![]() |
|
|
Vol. 18, Issue 3, 806-814, March 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
F508-CFTR for Endoplasmic Reticulum-associated Degradation


*Department of Biological Sciences, University of Pittsburgh, Pittsburgh, PA 15260; and
Department of Cell Biology and Physiology, University of Pittsburgh, Pittsburgh, PA 15261
Submitted May 25, 2006;
Revised October 25, 2006;
Accepted December 5, 2006
Monitoring Editor: Jonathan Weissman
| ABSTRACT |
|---|
|
|
|---|
F508-CFTR variant can be selected for endoplasmic reticulum (ER)-associated degradation (ERAD) by molecular chaperones. Because the message corresponding to HSP26, which encodes a small heat-shock protein (sHsp) in yeast was up-regulated in response to CFTR expression, we examined the impact of sHsps on ERAD. First, we observed that CFTR was completely stabilized in cells lacking two partially redundant sHsps, Hsp26p and Hsp42p. Interestingly, the ERAD of a soluble and a related integral membrane protein were unaffected in yeast deleted for the genes encoding these sHsps, and CFTR polyubiquitination was also unaltered, suggesting that Hsp26p/Hsp42p are not essential for polyubiquitination. Next, we discovered that
F508-CFTR degradation was enhanced when a mammalian sHsp,
A-crystallin, was overexpressed in human embryonic kidney 293 cells, but wild-type CFTR biogenesis was unchanged. Because
A-crystallin interacted preferentially with
F508-CFTR and because purified
A-crystallin suppressed the aggregation of the first nucleotide-binding domain of CFTR, we suggest that sHsps maintain the solubility of
F508-CFTR during the ERAD of this polypeptide. | INTRODUCTION |
|---|
|
|
|---|
A prominent ERAD substrate is the cystic fibrosis transmembrane conductance regulator (CFTR), and many requirements for its degradation have been established. CFTR is a 1480-amino acid integral membrane glycoprotein that belongs to the ATP-binding cassette (ABC) transporter superfamily and functions as a cAMP-regulated chloride and bicarbonate channel in the apical membrane of epithelial cells, including those of airways, pancreas, intestine, and other fluid-secreting epithelia (Pilewski and Frizzell, 1999
). CFTR is composed of two membrane-spanning domains (MSD1 and MSD2), each comprising six transmembrane segments, two nucleotide-binding domains (NBD1 and NBD2), and a central regulatory (R) domain. Mutations within the gene, particularly the deletion of the phenylalanine at position 508 (
F508-CFTR), may lead to cystic fibrosis (CF), one of the most common autosomal recessive disorders in individuals of European descent. Although perhaps
75% of wild-type CFTR is targeted for ERAD, essentially all of the
F508 variant is destroyed in the ER and thus fails to mature (Cheng et al., 1990
).
From studies in mammalian cells and in yeast, it is clear that a large number of cytoplasmic and ER lumenal chaperones impact CFTR and
F508-CFTR biogenesis. For example, Hsp90, Hsp40s, and the Hsp70 nucleotide exchange factor (NEF) HspBP1 facilitate the Hsp70-dependent folding of CFTR (Strickland et al., 1997
; Loo et al., 1998
; Meacham et al., 1999
; Rubenstein and Zeitlin, 2000
; Choo-Kang and Zeitlin, 2001
; Farinha et al., 2002
; Alberti et al., 2004
; Youker et al., 2004
; Zhang et al., 2006
). In addition, the ER chaperone calnexin interacts with the immature form of CFTR and
F508-CFTR and may also facilitate folding (Pind et al., 1994
; Okiyoneda et al., 2004
; Farinha and Amaral, 2005
). However, when an Hsp70/Hsp90-interacting E3 ubiquitin ligase, known as CHIP, is recruited to chaperone-bound CFTR, there is a shift toward the degradation pathway (Connell et al., 2001
; Meacham et al., 2001
), and more recent data indicate that CHIP acts after the RMA1 ubiquitin ligase monitors CFTR biogenesis (Younger et al., 2006
). Nevertheless, given the complexity of the CFTR-folding pathway (Du et al., 2005
; Kleizen et al., 2005
; Thibodeau et al., 2005
) and the continued identification of factors that facilitate protein folding in the ER and ERAD, it is likely that additional chaperones and chaperone-like proteins that impact CFTR maturation remain to be discovered.
In this report, we show that small heat-shock proteins (sHsps) facilitate CFTR degradation in yeast and that overexpression of a mammalian sHsp selectively accelerates the degradation of
F508-CFTR. These data suggest that sHsps distinguish terminally misfolded forms of
F508-CFTR from the wild-type protein and add cystic fibrosis to the growing list of diseases and homeostatic processes that sHsps are thought to affect, a list that includes disorders associated with protein aggregation, ischemia/reperfusion injury, tumorigenesis, progression and metastasis, and apoptosis (Sun and MacRae, 2005
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
strain in the RSY368 background was created using polymerase chain reaction (PCR)-based gene disruption (Brachmann et al., 1998
|
The antibodies used in this study were raised against the C and N terminus of CFTR (M3A7 and MM13-4, respectively; Chemicon International, Temecula, CA/Upstate Biotechnology, Lake Placid, NY), the C terminus of CFTR (R&D Systems, Minneapolis, MN),
A-crystallin, Hsp70, and BiP (Stressgen Biotechnologies, San Diego, CA), Kar2p and Ssa1p (Brodsky and Schekman, 1993
), Sec61p (Stirling et al., 1992
), Hsp82p (a gift from A. Caplan, Mount Sinai School of Medicine, New York City, NY), Hsp26p (a gift from J. Buchner, Technical University of Munich, Munich, Germany), Hsp42p (a gift from S. Sandmeyer, University of California, Irvine, Irvine, CA), Hsp104p (a gift from J. Glover, University of Toronto, Toronto, Ontario, Canada), ubiquitin (a gift from C. Pickart and S. Michaelis, Johns Hopkins University School of Medicine, Baltimore, MD), or the HA-epitope (12CA5, Roche Molecular Biochemicals, Indianapolis, IN). To detect the primary antibody, horseradish peroxidase-conjugated secondary antibodies (anti-rabbit or anti-mouse; GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) were used.
Preparation of RNA and Northern Blot Analysis
A yeast colony was inoculated into 4 ml of Sc-ura supplemented with 2% glucose and incubated overnight at 30°C. The culture was diluted into 250 ml of the same medium and grown to an OD600 of
0.3 at 30°C. Cells were harvested by centrifugation at 4000 rpm for 10 min in a Sorvall GSA rotor at 20°C. The pellet was resuspended in 25 ml of sterile water and centrifuged at 4000 rpm for 5 min at 20°C in a Sorvall SS 34 rotor. Pellets were snap frozen in liquid nitrogen and stored at 80°C. Yeast RNA was extracted three times with hot acid-phenol (Sigma-Aldrich, St. Louis, MO) (Ausubel et al., 1988
) and twice with chloroform and subjected to the RNeasy Midi kit (QIAGEN, Valencia, CA). Only samples with a ratio of A260/A280 higher than 1.8 were used. RNA integrity was confirmed on a formaldehyde-agarose gel.
For Northern blots, 20 µg of RNA was resolved on a formaldehyde-agarose gel, transferred to Gene Screen Plus membranes (PerkinElmer Life Science and Analytical Sciences, Boston, MA), and hybridized using 32P-labeled, randomly primed probes produced from PCR fragments by using primers against HSP26 (forward: CACCAAGACGTCAGTTAGCA, reverse: TGTTGTCTGCAT CCACACCT), FES1 (forward: CTACAGCAGTTATTCGGTGG, reverse: ACTCTCGT CAGACAAGCACT), HSP82 (forward: AGAGAGCACCATTCGACTTG, reverse: AATTGACCA GTTCTGATAGC), and SEC61 (forward: CCAACCGTGGTACTTT ACTG, reverse: GTCCAGAAGAGCTTCGGATA). Filters were processed as described previously (Ausubel et al., 1988
), except that the high-temperature wash was performed at 55°C for 10 min. Bound probe was removed from the filters by incubation in 0.1X SSC, supplemented with an additional 15 mM NaCl, and containing 1% SDS for 20 min at 100°C.
ERAD Assays
The ERAD of HA-tagged CFTR in yeast was performed as described previously (Zhang et al., 2002b
) but by using only fresh transformants, and data were quantified with a Kodak 440CF Image Station and Kodak 1D (version 3.6; Eastman Kodak, Rochester, NY) software. The degradation of HA-tagged CPY* and HA-tagged Ste6p* were determined by pulse-chase immunoprecipitations from 35S-metabolically labeled yeast as published previously (Zhang et al., 2001
). Wild-type CFTR/
F508-CFTR degradation and maturation in human embryonic kidney (HEK)293 cells were assessed by pulse-chase immunoprecipitation as reported previously (Zhang et al., 2002a
). The immunoprecipitates were resolved by SDS-PAGE and analyzed by PhosphorImager analysis by using Image Gauge software (version 3.45; FujiFilm Science Lab, Stamford, CT). Statistical analyses were performed via the program available at http://faculty.vassar.edu/lowry/t_ind_stats.html.
Detection of CFTR Polyubiquitination
Cells expressing CFTR-HA and containing a vector for the copper-inducible expression of a myc-tagged form of ubiquitin (provided by M. Hochstrasser, Yale University, New Haven, CT) were grown to log phase in 20 ml of selective medium at 30°C before 100 µM CuSO4 was added, and the cells were incubated for 3 h. Pelleted cells were washed with ice-cold 10 mM NaN3 and disrupted with glass beads in 200 µl of 20 mM HEPES, pH 7.4, 50 mM KOAc, 2 mM EDTA, 0.1 M sorbitol, 1 mM dithiothreitol and protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 0.5 µg/ml pepstatin A) by agitation on a Vortex mixer five times for 1 min with 1-min intervals on ice between each cycle. The homogenate was collected and pooled with two 500-µl rinses of the beads with buffer 88 (20 mM HEPES, pH 6.8, 150 mM KOAc, 250 mM sorbitol, and 5 mM MgOAc). After unbroken cells were removed by centrifugation, the supernatant was centrifuged at 18,000 x g for 20 min at 4°C. The crude membrane pellet was washed and resuspended in buffer 88 so that the absorbance at 280 nm in 2% SDS was
40. Membranes (10 µl) were mixed with 10 µl of buffer 88 and solubilized in 80 µl of 50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1.25% SDS, 10 mM N-ethylmaleimide, and protease inhibitors at 37°C for 20 min. Samples were added to 400 µl of 50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 2% Triton X-100, 10 mM N-ethylmaleimide, and protease inhibitors and insoluble material was removed by centrifugation at 18,000 x g for 2 min. CFTR was immunoprecipitated from the supernatants with anti-HA antibody and resolved on a 6% SDS-polyacrylamide gel. CFTR and polyubiquitinated CFTR were decorated on immunoblots with anti-HA antibody and anti-ubiquitin antibody, respectively, after the nitrocellulose filter was incubated in boiling water for 20 min. The bound antibodies were visualized using enhanced chemiluminescence, and the data were quantified as described above.
Mammalian Cell Culture, Plasmids, and Molecular/Cellular Methods
HEK293 cells were cultured in DMEM (Sigma-Aldrich) with 10% fetal bovine serum (Invitrogen), 4 mM L-glutamine (Sigma-Aldrich), and penicillin-streptomycin (Invitrogen) at 37°C in a humidified environment containing 5% CO2. The
A-crystallin gene was removed from a pCIneo vector (provided by U. Andley, Washington University, St. Louis, MO) with SalI (3') and XbaI (5'), and the gene was subcloned into pcDNA3.1 (the SalI site was lost in the cloning process). Construction of CFTR and
F508-CFTR expression plasmids (pcDNA3.1) and the CFTR C-terminal deletion constructs terminating at residue 588 were described previously (Zhang et al., 2002a
; Sun et al., 2006
).
HEK293 cells were transiently transfected with the indicated pcDNA3.1 expression plasmids aided by Lipofectamine 2000 (Invitrogen). After 24 h, the cells were subjected to a pulse-chase analysis as described previously (Zhang et al., 2002a
) or were lysed in 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, and 0.5% NP-40. For coimmunoprecipitation experiments, the cultures were treated with 50 µM MG-132 after transfection for 12 h before cell lysis.
Small Heat-Shock ProteinCFTR Interaction Assays
In total, 500 µg of HEK293 cell lysate was added to 13.3 mM HEPES, pH 7.0, 85 mM potassium-glutamate, 3.3 mM NaCl, 4.7 mM MgSO4, 13.3 mM EGTA, and 2.2 mM CaCl2 (vol/vol, 2:1) and incubated with 1 µg of anti-CFTR antibody M3A7 (Upstate Biotechnology) and anti-CFTR C-terminal antibody (R&D Systems) or with anti-
A-crystallin antibody (Stressgen Biotechnologies) for 2 h. The immunocomplex was isolated by incubation with protein A and G agarose beads for 2 h. Precipitates were isolated and washed three times with 13.3 mM HEPES, pH 7.0, 85 mM potassium-glutamate, 3.3 mM NaCl, 4.7 mM MgSO4, 13.3 mM EGTA, 2.2 mM CaCl2, and 0.25% NP-40, and the proteins were resolved on 415% SDS-polyacrylamide gels and subjected to Western blot analysis. Data were quantified using ImageJ software (http://rsb.info.nih.gov/ij/) and analyzed as described above.
Purification of
A-Crystallin and the NBD1 Aggregation Assay
A-crystallin was expressed in Escherichia coli BL21 DE from the pAED4 vector (provided by K. P. Das, Bose Institute, Kolkata, India), and the protein was purified as described previously (Biswas and Das, 2004
). The molar ratio stated assumes that the sHsp is a monomer. The ability of
A-crystallin to suppress NBD1 aggregation (provided by R. Youker, University of Pittsburgh, Pittsburgh, PA) was determined as described previously (Strickland et al., 1997
; Youker et al., 2004
).
| RESULTS |
|---|
|
|
|---|
F508-CFTR grow as well as cells lacking the CFTR-expression vector, and because CFTR fails to elicit an unfolded protein response (UPR) in yeast (Zhang et al., 2001
150 transcripts up-regulated in strains expressing CFTR were HSP82, which encodes the yeast Hsp90 homologue, and FES1, which is a NEF for a cytosolic Hsp70; both of the corresponding proteins are known to play a role in CFTR biogenesis in yeast and/or mammalian cells (Loo et al., 1998
20% increase in the sHsps, whereas little or no change was observed for Ssa1p (a yeast Hsp70) or Hsp104p. Although the HSP82 message increased, there was no increase in protein levels, suggesting posttranscriptional control. Interestingly, we also noted that the message and protein levels corresponding to Sec61p, a component of the translocon and a UPR target (Casagrande et al., 2000
|
yeast compared with wild-type cells by
50%, indicating that Hsp26p function is important for maximal CFTR degradation.
|
-crystallin domain (van Montfort et al., 2001
-crystallin domain-containing proteins, Hsp26p and Hsp42p. Although they recognize
90% of the same client proteins, only Hsp42p is present constitutively at high levels (Haslbeck et al., 2004
Different ERAD substrates require distinct factors for their degradation, depending on their solubility, membrane association, and location of structural alterations (see Discussion). Thus, it was important to establish whether the proteolysis of other substrates was altered by the loss of Hsp26p and Hsp42p. To this end, wild-type and hsp26
hsp42
strains were transformed with a vector for the constitutive expression of CPY*, a soluble ERAD substrate (Hiller et al., 1996
), and Ste6p*, a truncated form of the yeast a-mating factor pheromone transporter that, like CFTR, is an ABC transporter and is degraded via ERAD (Loayza et al., 1998
). As shown in Figure 2, C and D, we found that the hsp26
hsp42
mutant proficiently degraded both CPY* and Ste6p*, demonstrating that sHsps are important for the proteolysis of only a select class of ER substrates. It is also important to note that these experiments were performed at a permissive temperature for the sHsp mutant strain (30°C) (Petko and Lindquist, 1986
). Moreover, Kar2p, a UPR-regulated luminal Hsp70, was not induced in hsp26
hsp42
cells (our unpublished data). These observations indicate that the observed ERAD defect is due to deletion of the sHsps rather than to a nonspecific up-regulation of stress-inducible genes.
To identify the stage at which the yeast sHsps impact CFTR turnover, CFTR was immunoprecipitated from wild-type and hsp26
hsp42
cells, and the degree of polyubiquitination was assessed by immunoblot analysis. As a control, CFTR polyubiquitination was also measured in wild-type yeast and in cells lacking DOA10 and HRD1, two ubiquitin ligases that catalyze CFTR degradation in this organism (Gnann et al., 2004
). Surprisingly, we found that CFTR polyubiquitination was unaffected in cells lacking the sHsps, although the degree of modification when the ubiquitin ligases were disabled was <50% of the control (Figure 3). We also noted that the steady-state level of total polyubiquitinated proteins in yeast deleted for both HSP26 and HSP42 was unaffected, but was modestly higher when ubiquitin was overexpressed (Supplemental Figure 2S).
|
A-Crystallin Accelerates
F508-CFTR Degradation in HEK293 Cells
F508-CFTR and either a vector control or a vector engineered for the overexpression of
A-crystallin.
A-crystallin is one of 10 "
-crystallin-like" proteins in humans (Kappe et al., 2003
A-crystallin associates with unfolded proteins and prevents their aggregation (Horwitz, 1992
A-crystallin is expressed in human cells that normally synthesize CFTR (our unpublished data). When CFTR expression was examined in extracts from each cell type by Western blot analysis, we noted that
A-crystallin overexpression did not alter the amount of wild-type CFTR but that
F508-CFTR steady-state levels decreased (Figure 4). Because Hsp70 levels were unchanged, the observed effect was likely not a result of secondary consequences from enhanced
A-crystallin expression.
|
A-crystallin accelerated CFTR and/or
F508-CFTR degradation, HEK293 cells were again transfected with the CFTR or
F508-CFTR expression vector and either the vector control or the
A-crystallin expression vector. Pulse-chase immunoprecipitation experiments were then performed to follow the stability of core-glycosylated immature CFTR (B-band) and its maturation to the complex-glycosylated form (C-band) (Figure 5);
F508-CFTR fails to mature and thus only the B-band is evident (Figure 6). We observed that for wild-type CFTR the disappearance of CFTR B-band and appearance of the C-band proceeded at equal rates in cultures transfected with the empty vector and in those overexpressing
A-crystallin. In contrast, the overexpression of
A-crystallin enhanced
F508-CFTR proteolysis by diminishing a reproducible lag in the disappearance of the B-band (Figure 6). This result indicates that
A-crystallin impacts only the ERAD of
F508-CFTR and thus might be able to distinguish between the wild type and mutant channels in mammals.
|
|
A-Crystallin Interacts Preferentially with
F508-CFTR and Prevents the Aggregation of NBD1
A-crystallin and CFTR and
F508-CFTR was assessed by immunoprecipitation after cotransfection of HEK293 cells with the
A-crystallin expression vector and expression vectors for either the wild-type or mutant protein. As displayed in Figure 7, the sHsp was isolated in a complex with CFTR or
F508-CFTR and by quantifying the amount of CFTR/
F508-CFTR relative to the chaperone, we estimated that approximately twofold more
A-crystallin bound to
F508-CFTR than to the wild-type protein.
|
A-crystallin also inhibits the formation of high-molecular-weight NBD1 oligomers. Toward this goal,
A-crystallin was expressed in and purified from E. coli and then incubated with NBD1 upon its dilution from denaturant. At a chaperone-to-substrate molar ratio of 0.5:1,
A-crystallin suppressed NBD1 aggregation by
50%, and at a molar ratio of 1:1 aggregation was suppressed by
80% (Figure 8). Although most chaperones suppress NBD1 aggregation to a similar extent only when used at higher molar ratios (e.g., Hdj2:NBD1 at 5:1, Hsc70-Hdj2:NBD1 at 2:1, and Hsp90:NBD1 at 5:1; Meacham et al., 1999
A-crystallin plays an important and previously unappreciated role in chaperoning the degradation of
F508-CFTR.
|
| DISCUSSION |
|---|
|
|
|---|
F508-CFTR in mammalian cells. We also found that one sHsp,
A-crystallin, suppressed NBD1 aggregation and coprecipitated preferentially with
F508-CFTR. Because CFTR polyubiquitination was robust in yeast deleted for
-crystallin domain-containing proteins, we suggest that sHsps increase the accessibility of CFTR to the proteasome after polyubiquitination. If this is true, one might have expected an increase in the steady-state level of polyubiquitinated CFTR, but we cannot exclude the possibility that there was a concomitant increase in the activity of a deubiquitination enzyme or in the amount of aggregated protein. It is also formally possible that sHsps increase the accessibility of CFTR to the ubiquitin-conjugating machinery. The simplest model, though, is that sHsps maintain the solubility of a select group of ERAD substrates after ubiquitin modification.
An increasing number of papers implicate sHsps in the ubiquitin-proteasome pathway. Consistent with our findings
B-crystallin and Hsp27 are up-regulated by and are recruited to aggresomes (Ito et al., 2002
), which are large, cytoplasmic inclusions of mis-folded proteins (Johnston et al., 1998
). In addition, Hsp27 binds to the 26S proteasome and to a polyubiquitinated substrate (Parcellier et al., 2003
). sHsps might directly catalyze the proteolysis of ERAD substrates because
-crystallins regulate proteasome activity and interact with a subunit in the proteasome core (Wagner and Margolis, 1995
; Conconi et al., 1998
, 1999
; Boelens et al., 2001
; Ito et al., 2002
). However, other papers suggest a role for sHsps during substrate ubiquitination:
B-crystallin has been proposed to recruit FBX4, an adaptor molecule for the SCF ubiquitin ligase and promote substrate ubiquitination (den Engelsman et al., 2003
; den Engelsman et al., 2004
), and in vitro Hsp27 seems to facilitate the ubiquitination reaction (Parcellier et al., 2006
). Overall, understanding the precise mechanism of sHsp action during ERAD represents an important, ongoing goal.
The observation that sHsps regulate the half-life of CFTR but not the turnover of a soluble ERAD substrate is in agreement with previous reports demonstrating distinct requirements for the degradation of different classes of ERAD clients (Plemper et al., 1997
; Brodsky et al., 1999
; Hill and Cooper, 2000
; Fewell et al., 2001
; Nishikawa et al., 2001
; Vashist et al., 2001
; Zhang et al., 2001
; Kabani et al., 2003
; Taxis et al., 2003
; Ahner and Brodsky, 2004
; Huyer et al., 2004
; Vashist and Ng, 2004
; Sayeed and Ng, 2005
). However, a recent study reported similar requirements for the ERAD of CFTR and Ste6p* in yeast, which is in contrast to the results presented in Figure 2D (Huyer et al., 2004
). Nevertheless, these newer data are consistent with the exquisite ability of sHsps to recognize subtle conformational differences between substrates (Basha et al., 2006
, and see below) and with the fact that CFTR and Ste6p* are structurally distinct members of the same transporter family. Specifically, the sequence similarity between Ste6p* and CFTR is low and restricted to the NBDs (Kuchler et al., 1989
) and only CFTR contains an R domain. Therefore, it will be important in the future to assess whether other aberrant ABC transporters in yeast require Hsp26p/Hsp42p for their degradation, and combined with the continued structural analysis of ABC transporters (see, for example, Lewis et al., 2004
), it is hoped that the determinant(s) for their degradation can be ascertained.
Our observation that
A-crystallin enhances exclusively the degradation of
F508-CFTR in mammals implies that this sHsp distinguishes the wild type and the mutant variants of the channel. Although immature CFTR and
F508-CFTR are often assumed to adopt the same aberrant conformationone that directs the proteins for ERADother evidence indicates discernible differences between immature wild-type and
F508-CFTR. First, Meacham et al. (1999)
observed an approximately twofold higher abundance of Hsc70
F508-CFTR complexes than Hsc70CFTR complexes. Second, cotransfection of Hsc70 and Hdj-1 stabilized exclusively the immature form of wild-type CFTR (Farinha et al., 2002
). Third, coexpression of Csp1 slowed the degradation of immature wild-type CFTR but increased the turnover of
F508-CFTR (Zhang et al., 2006
; our unpublished data). Fourth, complexes between calnexin and
F508-CFTR were more stable than those between calnexin and wild-type CFTR (Pind et al., 1994
). Fifth, the overexpression of RMA1, which may monitor folding defects in
F508-CFTR, has a greater effect on
F508-CFTR than on wild-type CFTR degradation (Younger et al., 2006
). And finally,
F508-CFTR seems to be degraded independently of glycan modification, whereas proteolysis of the wild-type protein requires the glycan moiety and calnexin function (Farinha and Amaral, 2005
). Moreover, we note that sHsps can distinguish between wild-type protein conformations and structurally identical mutant variants that differ only in their free energies of unfolding; thus, sHsps may be able to recognize transient nonnative states (McHaourab et al., 2002
; Koteiche and McHaourab, 2003
; Sathish et al., 2004
; Shashidharamurthy et al., 2005
), and indeed the cytosolic domain of
F508-CFTR exhibits a distinct conformation as assessed by limited proteolysis (Zhang et al., 1998
). Interestingly, however, we found that
A-crystallin bound with equal efficiencies to an N-terminal, NBD1-containing fragment of wild-type and
F508-CFTR (Supplemental Figure 3S), suggesting that the chaperone recognizes the
F508-folding defect only after the full-length protein has been synthesized.
A hint that sHsps might also respond to the long-term expression of
F508-CFTR in humans was recently provided (Roxo-Rosa et al., 2006
). A proteomic analysis of nasal cells from healthy and
F508-CFTRexpressing individuals uncovered 65 differentially expressed "spots," and among these polypeptides was Hsp27. Interestingly, Hsp27 levels decreased approximately twofold in the samples from CF patients. Although the nature of this effect is unclear, one hypothesisconsistent with previous datais that the chaperone negatively regulates the immune response (De et al., 2000
). Another hypothesis is that the synthesis of this sHsp responds to the concentration of CFTR: Because the steady-state level of
F508-CFTR is low, Hsp27 levels may also drop. However, it is not clear whether the reduction of this sHsp impacts
F508-CFTR turnover.
If sHsps only affect the degradation of
F508-CFTR in mammals, why is the wild-type protein stabilized in yeast lacking Hsp26p and Hsp42p? One answer to this question is that CFTR might be unable to assume the native conformation in this organism, and support for this hypothesis derives from the observation that CFTR fails to exit the ER and is quantitatively degraded in yeast (Kiser et al., 2001
; Zhang et al., 2001
; Fu and Sztul, 2003
). We therefore propose that the yeast CFTR expression system better reflects
F508-CFTR biogenesis than wild-type CFTR biogenesis. Nevertheless, our data suggest that yeast can be used to identify factors that affect the maturation of any mammalian protein, assuming that an expression system has been developed and validated.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Jeffrey L. Brodsky (jbrodsky{at}pitt.edu)
| REFERENCES |
|---|
|
|
|---|
Alberti, S., Bohse, K., Arndt, V., Schmitz, A., Hohfeld, J. (2004). The cochaperone HspBP1 inhibits the CHIP ubiquitin ligase and stimulates the maturation of the cystic fibrosis transmembrane conductance regulator. Mol. Biol. Cell 15, 40034010.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidmann, J. G., Smith, J. G., Struhl, K. (1988). Current protocols in Molecular Biology. New York: Greene Publishing Associates and Wiley Interscience.
Basha, E., Friedrich, K. L., Vierling, E. (2006). The N-terminal arm of small heat shock proteins is important for both chaperone activity and substrate specificity. J. Biol. Chem 281, 3994339952.
Becker, J., Walter, W., Yan, W., Craig, E. A. (1996). Functional interaction of cytosolic hsp70 and a DnaJ-related protein, Ydj1p, in protein translocation in vivo. Mol. Cell Biol 16, 43784386.[Abstract]
Biswas, A. and Das, K. P. (2004). Role of ATP on the interaction of alpha-crystallin with its substrates and its implications for the molecular chaperone function. J. Biol. Chem 279, 4264842657.
Boelens, W. C., Croes, Y., de Jong, W. W. (2001). Interaction between alphaB-crystallin and the human 20S proteasomal subunit C8/alpha7. Biochim. Biophys. Acta 1544, 311319.[CrossRef][Medline]
Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115132.[CrossRef][Medline]
Brodsky, J. L., Lawrence, J. G., Caplan, A. J. (1998). Mutations in the cytosolic DnaJ homologue, YDJ1, delay and compromise the efficient translation of heterologous proteins in yeast. Biochemistry 37, 1804518055.[CrossRef][Medline]
Brodsky, J. L. and Schekman, R. (1993). A Sec63p-BiP complex from yeast is required for protein translocation in a reconstituted proteoliposome. J. Cell Biol 123, 13551363.
Brodsky, J. L., Werner, E. D., Dubas, M. E., Goeckeler, J. L., Kruse, K. B., McCracken, A. A. (1999). The requirement for molecular chaperones during endoplasmic reticulum-associated protein degradation demonstrates that protein export and import are mechanistically distinct. J. Biol. Chem 274, 34533460.
Casagrande, R., Stern, P., Diehn, M., Shamu, C., Osario, M., Zuniga, M., Brown, P. O., Ploegh, H. (2000). Degradation of proteins from the ER of S. cerevisiae requires an intact unfolded protein response pathway. Mol. Cell 5, 729735.[CrossRef][Medline]
Chang, Z., Primm, T. P., Jakana, J., Lee, I. H., Serysheva, I., Chiu, W., Gilbert, H. F., Quiocho, F. A. (1996). Mycobacterium tuberculosis 16-kDa antigen (Hsp16.3) functions as an oligomeric structure in vitro to suppress thermal aggregation. J. Biol. Chem 271, 72187223.
Cheng, S. H., Gregory, R. J., Marshall, J., Paul, S., Souza, D. W., White, G. A., O'Riordan, C. R., Smith, A. E. (1990). Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63, 827834.[CrossRef][Medline]
Choo-Kang, L. R. and Zeitlin, P. L. (2001). Induction of HSP70 promotes DeltaF508 CFTR trafficking. Am. J. Physiol 281, L58L68.
Christianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H., Hieter, P. (1992). Multifunctional yeast high-copy-number shuttle vectors. Gene 110, 119122.[CrossRef][Medline]
Conconi, M., Djavadi-Ohaniance, L., Uerkvitz, W., Hendil, K. B., Friguet, B. (1999). Conformational changes in the 20S proteasome upon macromolecular ligand binding analyzed with monoclonal antibodies. Arch. Biochem. Biophys 362, 325328.[CrossRef][Medline]
Conconi, M., Petropoulos, I., Emod, I., Turlin, E., Biville, F., Friguet, B. (1998). Protection from oxidative inactivation of the 20S proteasome by heat-shock protein 90. Biochem. J 333, 407415.
Connell, P., Ballinger, C. A., Jiang, J., Wu, Y., Thompson, L. J., Hohfeld, J., Patterson, C. (2001). The co-chaperone CHIP regulates protein triage decisions mediated by heat-shock proteins. Nat. Cell Biol 3, 9396.[CrossRef][Medline]
De, A. K., Kodys, K. M., Yeh, B. S., Miller-Graziano, C. (2000). Exaggerated human monocyte IL-10 concomitant to minimal TNF-alpha induction by heat-shock protein 27 (Hsp27) suggests Hsp27 is primarily an antiinflammatory stimulus. J. Immunol 165, 39513958.
den Engelsman, J., Bennink, E. J., Doerwald, L., Onnekink, C., Wunderink, L., Andley, U. P., Kato, K., de Jong, W. W., Boelens, W. C. (2004). Mimicking phosphorylation of the small heat-shock protein alphaB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles. Eur. J. Biochem 271, 41954203.[Medline]
den Engelsman, J., Keijsers, V., de Jong, W. W., Boelens, W. C. (2003). The small heat-shock protein alpha B-crystallin promotes FBX4-dependent ubiquitination. J. Biol. Chem 278, 46994704.
Du, K., Sharma, M., Lukacs, G. L. (2005). The DeltaF508 cystic fibrosis mutation impairs domain-domain interactions and arrests post-translational folding of CFTR. Nat. Struct. Mol. Biol 12, 1725.[CrossRef][Medline]
Ehrnsperger, M., Graber, S., Gaestel, M., Buchner, J. (1997). Binding of non-native protein to Hsp25 during heat shock creates a reservoir of folding intermediates for reactivation. EMBO J 16, 221229.[CrossRef][Medline]
Ellgaard, L. and Helenius, A. (2003). Quality control in the endoplasmic reticulum. Nat. Rev. Mol. Cell Biol 4, 181191.[CrossRef][Medline]
Farinha, C. M. and Amaral, M. D. (2005). Most F508del-CFTR is targeted to degradation at an early folding checkpoint and independently of calnexin. Mol. Cell Biol 25, 52425252.
Farinha, C. M., Nogueira, P., Mendes, F., Penque, D., Amaral, M. D. (2002). The human DnaJ homologue (Hdj)-1/heat-shock protein (Hsp) 40 co-chaperone is required for the in vivo stabilization of the cystic fibrosis transmembrane conductance regulator by Hsp70. Biochem. J 366, 797806.[Medline]
Fewell, S. W., Travers, K. J., Weissman, J. S., Brodsky, J. L. (2001). The action of molecular chaperones in the early secretory pathway. Annu. Rev. Genet 35, 149191.[CrossRef][Medline]
Fu, L. and Sztul, E. (2003). Traffic-independent function of the Sar1p/COPII machinery in proteasomal sorting of the cystic fibrosis transmembrane conductance regulator. J. Cell Biol 160, 157163.
Gnann, A., Riordan, J. R., Wolf, D. H. (2004). Cystic fibrosis transmembrane conductance regulator degradation depends on the lectins Htm1p/EDEM and the Cdc48 protein complex in yeast. Mol. Biol. Cell 15, 41254135.
Haslbeck, M., Braun, N., Stromer, T., Richter, B., Model, N., Weinkauf, S., Buchner, J. (2004). Hsp42 is the general small heat shock protein in the cytosol of Saccharomyces cerevisiae. EMBO J 23, 638649.[CrossRef][Medline]
Haslbeck, M., Franzmann, T., Weinfurtner, D., Buchner, J. (2005). Some like it hot: the structure and function of small heat-shock proteins. Nat. Struct. Mol. Biol 12, 842846.[CrossRef][Medline]
Haslbeck, M., Walke, S., Stromer, T., Ehrnsperger, M., White, H. E., Chen, S., Saibil, H. R., Buchner, J. (1999). Hsp 26, a temperature-regulated chaperone. EMBO J 18, 67446751.[CrossRef][Medline]
Hill, K. and Cooper, A. A. (2000). Degradation of unassembled Vph1p reveals novel aspects of the yeast ER quality control system. EMBO J 19, 550561.[CrossRef][Medline]
Hiller, M. M., Finger, A., Schweiger, M., Wolf, D. H. (1996). ER degradation of a misfolded luminal protein by the cytosolic ubiquitin-proteasome pathway. Science 273, 17251728.
Horwitz, J. (1992). Alpha-crystallin can function as a molecular chaperone. Proc. Natl. Acad. Sci. USA 89, 1044910453.
Huyer, G., Piluek, W. F., Fansler, Z., Kreft, S. G., Hochstrasser, M., Brodsky, J. L., Michaelis, S. (2004). Distinct machinery is required in saccharomyces cerevisiae for the endoplasmic reticulum-associated degradation of a multispanning membrane protein and a soluble lumenal protein. J. Biol. Chem 297, 3836938378.
Ito, H., Kamei, K., Iwamoto, I., Inaguma, Y., Garcia-Mata, R., Sztul, E., Kato, K. (2002). Inhibition of proteasomes induces accumulation, phosphorylation, and recruitment of HSP27 and alphaB-crystallin to aggresomes. J. Biochem 131, 593603.
Jakob, U., Gaestel, M., Engel, K., Buchner, J. (1993). Small heat shock proteins are molecular chaperones. J. Biol. Chem 268, 15171520.
Johnston, J. A., Ward, C. L., Kopito, R. R. (1998). Aggresomes: a cellular response to misfolded proteins. J. Cell Biol 143, 18831898.
Kabani, M., Beckerich, J. M., Brodsky, J. L. (2002). Nucleotide exchange factor for the yeast Hsp70 molecular chaperone Ssa1p. Mol. Cell Biol 22, 46774689.
Kabani, M., Kelley, S. S., Morrow, M. W., Montgomery, D. L., Sivendran, R., Rose, M. D., Gierasch, L. M., Brodsky, J. L. (2003). Dependence of endoplasmic reticulum-associated degradation on the peptide binding domain and concentration of BiP. Mol. Biol. Cell 14, 34373448.
Kappe, G., Franck, E., Verschuure, P., Boelens, W. C., Leunissen, J. A., de Jong, W. W. (2003). The human genome encodes 10 alpha-crystallin-related small heat shock proteins: HspB110. Cell Stress Chaperones 8, 5361.[CrossRef][Medline]
Kiser, G. L., Gentzsch, M., Kloser, A. K., Balzi, E., Wolf, D. H., Goffeau, A., Riordan, J. R. (2001). Expression and degradation of the cystic fibrosis transmembrane conductance regulator in Saccharomyces cerevisiae. Arch. Biochem. Biophys 390, 195205.[CrossRef][Medline]
Kleizen, B., van Vlijmen, T., de Jonge, H. R., Braakman, I. (2005). Folding of CFTR is predominantly cotranslational. Mol. Cell 20, 277287.[CrossRef][Medline]
Kostova, Z. and Wolf, D. H. (2003). For whom the bell tolls: protein quality control of the endoplasmic reticulum and the ubiquitin-proteasome connection. EMBO J 22, 23092317.[CrossRef][Medline]
Koteiche, H. A. and McHaourab, H. S. (2003). Mechanism of chaperone function in small heat-shock proteins. Phosphorylation-induced activation of two-mode binding in alphaB-crystallin. J. Biol. Chem 278, 1036110367.
Kuchler, K., Sterne, R. E., Thorner, J. (1989). Saccharomyces cerevisiae STE6 gene product: a novel pathway for protein export in eukaryotic cells. EMBO J 8, 39733984.[Medline]
Lee, G. J., Roseman, A. M., Saibil, H. R., Vierling, E. (1997). A small heat shock protein stably binds heat-denatured model substrates and can maintain a substrate in a folding-competent state. EMBO J 16, 659671.[CrossRef][Medline]
Lewis, H. A., et al. (2004). Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator. EMBO J 23, 282293.[CrossRef][Medline]
Loayza, D., Tam, A., Schmidt, W. K., Michaelis, S. (1998). Ste6p mutants defective in exit from the endoplasmic reticulum (ER) reveal aspects of an ER quality control pathway in Saccharomyces cerevisiae. Mol. Biol. Cell 9, 27672784.
Loo, M. A., Jensen, T. J., Cui, L., Hou, Y., Chang, X. B., Riordan, J. R. (1998). Perturbation of Hsp90 interaction with nascent CFTR prevents its maturation and accelerates its degradation by the proteasome. EMBO J 17, 68796887.[CrossRef][Medline]
McCracken, A. A. and Brodsky, J. L. (2003). Evolving questions and paradigm shifts in endoplasmic-reticulum-associated degradation (ERAD). Bioessays 25, 868877.[CrossRef][Medline]
McHaourab, H. S., Dodson, E. K., Koteiche, H. A. (2002). Mechanism of chaperone function in small heat shock proteins. Two-mode binding of the excited states of T4 lysozyme mutants by alphaA-crystallin. J. Biol. Chem 277, 4055740566.
Meacham, G. C., Lu, Z., King, S., Sorscher, E., Tousson, A., Cyr, D. M. (1999). The Hdj-2/Hsc70 chaperone pair facilitates early steps in CFTR biogenesis. EMBO J 18, 14921505.[CrossRef][Medline]
Meacham, G. C., Patterson, C., Zhang, W., Younger, J. M., Cyr, D. M. (2001). The Hsc70 co-chaperone CHIP targets immature CFTR for proteasomal degradation. Nat. Cell Biol 3, 100105.[CrossRef][Medline]
Ng, D. T., Spear, E. D., Walter, P. (2000). The unfolded protein response regulates multiple aspects of secretory and membrane protein biogenesis and endoplasmic reticulum quality control. J. Cell Biol 150, 7788.
Nishikawa, S. I., Fewell, S. W., Kato, Y., Brodsky, J. L., Endo, T. (2001). Molecular chaperones in the yeast endoplasmic reticulum maintain the solubility of proteins for retrotranslocation and degradation. J. Cell Biol 153, 10611070.
Okiyoneda, T., Harada, K., Takeya, M., Yamahira, K., Wada, I., Shuto, T., Suico, M. A., Hashimoto, Y., Kai, H. (2004). Delta F508 CFTR pool in the endoplasmic reticulum is increased by calnexin overexpression. Mol. Biol. Cell 15, 563574.
Parcellier, A., Schmitt, E., Gurbuxani, S., Seigneurin-Berny, D., Pance, A., Chantome, A., Plenchette, S., Khochbin, S., Solary, E., Garrido, C. (2003). HSP27 is a ubiquitin-binding protein involved in I-kappaBalpha proteasomal degradation. Mol. Cell Biol 23, 57905802.
Parcellier, A., et al. (2006). HSP27 favors ubiquitination and proteasomal degradation of p27Kip1 and helps S-phase re-entry in stressed cells. FASEB J 20, E281E293.
Petko, L. and Lindquist, S. (1986). Hsp26 is not required for growth at high temperatures, nor for thermotolerance, spore development, or germination. Cell 45, 885894.[CrossRef][Medline]
Pilewski, J. M. and Frizzell, R. A. (1999). Role of CFTR in airway disease. Physiol. Rev 79, S215255.[Medline]
Pind, S., Riordan, J. R., Williams, D. B. (1994). Participation of the endoplasmic reticulum chaperone calnexin (p88, IP90) in the biogenesis of the cystic fibrosis transmembrane conductance regulator. J. Biol. Chem 269, 1278412788.
Plemper, R. K., Bohmler, S., Bordallo, J., Sommer, T., Wolf, D. H. (1997). Mutant analysis links the translocon and BiP to retrograde protein transport for ER degradation. Nature 388, 891895.[CrossRef][Medline]
Qu, B. H. and Thomas, P. J. (1996). Alteration of the cystic fibrosis transmembrane conductance regulator folding pathway. J. Biol. Chem 271, 72617264.
Robinson, J. S., Klionsky, D. J., Banta, L. M., Emr, S. D. (1988). Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol. Cell Biol 8, 49364948.
Roxo-Rosa, M., da Costa, G., Luider, T. M., Scholte, B. J., Coelho, A. V., Amaral, M. D., Penque, D. (2006). Proteomic analysis of nasal cells from cystic fibrosis patients and non-cystic fibrosis control individuals: search for novel biomarkers of cystic fibrosis lung disease. Proteomics 6, 23142325.[CrossRef][Medline]
Rubenstein, R. C. and Zeitlin, P. L. (2000). Sodium 4-phenylbutyrate downregulates Hsc 70, implications for intracellular trafficking of DeltaF508-CFTR. Am. J. Physiol 278, C259C267.
Sathish, H. A., Koteiche, H. A., McHaourab, H. S. (2004). Binding of destabilized betaB2-crystallin mutants to alpha-crystallin: the role of a folding intermediate. J. Biol. Chem 279, 1642516432.
Sayeed, A. and Ng, D. T. (2005). Search and destroy: ER quality control and ER-associated protein degradation. Crit. Rev. Biochem. Mol. Biol 40, 7591.[CrossRef][Medline]
Shashidharamurthy, R., Koteiche, H. A., Dong, J., McHaourab, H. S. (2005). Mechanism of chaperone function in small heat shock proteins: dissociation of the HSP27 oligomer is required for recognition and binding of destabilized T4 lysozyme. J. Biol. Chem 280, 52815289.
Stirling, C. J., Rothblatt, J., Hosobuchi, M., Deshaies, R., Schekman, R. (1992). Protein translocation mutants defective in the insertion of integral membrane proteins into the endoplasmic reticulum. Mol. Biol. Cell 3, 129142.[Abstract]
Strickland, E., Qu, B. H., Millen, L., Thomas, P. J. (1997). The molecular chaperone Hsc70 assists the in vitro folding of the N-terminal nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator. J. Biol. Chem 272, 2542125424.
Studer, S. and Narberhaus, F. (2000). Chaperone activity and homo- and hetero-oligomer formation of bacterial small heat shock proteins. J. Biol. Chem 275, 3721237218.
Sun, Y. and MacRae, T. H. (2005). The small heat shock proteins and their role in human disease. FEBS J 272, 26132627.[CrossRef][Medline]
Sun, F., Zhang, R., Gong, X., Geng, X., Drain, P. F., Frizzell, R. A. (2006). Derlin-1 promotes the efficient degradation of CFTR and CFTR folding mutants. J. Biol. Chem 281, 3685636863.
Taxis, C., Hitt, R., Park, S. H., Deak, P. M., Kostova, Z., Wolf, D. H. (2003). Use of modular substrates demonstrates mechanistic diversity and reveals differences in chaperone requirement of ERAD. J. Biol. Chem 278, 3590335913.
Thibodeau, P. H., Brautigam, C. A., Machius, M., Thomas, P. J. (2005). Side chain and backbone contributions of Phe508 to CFTR folding. Nat. Struct. Mol. Biol 12, 1016.[CrossRef][Medline]
Tsai, B., Ye, Y., Rapoport, T. A. (2002). Retro-translocation of proteins from the endoplasmic reticulum into the cytosol. Nat. Rev. Mol. Cell Biol 3, 246255.[CrossRef][Medline]
van Montfort, R., Slingsby, C., Vierling, E. (2001). Structure and function of the small heat shock protein/alpha-crystallin family of molecular chaperones. Adv. Protein Chem 59, 105156.[Medline]
Vashist, S., Kim, W., Belden, W. J., Spear, E. D., Barlowe, C., Ng, D. T. (2001). Distinct retrieval and retention mechanisms are required for the quality control of endoplasmic reticulum protein folding. J. Cell Biol 155, 355368.
Vashist, S. and Ng, D. T. (2004). Misfolded proteins are sorted by a sequential checkpoint mechanism of ER quality control. J. Cell Biol 165, 4152.
Wagner, B. J. and Margolis, J. W. (1995). Age-dependent association of isolated bovine lens multicatalytic proteinase complex (proteasome) with heat-shock protein 90, an endogenous inhibitor. Arch. Biochem. Biophys 323, 455462.[CrossRef][Medline]
Youker, R. T., Walsh, P., Beilharz, T., Lithgow, T., Brodsky, J. L. (2004). Distinct roles for the Hsp40 and Hsp90 molecular chaperones during cystic fibrosis transmembrane conductance regulator degradation in yeast. Mol. Biol. Cell 15, 47874797.
Younger, J. M., Chen, L., Ren, H. Y., Rosser, M. F., Turnbull, E. L., Fan, C. Y., Patterson, C., Cyr, D. M. (2006). Sequential quality-control checkpoints triage misfolded cystic fibrosis transmembrane conductance regulator. Cell 126, 571582.[CrossRef][Medline]
Zhang, F., Kartner, N., Lukacs, G. L. (1998). Limited proteolysis as a probe for arrested conformational maturation of delta F508 CFTR. Nat. Struct. Biol 5, 180183.[CrossRef][Medline]
Zhang, H., Peters, K. W., Sun, F., Marino, C. R., Lang, J., Burgoyne, R. D., Frizzell, R. A. (2002a). Cysteine string protein interacts with and modulates the maturation of the cystic fibrosis transmembrane conductance regulator. J. Biol. Chem 277, 2894828958.
Zhang, H., Schmidt, B. Z., Sun, F., Condliffe, S. B., Butterworth, M. B., Youker, R. T., Brodsky, J. L., Aridor, M., Frizzell, R. A. (2006). Cysteine string protein monitors late steps in CFTR biogenesis. J. Biol. Chem 281, 1131211321.
Zhang, Y., Michaelis, S., Brodsky, J. L. (2002b). CFTR expression and ER-associated degradation in yeast. Methods Mol. Med 70, 257265.[Medline]
Zhang, Y., Nijbroek, G., Sullivan, M. L., McCracken, A. A., Watkins, S. C., Michaelis, S., Brodsky, J. L. (2001). Hsp70 molecular chaperone facilitates endoplasmic reticulum-associated protein degradation of cystic fibrosis transmembrane conductance regulator in yeast. Mol. Biol. Cell 12, 13031314.
This article has been cited by other articles:
![]() |
L. R. Singh and W. D. Kruger Functional Rescue of Mutant Human Cystathionine {beta}-Synthase by Manipulation of Hsp26 and Hsp70 Levels in Saccharomyces cerevisiae J. Biol. Chem., February 13, 2009; 284(7): 4238 - 4245. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Metzger, M. J. Maurer, B. M. Dancy, and S. Michaelis Degradation of a Cytosolic Protein Requires Endoplasmic Reticulum-associated Degradation Machinery J. Biol. Chem., November 21, 2008; 283(47): 32302 - 32316. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||