpain 2, but not calpain 1, targeted to lipid rafts at the cell front. We also show that calpain 2 is recruited during early pseudopod formation to the area of the cell experiencing the highest concentration of chemoattractant and that calpain 2 localization is defined according to spatial cues from the chemotactic gradient. Finally, we demonstrate that calpain 2 activity is necessary for limiting pseudopod formation and for efficient chemotaxis. Based on our data, we propose that calpain 2 is a novel component of the signaling pathways at the leading edge that bias pseudopod formation in the direction of chemoattractant to promote frontness during neutrophil chemotaxis (Figure 7). We hypothesize that the localization of calpain 2 to lipid rafts at the leading edge provides a scaffold to restrict calpain 2 activity to highly localized regions at the leading edge and place it in proximity to specific effector pathways. Additional work is necessary to determine the calpain 2 mediated effector pathways during neutrophil chemotaxis and to understand the significance of calpain 1 targeting in neutrophil chemotaxis.
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
![]()
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
These authors contributed equally to this work. ![]()
Address correspondence to: Anna Huttenlocher (huttenlocher{at}wisc.edu)
Abbreviations used: C5a, Complement factor 5a; DIC, differential interference contrast; dHL-60, differentiated HL-60; fMLP, N-formyl- L-methionyl-L-leucyl-L-phenylalanine; GM, ganglioside marker-1; PD, protease dead; PMN, polymorphonuclear cell; PIP3, phosphatidylinositol-3,4,5-triphosphate; RACK, receptor for activated C kinase.
| REFERENCES |
|---|
|
|
|---|
Arthur, J. S. and Crawford, C. (1996). Investigation of the interaction of m-calpain with phospholipids:calpain-phospholipid interactions. Biochim. Biophys. Acta 1293, 201206.[CrossRef][Medline]
Arthur, J. S., Gauthier, S., Elce, J. S. (1995). Active site residues in m-calpain: identification by site-directed mutagenesis. FEBS Lett 368, 397400.[CrossRef][Medline]
Badizadegan, K., Dickinson, B. L., Wheeler, H. E., Blumberg, R. S., Holmes, R. K., Lencer, W. I. (2000). Heterogeneity of detergent-insoluble membranes from human intestine containing caveolin-1 and ganglioside G(M1). Am. J. Physiol 278, G895G904.
Bhatt, A., Kaverina, I., Otey, C., Huttenlocher, A. (2002). Regulation of focal complex composition and disassembly by the calcium-dependent protease calpain. J. Cell Sci 115, 34153425.
Carrigan, S. O., Weppler, A. L., Issekutz, A. C., Stadnyk, A. W. (2005). Neutrophil differentiated HL-60 cells model Mac-1 (CD11b/CD18)-independent neutrophil transepithelial migration. Immunology 115, 108117.[CrossRef][Medline]
Collins, S. J., Gallo, R. C., Gallagher, R. E. (1977). Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature 270, 347349.[CrossRef][Medline]
Collins, S. J., Ruscetti, F. W., Gallagher, R. E., Gallo, R. C. (1978). Terminal differentiation of human promyelocytic leukemia cells induced by dimethyl sulfoxide and other polar compounds. Proc. Natl. Acad. Sci. USA 75, 24582462.
Collins, S. J., Ruscetti, F. W., Gallagher, R. E., Gallo, R. C. (1979). Normal functional characteristics of cultured human promyelocytic leukemia cells (HL-60) after induction of differentiation by dimethylsulfoxide. J. Exp. Med 149, 969974.
De Tullio, R., Stifanese, R., Salamino, F., Pontremoli, S., Melloni, E. (2003). Characterization of a new p94-like calpain form in human lymphocytes. Biochem. J 375, 689696.[CrossRef][Medline]
Denker, S. P. and Barber, D. L. (2002). Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1. J. Cell Biol 159, 10871096.
Devreotes, P. and Janetopoulos, C. (2003). Eukaryotic chemotaxis: distinctions between directional sensing and polarization. J. Biol. Chem 278, 2044520448.
Dourdin, N., Bhatt, A. K., Dutt, P., Greer, P. A., Arthur, J. S., Elce, J. S., Huttenlocher, A. (2001). Reduced cell migration and disruption of the actin cytoskeleton in calpain-deficient embryonic fibroblasts. J. Biol. Chem 276, 4838248388.
Franca-Koh, J. and Devreotes, P. N. (2004). Moving forward: mechanisms of chemoattractant gradient sensing. Physiology 19, 300308.
Franco, S. J., Perrin, B. J., Huttenlocher, A. (2004a). Isoform specific function of calpain 2 in regulating membrane protrusion. Exp. Cell Res 299, 179187.[CrossRef][Medline]
Franco, S. J., Rodgers, M. A., Perrin, B. J., Han, J., Bennin, D. A., Critchley, D. R., Huttenlocher, A. (2004b). Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat. Cell Biol 6, 977983.[CrossRef][Medline]
Funamoto, S., Meili, R., Lee, S., Parry, L., Firtel, R. A. (2002). Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109, 611623.[CrossRef][Medline]
Gallagher, R., et al. (1979). Characterization of the continuous, differentiating myeloid cell line (HL-60) from a patient with acute promyelocytic leukemia. Blood 54, 713733.
Glading, A., Bodnar, R. J., Reynolds, I. J., Shiraha, H., Satish, L., Potter, D. A., Blair, H. C., Wells, A. (2004). Epidermal growth factor activates m-calpain (calpain II), at least in part, by extracellular signal-regulated kinase-mediated phosphorylation. Mol. Cell Biol 24, 24992512.
Glading, A., Uberall, F., Keyse, S. M., Lauffenburger, D. A., Wells, A. (2001). Membrane proximal ERK signaling is required for M-calpain activation downstream of epidermal growth factor receptor signaling. J. Biol. Chem 276, 2334123348.
Goll, D. E., Thompson, V. F., Li, H., Wei, W., Cong, J. (2003). The calpain system. Physiol. Rev 83, 731801.
Gomez-Mouton, C., Abad, J. L., Mira, E., Lacalle, R. A., Gallardo, E., Jimenez-Baranda, S., Illa, I., Bernad, A., Manes, S., Martinez, A. C. (2001). Segregation of leading-edge and uropod components into specific lipid rafts during T cell polarization. Proc. Natl. Acad. Sci. USA 98, 96429647.
Gomez-Mouton, C., Lacalle, R. A., Mira, E., Jimenez-Baranda, S., Barber, D. F., Carrera, A. C., Martinez, A. C., Manes, S. (2004). Dynamic redistribution of raft domains as an organizing platform for signaling during cell chemotaxis. J. Cell Biol 164, 759768.
Guroff, G. (1964). A neutral, calcium-activated proteinase from the soluble fraction of rat brain. J. Biol. Chem 239, 149155.
Harlow, E. and Lane, D. (1999). Using Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Hauert, A. B., Martinelli, S., Marone, C., Niggli, V. (2002). Differentiated HL-60 cells are a valid model system for the analysis of human neutrophil migration and chemotaxis. Int. J. Biochem. Cell Biol 34, 838854.[CrossRef][Medline]
Huttenlocher, A. (2005). Cell polarization mechanisms during directed cell migration. Nat. Cell Biol 7, 336337.[CrossRef][Medline]
Huttenlocher, A., Ginsberg, M. H., Horwitz, A. F. (1996). Modulation of cell migration by integrin-mediated cytoskeletal linkages and ligand-binding affinity. J. Cell Biol 134, 15511562.
Huttenlocher, A., Palecek, S. P., Lu, Q., Zhang, W., Mellgren, R. L., Lauffenburger, D. A., Ginsberg, M. H., Horwitz, A. F. (1997). Regulation of cell migration by the calcium-dependent protease calpain. J. Biol. Chem 272, 3271932722.
Jordan, M., Schallhorn, A., Wurm, F. M. (1996). Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation. Nucleic Acids Res 24, 596601.
Kimmel, A. R. and Parent, C. A. (2003). The signal to move: D. discoideum go orienteering. Science 300, 15251527.
Kindzelskii, A. L., Sitrin, R. G., Petty, H. R. (2004). Cutting edge: optical microspectrophotometry supports the existence of gel phase lipid rafts at the lamellipodium of neutrophils: apparent role in calcium signaling. J. Immunol 172, 46814685.
Li, Z., et al. (2003). Directional sensing requires G beta gamma-mediated PAK1 and PIX alpha-dependent activation of Cdc42. Cell 114, 215227.[CrossRef][Medline]
Lokuta, M. A., Nuzzi, P. A., Huttenlocher, A. (2003). Calpain regulates neutrophil chemotaxis. Proc. Natl. Acad. Sci. USA 100, 40064011.
Manes, S., Mira, E., Gomez-Mouton, C., Lacalle, R. A., Keller, P., Labrador, J. P., Martinez, A. C. (1999). Membrane raft microdomains mediate front-rear polarity in migrating cells. EMBO J 18, 62116220.[CrossRef][Medline]
Melloni, E., Michetti, M., Salamino, F., Minafra, R., Pontremoli, S. (1996). Modulation of the calpain autoproteolysis by calpastatin and phospholipids. Biochem. Biophys. Res. Commun 229, 193197.[CrossRef][Medline]
Niggli, V. (1999). Rho-kinase in human neutrophils: a role in signaling for myosin light chain phosphorylation and cell migration. FEBS Lett 445, 6972.[CrossRef][Medline]
Palecek, S. P., Huttenlocher, A., Horwitz, A. F., Lauffenburger, D. A. (1998). Physical and biochemical regulation of integrin release during rear detachment of migrating cells. J. Cell Sci 111, 929940.[Abstract]
Patel, H. and Barber, D. L. (2005). A developmentally regulated Na-H exchanger in Dictyostelium discoideum is necessary for cell polarity during chemotaxis. J. Cell Biol 169, 321329.
Pierini, L. M., Eddy, R. J., Fuortes, M., Seveau, S., Casulo, C., Maxfield, F. R. (2003). Membrane lipid organization is critical for human neutrophil polarization. J. Biol. Chem 278, 1083110841.
Rock, M. T., Dix, A. R., Brooks, W. H., Roszman, T. L. (2000). Beta1 integrin-mediated T cell adhesion and cell spreading are regulated by calpain. Exp. Cell Res 261, 260270.[CrossRef][Medline]
Rodighiero, C., Fujinaga, Y., Hirst, T. R., Lencer, W. I. (2001). A cholera toxin B-subunit variant that binds ganglioside G(M1) but fails to induce toxicity. J. Biol. Chem 276, 3693936945.
Ruoslahti, E., Hayman, E. G., Pierschbacher, M., Engvall, E. (1982). Fibronectin: purification, immunochemical properties, and biological activities. Methods Enzymol 82, 803831.
Saido, T. C., Shibata, M., Takenawa, T., Murofushi, H., Suzuki, K. (1992). Positive regulation of µ-calpain action by polyphosphoinositides. J. Biol. Chem 267, 2458524590.
Sampath, R., Gallagher, P. J., Pavalko, F. M. (1998). Cytoskeletal interactions with the leukocyte integrin beta2 cytoplasmic tail. Activation-dependent regulation of associations with talin and alpha-actinin. J. Biol. Chem 273, 3358833594.
Schymeinsky, J., Sindrilaru, A., Frommhold, D., Sperandio, M., Gerstl, R., Then, C., Mocsai, A., Scharffetter-Kochanek, K., Walzog, B. (2006). The Vav binding site of the non-receptor tyrosine kinase Syk at Tyr 348 is critical for
2 integrin (CD11/CD18)-mediated neutrophil migration. Blood 108, 39193927.
Schymeinsky, J., Then, C., Walzog, B. (2005). The non-receptor tyrosine kinase Syk regulates lamellipodium formation and site-directed migration of human leukocytes. J. Cell Physiol 204, 614622.[CrossRef][Medline]
Servant, G., Weiner, O. D., Herzmark, P., Balla, T., Sedat, J. W., Bourne, H. R. (2000). Polarization of chemoattractant receptor signaling during neutrophil chemotaxis. Science 287, 10371040.
Servant, G., Weiner, O. D., Neptune, E. R., Sedat, J. W., Bourne, H. R. (1999). Dynamics of a chemoattractant receptor in living neutrophils during chemotaxis. Mol. Biol. Cell 10, 11631178.
Shao, H., Chou, J., Baty, C. J., Burke, N. A., Watkins, S. C., Stolz, D. B., Wells, A. (2006). Spatial localization of m-calpain to the plasma membrane by phosphoinositide biphosphate binding during epidermal growth factor receptor-mediated activation. Mol. Cell Biol 26, 54815496.
Shiraha, H., Glading, A., Chou, J., Jia, Z., Wells, A. (2002). Activation of m-calpain (calpain II) by epidermal growth factor is limited by protein kinase A phosphorylation of m-calpain. Mol. Cell Biol 22, 27162727.
Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman, D., Bourne, H. R. (2003). Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. J. Cell Biol 160, 375385.
Tompa, P., Emori, Y., Sorimachi, H., Suzuki, K., Friedrich, P. (2001). Domain III of calpain is a ca2+-regulated phospholipid-binding domain. Biochem. Biophys. Res. Commun 280, 13331339.[CrossRef][Medline]
Van Haastert, P.J.M. and Devreotes, P. N. (2004). Chemotaxis: signalling the way forward. Nat. Rev. Mol. Cell Biol 5, 626634.[CrossRef][Medline]
Van Keymeulen, A., Wong, K., Knight, Z. A., Govaerts, C., Hahn, K. M., Shokat, K. M., Bourne, H. R. (2006). To stabilize neutrophil polarity, PIP3 and Cdc42 augment RhoA activity at the back as well as signals at the front. J. Cell Biol 174, 437445.[CrossRef][Medline]
Weiner, O. D., Neilsen, P. O., Prestwich, G. D., Kirschner, M. W., Cantley, L. C., Bourne, H. R. (2002). A PtdInsP(3)- and Rho GTPase-mediated positive feedback loop regulates neutrophil polarity. Nat. Cell Biol 4, 509513.[CrossRef][Medline]
Weiner, O. D., Servant, G., Welch, M. D., Mitchison, T. J., Sedat, J. W., Bourne, H. R. (1999). Spatial control of actin polymerization during neutrophil chemotaxis. Nat. Cell Biol 1, 7581.[CrossRef][Medline]
Witkowski, J. M., Zmuda-Trzebiatowska, E., Swiercz, J. M., Cichorek, M., Ciepluch, H., Lewandowski, K., Bryl, E., Hellmann, A. (2002). Modulation of the activity of calcium-activated neutral proteases (calpains) in chronic lymphocytic leukemia (B-CLL) cells. Blood 100, 18021809.
Wong, K., Pertz, O., Hahn, K., Bourne, H. (2006). Neutrophil polarization: spatiotemporal dynamics of RhoA activity support a self-organizing mechanism. Proc. Natl. Acad. Sci. USA 103, 36393644.
Xu, J., Wang, F., Van Keymeulen, A., Herzmark, P., Straight, A., Kelly, K., Takuwa, Y., Sugimoto, N., Mitchison, T., Bourne, H. R. (2003). Divergent signals and cytoskeletal assemblies regulate self-organizing polarity in neutrophils. Cell 114, 201214.[CrossRef][Medline]
Yan, S. R. and Berton, G. (1998). Antibody-induced engagement of beta2 integrins in human neutrophils causes a rapid redistribution of cytoskeletal proteins, Src-family tyrosine kinases, and p72syk that precedes de novo actin polymerization. J. Leukoc. Biol 64, 401408.[Abstract]
This article has been cited by other articles:
![]() |
M. Katsube, T. Kato, M. Kitagawa, H. Noma, H. Fujita, and S. Kitagawa Calpain-mediated regulation of the distinct signaling pathways and cell migration in human neutrophils J. Leukoc. Biol., July 1, 2008; 84(1): 255 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Sprague, T. S. Fraley, H. S. Jang, S. Lal, and J. A. Greenwood Phosphoinositide Binding to the Substrate Regulates Susceptibility to Proteolysis by Calpain J. Biol. Chem., April 4, 2008; 283(14): 9217 - 9223. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Cortesio, K. T. Chan, B. J. Perrin, N. O. Burton, S. Zhang, Z.-Y. Zhang, and A. Huttenlocher Calpain 2 and PTP1B function in a novel pathway with Src to regulate invadopodia dynamics and breast cancer cell invasion J. Cell Biol., March 5, 2008; 180(5): 957 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Lacalle, R. M. Peregil, J. P. Albar, E. Merino, C. Martinez-A, I. Merida, and S. Manes Type I phosphatidylinositol 4-phosphate 5-kinase controls neutrophil polarity and directional movement J. Cell Biol., December 31, 2007; 179(7): 1539 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lokuta, M. A. Senetar, D. A. Bennin, P. A. Nuzzi, K. T. Chan, V. L. Ott, and A. Huttenlocher Type I{gamma} PIP Kinase Is a Novel Uropod Component that Regulates Rear Retraction during Neutrophil Chemotaxis Mol. Biol. Cell, December 1, 2007; 18(12): 5069 - 5080. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||