![]() |
|
|
Vol. 18, Issue 3, 995-1008, March 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,




*Department of Biology and
Program in Biochemistry and Molecular Biology, Lewis and Clark College, Portland, OR 97219; and
Institute of Biological Chemistry, Washington State University, Pullman, WA 99164
Submitted August 7, 2006;
Revised December 19, 2006;
Accepted December 22, 2006
Monitoring Editor: Sandra Lemmon
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The human diseases Hermansky-Pudlak, Chediak-Higashi, and Griscelli syndromes result from dysfunctional lysosome-related organelles (Stinchcombe et al., 2004
). Hermansky- Pudlak syndrome (HPS) is associated with the abnormal biogenesis of lysosome-related organelles including melanosomes and platelet-dense granules, which is manifested in partial albinism and impaired blood clotting (Huizing et al., 2002
; Li et al., 2004
). Mutations in eight different human genes are known to cause HPS, and at least seven additional genes are associated with HPS-like phenotypes in rodents (Wei, 2006
). HPS genes encode Rab38 and subunits of the AP-3, HOPS, and BLOC-1, -2, and -3 complexes (Dell'Angelica, 2004
; Di Pietro and Dell'Angelica, 2005
). These proteins function in the sorting and transport of proteins to lysosomes and lysosome-related organelles.
The intestinal cells of the nematode Caenorhabditis elegans contain gut granules, cell typespecific compartments that have been proposed to be lysosome-related organelles (Clokey and Jacobson, 1986
; Hermann et al., 2005
). Gut granules are acidified (Clokey and Jacobson, 1986
), contain the vacuolar H+-ATPase (V-ATPase; Hermann et al., 2005
), and act as terminal endocytic compartments (Clokey and Jacobson, 1986
; Bossinger and Schierenberg, 1996
). Gut granules are distinguished from other lysosomes in C. elegans by their birefringent (Laufer et al., 1980
) and autofluorescent (Babu, 1974
) contents. The biogenesis of gut granules requires C. elegans genes encoding homologues of Rab38 and subunits of the AP-3 and HOPS complexes (Hermann et al., 2005
). Animals with mutations in these genes show a Glo (gut granule loss) phenotype characterized by loss and/or mislocalization of birefringent material into the embryonic intestinal lumen and/or the loss of adult autofluorescent gut granules.
Disrupting the function of the ABC transporter PGP-2 results in the loss of acidified compartments (Nunes et al., 2005
) and fat (Ashrafi et al., 2003
; Nunes et al., 2005
) in adult C. elegans intestinal cells. The function of pgp-2 in gut granule biogenesis and whether this might explain defects in fat storage exhibited by pgp-2() animals has not been investigated. In screens for Glo mutants we identified a gene glo-5 that we show is identical to pgp-2. Here we show that pgp-2 functions directly in gut granule biogenesis, likely in parallel to AP-3, and that gut granules are sites of fat storage in C. elegans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
glo-5 alleles were isolated following ethylmethane sulfonate or ethyl nitroso urea-mutagenesis using the method described by Hermann et al. (2005)
. Single nucleotide polymorphism mapping with CB4856 (Davis et al., 2005
) placed kx34, kx48, and kx67 on LGI between 6 and +5. kx48 and kx55 mapped to the dpy-5 unc-13 genetic interval. Standard genetic tests placed kx34, kx48, kx55, and kx67 into the glo-5 complementation group. The Glo phenotypes of all glo-5 alleles were found to be recessive and expressed zygotically. kx48 was backcrossed two to five times to N2 and kx55 was backcrossed two times to N2 before being used for phenotypic studies.
Double mutants were constructed by mating unmarked Glo mutants into dpy-5(e61) marked kx48 or kx55 mutants to generate transheterozygotes. We isolated Glo non-Dpy adult progeny from the transheterozygotes. Resulting homozygous double mutants were identified by their Dpy phenotype. In all cases at least two independently generated double mutant lines were analyzed and found to exhibit the same phenotype. The linked dpy-5(e61) mutation did not alter the Glo phenotypes.
RNA interference (RNAi) using clones from a genomic library (Kamath et al., 2003
) was carried out as described in the RNAi-sensitive rrf-3(pk1426) background (Simmer et al., 2002
).
Microscopy
A Zeiss Axioskop II plus microscope (Thornwood, NY) equipped with DIC, polarization, and fluorescence optics was used for all microscopic analysis. Images were captured with an Insight Spot QE 4.1 camera (Diagnostic Instruments, Sterling Heights, MI). Pretzel stages embryos were placed on slides with excess Escherichia coli or briefly chilled to 4°C to induce a paralyzed state before imaging. Larvae and adults were immobilized by mounting in 1x M9 containing 10 mM levamisole. Images used for phenotypic comparisons were always captured at the same exposure times, and brightness and contrast were adjusted identically. Birefringent intestinal material was visualized using polarization optics. Zeiss 9 (Ex:BP450490; EmLP515) and Zeiss 15 (Ex:BP586/12; Em:LP590) filters were used to visualize autofluorescence. A custom (Ex:BP480/20; Em:BP530/20) filter was used to analyze the colocalization of green fluorescent protein (GFP) signals and birefringent material in living embryos. Staining of adult gut granules with Lysotracker Red (Molecular Probes, Eugene, OR) and embryonic and adult gut granules with acridine orange (Sigma, St. Louis, MO) were performed as described (Hermann et al., 2005
). The staining of all lysosomal dyes was analyzed using a Zeiss 15 fluorescence filter set. Endocytosis was monitored by staining with tetramethylrhodamine B isothiocyanate (TRITC)-BSA (Sigma) using the procedure described by Hermann et al., 2005
. Fat stores were stained by growing embryo/L1 stage animals to adulthood on seeded nematode growth media (NGM) plates to which Nile Red (Molecular Probes, Eugene, OR) had been added to a final concentration of approximately 50 ng/ml (Ashrafi et al., 2003
) or BODIPY 493/503 (Molecular Probes) had been added to a final concentration of
0.5 ng/ml. Adults and their progeny stained by Nile Red or BODIPY 493/503 were removed from plates and immediately scored. Zeiss 15 and a custom (Ex:BP480/20; Em:BP530/20) filter were used to analyze the colocalization of Nile Red with autofluorescence and GLO-1::GFP. All analysis of GFP in living embryos was carried out using a custom (Ex:BP480/20; Em:BP530/20) filter. Embryos were fixed and stained with mouse 3E6 anti-GFP (Qbiogene, Carlsbad, CA) and affinity-purified rabbit anti-FUS-1 (Kontani et al., 2005
), anti-VHA-11 (Oka and Futai, 2000
), anti-VPS-27 (Roudier et al., 2005
), and anti-PGP-2 (this work) antisera as described (Leung et al., 1999
).
Lipid Analysis
Embryos were isolated from adult worms and grown at 22°C on NGM plates with an excess of food until the majority of the population reached young adulthood, indicated by the presence of 13 embryos in the uterus. Worms were washed off the plates with 1x M9 and rinsed four times with 1x M9 by letting the worms settle and discarding the supernatant. After the rinses, the worms were spun down in a microfuge tube and as much of the 1x M9 as possible was removed from the final pellet (>400 mg), which was immediately flash-frozen in liquid N2 and stored at 70°C. Total lipids were extracted from worm pellets, separated using thin-layer chromatography (TLC), and quantified using gas chromatography as described (Brock et al., 2006
).
Cloning glo-5
glo-5 mapped to the dpy-5 unc-13 interval of LGI. The Glo phenotypes of candidate genes located in this interval were assessed using existing mutants or with RNAi. pgp-2(gk114) embryos and adults exhibited a Glo phenotype. pgp-2(RNAi) in the rrf-3(pk1246) background exhibited a strong adult and a weak embryonic Glo phenotype. Three of four stable transmitting glo-5(kx48) lines injected with cosmid C34G6 at 10 ng/µl and the coinjection marker pRF4[Rol-6D] at 100 ng/µl were GLO(+). A 17.3-kb fragment extending from 7.6 kb upstream to 625 base pairs downstream of the pgp-2 coding sequence was PCR amplified using C34G6 as a template with primers P442 5'CGGATGAGAAGGGAGGGATCTTAGAAG3' and P460 5'TCGTCGATGAAAACAATGTTACCTTCG3'. All PCR reactions used in these studies utilized Phusion high fidelity DNA polymerase (New England Biolabs, Beverly, MA). The PCR product was coinjected at 10 ng/µl with pRF4[Rol-6D] at 100 ng/µl. Four of four independently derived transmitting lines were GLO(+). The sequence of mutant alleles was obtained by PCR amplifying the pgp-2 coding sequences from glo-5() mutants. Amplifications and DNA sequencing (OHSU Core Facility) were performed in duplicate. The pgp-2 cDNA was amplified from total RNA isolated using Trizol/chloroform extraction. cDNA was generated using d(T)20 and random hexamers with Superscript III (Invitrogen, Carlsbad, CA). An SL1 primer and a primer specific for the 3' end of pgp-2 were used to amplify the full-length cDNA which was sequenced and found to contain an alternative exon 1 (GenBank accession no. EF205592) when compared with the pgp-2 cDNA predicted by Genefinder (Wormbase160).
Generation of pgp-2::gfp, PGP-2::GFP, and PGP-2 ATPase Mutants
The transcriptional reporter pgp-2::gfp was constructed using PCR fusion (Hobert, 2002
). A 7.6-kb sequence 5' of the new predicted translational start of pgp-2 was amplified using P441 5'CTGTTCGCCAAGCACCCTTCTGAAAAG3' and P485 5'CAGTGAAAAGTTCTTCTCCTTTACTCATTGAAATGAAGATCTGAACAGAAAAG3'. GFP-NLS was amplified from pPD95.67 using P269 5'ATGAGTAAAGGAGAAGAACTTTTCACTG3' and P266 5'AAGGGCCCGTACGGCCGACTAGTAGG3'. These two PCR products were fused using P442 and P267 5'GGAAACAGTTATGTTTGGTATATTGGG3' as described (Hobert, 2002
). The resulting pgp-2::gfp product was coinjected at 5 ng/µl with pRF4[Rol-6D] at 100 ng/µl into wild type. kxEx74[pgp-2::gfp;Rol-6D] was used for the analysis in this article, and two other independently derived lines showed the same GFP expression pattern.
The translational reporter PGP-2::GFP was constructed by amplifying the full-length pgp-2 cDNA with P453 5'GGGGACAACTTTGTACAAGAAAGTGTATTGACTTTCGACAATCCTCTGCG3' and P482 5'GGGGACAACTTTGTACAAAAAAGTTGTGGGAAAAGACACGGAGAAAACTCC3' and Gateway (Invitrogen) cloning the resulting product using a BP reaction into pDONR221. All transformations of plasmids containing pgp-2 were carried out using CopyCutter EPI400 (Epicenter, Madison, WI) E. coli. The resulting pLKS2 plasmid was fully sequenced to ensure a lack of PCR-generated mutations. pgp-2 was Gateway cloned using an LR reaction into a VHA-6(promoter)::GFP::GTWYB(EcoRI) vector (Chen et al., 2006
). The resulting plasmid pLKS4 contains an N-terminal fusion of gfp to pgp-2 whose expression is regulated by the vha-6 promoter. The addition of 26 C-terminal amino acids derived from flanking 3' vector sequences disrupted the function of PGP-2::GFP (not shown). To generate a rescuing PGP-2::GFP construct, PCR fusion was used to introduce a stop codon and the unc-54 3' untranslated region (UTR) at the end of the pgp-2 coding sequence. vha-6(promoter)::gfp::pgp-2 was amplified from pLKS4 using P504 5'AAATGAAATAAGCTTGCATGCCTGCAG3' and P506 5'CCGGCGCTCAGTTGGAATTCTACGATTATTGACTTTCGACAATCCTCTGCG3' and the unc-54 3' UTR was amplified from pPD95.75 using P507 5'TCGTAGAATTCCAACTGAGCGCCGG3' and P266. The resulting vha-6(promoter)::gfp::pgp- 2::unc-54 3' UTR product was coinjected at 5 ng/µl with pRF4[Rol-6D] at 100 ng/µl into pgp-2(kx48) and wild type. pgp-2(kx48); kxEx93[PGP-2::GFP;Rol-6D] was used for the analysis presented in this article, and 13 other independently derived lines showed the same GFP expression pattern. Eleven of fourteen lines were GLO(+). pgp-2(kx48); kxEx93[PGP-2::GFP;Rol-6D] showed wild-type patterns of Nile Redstained fat and acridine orangestained acidified compartments and was used to determine the cellular localization of PGP-2::GFP in adults. kxEx98[PGP- 2::GFP;Rol-6D] was used to determine the cellular localization of PGP-2::GFP in embryos.
To express PGP-2::GFP under the control of unc-119 regulatory sequences (Maduro and Pilgrim, 1995
), we performed a triple PCR fusion. The vha-6(promoter)::gfp::pgp-2 sequence was amplified with P504 and P506 from pLKS4 and the unc-54 3'UTR was amplified from pPD95.75 with P507 and P266. The resulting fragments were fused using P269 and P266. gfp::pgp-2::unc-54 3'UTR was fused with the unc-119 promoter amplified from genomic DNA with P495 5'TTTTCCCTTTCCCTCTTGGGGAAAACGGG3' and P496 5'CAGTGAAAAGTTCTTCTCCTTTACTCATATATGCTGTTGTAGCTGAAAATTTTGGGG3' using P508 5'TCGAAGACAAACTTTTCAAAAAATTG3' and P267. The resulting unc-119(promoter)::gfp::pgp-2::unc-54 3' UTR product was coinjected at 5 ng/µl with pRF4[Rol-6D] at 100 ng/µl into pgp-2(kx48). unc- 119(promoter)::gfp::pgp-2::unc-54 3' UTR was expressed throughout the nervous system and did not rescue the loss of adult autofluorescence in 3/3 independently derived lines. pgp-2(kx48); kxEx100[unc-119::PGP-2::GFP;Rol-6D] was scored for rescue of adult Nile Redstained fat and acridine orangestained acidified compartments.
To alter the ATPase domains of PGP-2, site-directed mutagenesis with Quickchange II (Stratagene, La Jolla, CA) with primers P501 5'GGTCGGTTCAAGTGGTTGTGGAAGATCAACAATTG3' and P501R 5'CAATTGTTGATCTTCCACAACCACTTGAACCGACC3' were used to change Lys440 to Arg and primers P502 5'GGCACTCAGGATGTGGAAGATCTACAATTATGGG3' and P502R 5'CCCATAATTGTAGATCTTCCACATCCTGAGTGCC3' were used to change Lys1069 to Arg in plasmid pLKS4 to generate two plasmids pSK7 and pSK8, respectively. The P502 and P502R primers were used to change Lys1069 to Arg in pSK7 resulting in the double ATPase mutant (pSK9). The coding sequences of pgp-2 and gfp were fully sequenced to verify no other mutations were introduced during mutagenesis. We performed the same PCR fusion steps as used in the generation of vha-6(promoter)::gfp::pgp-2::unc-54 3' UTR to construct vha-6(promoter)::gfp::pgp-2(K440R)::unc-54 3' UTR, vha- 6(promoter)::gfp::pgp-2(K1069R)::unc-54 3' UTR, and vha-6(promoter)::gfp::pgp-2(K440R; K1069R)::unc-54 3' UTR. These were each coinjected at 15 ng/µl with pRF4 [Rol-6D] at 100 ng/µl into pgp-2(kx48) and wild type. The resulting transmitting lines with comparable levels of PGP-2::GFP expression were characterized. pgp-2(kx48); kxEx102 [PGP-2(K440R)::GFP;Rol-6D] was used for the analysis presented in this article, and 2/2 other independently derived lines showed similar partial rescue of autofluorescence. pgp-2(kx48); kxEx102 was scored for rescue of Nile Redstained fat and acridine orangestained acidified compartments and pgp-2(+); kxEx104 [PGP-2(K440R)::GFP;Rol-6D] was used to determine the cellular localization of PGP-2(K440R)::GFP in adults. pgp-2(kx48); kxEx103 [PGP-2(K1069R)::GFP;Rol-6D] was used for the analysis presented in this article, and 3/3 other independently derived lines showed similar partial rescue of autofluorescence. pgp-2(kx48); kxEx103 was scored for rescue of Nile Redstained fat and acridine orangestained acidified compartments, and pgp-2(+); kxEx105 [PGP-2(K1069R)::GFP;Rol-6D] was used to determine the cellular localization of PGP-2(K1069R)::GFP in adults. pgp-2(kx48); kxEx115 [PGP-2(K440R; K1069R)::GFP;Rol-6D] was used for the analysis presented in this article, and one other independently derived lines showed similar partial rescue of autofluorescence and Nile Red staining. pgp-2(kx48);kxEx115 was scored for rescue of Nile Redstained fat and acridine orangestained acidified compartments, and pgp-2(+); kxEx117 [PGP-2(K440R; K1069R)::GFP;Rol-6D] was used to determine the cellular localization of PGP-2(K440R; K1069R)::GFP in adults.
PGP-2 Antibodies
Affinity-purified antibodies recognizing PGP-2 were generated by Bethyl Laboratories (Montgomery, TX). Peptides corresponding to amino 1MGKDTEKTPLLLKS-cys14 and carboxy 1259cys-YQKFsETQRIVESQ1272 (C1263S) terminal PGP-2 sequences were synthesized, coupled to KLH, and used for immunization. Agarose-linked peptides were used to affinity-purify antibodies. The specificity of each antisera was confirmed using pgp-2(kx48) Arg466-stop embryos. The anti-carboxy terminal PGP-2 antisera was used in the studies presented here; however, identical results were observed using the anti-amino terminal PGP-2 antisera.
| RESULTS |
|---|
|
|
|---|
|
|
pgp-2 Functions in Gut Granule Biogenesis
Wild-type gut granules contain birefringent material from the bean (Hermann et al., 2005
) through pretzel-stages of embryogenesis (Table 1 and Figure 2B). In C. elegans, the stages of embryogenesis are named after the morphology of the embryo (Sulston et al., 1983
). Body elongation begins at the bean stage, transforming the ball of embryonic cells into a worm that appears pretzel-like in the eggshell. Between bean and pretzel, the stages of development are described by the length of the embryo relative to the length of the eggshell. Bean-to-hatching stage pgp-2() embryos contained substantially reduced numbers of birefringent granules within their intestinal cells when compared with wild type (Table 1 and Figure 2, D and F). During the late pretzel stage, pgp-2() embryos mislocalized birefringent material into the intestinal lumen (Figure 2F). This material was defecated upon hatching (data not shown).
|
|
To determine whether the formation of birefringent puncta in pgp-2() embryonic intestinal cells required the activity of genes that function in gut granule biogenesis, we generated double mutants between pgp-2 and glo-1 or glo-4. glo-4 encodes a putative guanine nucleotide exchange factor for GLO-1, and glo-4() and glo-1() embryos lack birefringent gut granules (Hermann et al., 2005
). We found that pgp-2(); glo-1() and pgp-2(); glo-4() mutants lacked embryonic birefringent granules (Table 1), indicating that glo-1 and glo-4 are necessary for the formation of birefringent organelles in pgp-2(). Together these data indicate that the birefringent material in pgp-2() embryos is contained within endolysosomal compartments, possibly aberrantly formed gut granules.
We examined whether pgp-2 was necessary for the formation of other endolysomal organelles in C. elegans embryos. In wild type, the early endosome-associated proteins RME-1::GFP (Grant et al., 2001
), RAB-5::GFP (Chen et al., 2006
), and VPS-27 (Roudier et al., 2005
) were localized to punctate structures present throughout the cytoplasm or enriched near the apical surface of embryonic intestinal cells (Figure 3, I, K, and S); identical distributions were seen in pgp-2() embryos (Figure 3, J, L, and T). In intestinal cells, LMP-1::GFP (Hermann et al., 2005
; Chen et al., 2006
) is associated with the basolateral plasma membrane and what are likely endosomal compartments localized near the apical membrane (Figure 3M). This distribution was unchanged in pgp-2(kx48) embryos; however, some of the LMP-1::GFP containing compartments near the apical surface appeared slightly enlarged (Figure 3N). A similar phenotype is seen in glo-1 (Hermann et al., 2005
) and glo-3 (Kokes and Hermann, unpublished results) mutants; however, the cellular basis of this effect is currently unknown. RME-8::GFP (Zhang et al., 2001
) and RAB-7::GFP (Chen et al., 2006
) localize to what are likely late endosomes in embryonic intestinal cells (Figure 3, K and O). The distribution of these proteins was unaltered in pgp-2(kx48) embryos (Figure 3, L and P). These results suggest that despite defects in gut granule biogenesis, many aspects of the endosomal system are properly organized in pgp-2() embryos.
We next asked whether pgp-2 was necessary for the formation of gut granules in L4 and adult stage animals. At these stages, wild-type intestinal cells contain hundreds of gut granules characterized by their autofluorescent contents, acidity, and function as terminal endocytic compartments (Clokey and Jacobson, 1986
; Figure 4, B, D, and F). pgp-2() animals contained reduced numbers of organelles with diminished levels of autofluorescent material in intestinal cells, which was only faintly visible with standard FITC fluorescence filter sets (Figure 5I) and was not visible with filter sets used to visualize rhodamine fluorescence (Figures 4H and 9B). Despite containing autofluorescent organelles, L4 and adult stage pgp-2(kx48) animals completely lacked acidified gut granules stained by Lysotracker Red (Figure 4J) or acridine orange (Figure 9D and Table 2). TRITC-bovine serum albumen (BSA; Figure 4L) and TRITC-dextran (not shown) fed to pgp-2(kx48) animals was endocytosed by intestinal cells, indicating that pgp-2 is not essential for fluid-phase endocytosis across the apical plasma membrane. However, the markers did not accumulate to the same level as in wild-type animals (Figure 4, F and L), and we therefore cannot rule out the possibility that the rate of endocytosis is reduced or the rate of endocytic recycling is increased in pgp-2(kx48) adults. The endocytosed TRITC-BSA signal did not localize to the autofluorescent organelles in pgp-2(kx48) (not shown) as they do in wild type (Clokey and Jacobson, 1986
). Together, these data suggest that the autofluorescent material in pgp-2() intestinal cells is contained within aberrantly formed gut granules. Consistent with this idea, we found that pgp-2(); glo-1() and pgp-2(); glo-4() adults lacked autofluorescent material in their intestinal cells (Table 1). We conclude that mutations in pgp-2 disrupt adult gut granule formation.
|
|
|
The Role of ABCB Transporters in Gut Granule Biogenesis
We examined whether any other transporters in the ABCB subfamily were necessary for gut granule biogenesis. The C. elegans genome encodes 24 members of the ABCB subfamily (Sheps et al., 2004
). Fifteen ABCB transporters, denoted PGP, have a domain structure similar to PGP-2 (Figure 1). The remaining nine transporters, denoted HAF, contain 48 transmembrane domains followed by a cytoplasmic ATPase domain. We analyzed mutations and/or RNAi of 23 ABCB subfamily transporters for alterations in the number, placement, or morphology of gut granules. Only one ABCB transporter, in addition to pgp-2, showed a Glo phenotype. Eighty-four percent of haf-4(gk240) embryos lacked or contained significantly reduced numbers of birefringent intestinal granules (Table 1). However, haf-4() embryos did not mislocalize birefringent material to the intestinal lumen and displayed FUS-1containing and acidified organelles similar in number and distribution to gut granules in wild type (not shown). In addition, haf-4() adult autofluorescent gut granules were acidified and were indistinguishable from wild type (not shown). These data indicate that haf-4(+) activity controls the formation of birefringent material rather than the biogenesis of acidified gut granule per se. Intriguingly, the human gene ABCB9/TAPL, which is homologous to haf-4, encodes a lysosomal transporter (Zhao et al., 2006
), suggesting the possibility that haf-4 mediates transport across the gut granule membrane to facilitate the formation of birefringent material. Together, our analyses indicate that the ABCB subfamily of transporters do not play a general role in C. elegans gut granule biogenesis and suggest that PGP-2 uniquely functions in the formation of gut granules.
pgp-2 Acts in Parallel to AP-3
The requirement of glo-1 and glo-4 in the generation of birefringent and autofluorescent material within pgp-2() intestinal cells (Table 1) strongly suggests that pathways for gut granule biogenesis are still functional in pgp-2() animals. To identify specific gut granule trafficking pathways that are acting in pgp-2() animals, we investigated the functional relationship between pgp-2 and AP-3 in the formation of the birefringent and autofluorescent material normally localized within the gut granule (Hermann et al., 2005
). The C. elegans AP-3 adaptor complex is composed of four proteins, including the
3 and µ3 subunits encoded by apt-6 and apt-7 (Boehm and Bonifacino, 2001
), respectively. The AP-3 complex mutants, like pgp-2(), contained reduced numbers of birefringent granules and autofluorescent organelles (Table 1 and Figures 2H and 5L) and lack acidified intestinal compartments (Hermann et al., 2005
). We found that pgp-2(kx48) apt-6(ok429), pgp-2(kx48); apt-7(tm920), and pgp-2(kx55); apt-7(tm920) double mutants always lacked birefringent and autofluorescent organelles (Table 1 and Figure 2J). These synthetic phenotypes indicate that AP-3 and pgp-2(+) have independent functions in the formation of birefringent and autofluorescent material and suggest that PGP-2 acts in parallel to the AP-3 adaptor complex in the formation of gut granules.
Gut Granules Are Sites of Fat Storage in C. elegans
pgp-2(+) activity has been implicated in regulating C. elegans adult fat storage. pgp-2(RNAi) (Ashrafi et al., 2003
), pgp-2(gk114) (Nunes et al., 2005
), and pgp-2(kx48) (Figure 5H) adults have greatly diminished staining by Nile Red, a fluorescent vital dye that marks fat storage compartments, which are mainly found in the intestinal cells of C. elegans (Ashrafi et al., 2003
; McKay et al., 2003
). Given the requirement of pgp-2(+) activity for both gut granule biogenesis and the formation of fat storage compartments in intestinal cells, we investigated whether gut granules are sites of fat storage. We examined L4/adult stage animals and found that Nile Red staining coincided with gut granule autofluorescence (Figure 5, B and C). Moreover, in 1.5-foldstage embryos (not shown), pretzel-stage embryos (Figure 6, AC), and newly hatched L1 stage larvae (not shown), Nile Red staining was limited to the intestine and coincided with birefringent gut granules. Identical results were seen with the neutral lipid stain BODIPY 493/503 (Gocze and Freeman, 1994
; Figures 5, DF, and 6, DF). In 1.5-foldstage embryos, Nile Redstained fat was contained within gut granules marked with GLO-1::GFP (Figure 6, PR). We conclude that fat is contained within gut granules in wild-type embryos and adults.
|
To determine whether glo mutants contain reduced levels of fat, total lipids were extracted from wild-type and mutant animals, separated by TLC, and quantified by gas chromatography. Levels of triacylglycerides, which are likely the major form of stored fat in C. elegans (Ashrafi et al., 2003
), were not obviously altered in pgp-2() and glo-1() relative to wild- type (Figure 5P). apt-7() animals displayed a slight decrease in the level of triacylglycerides; triacylglycerides as a mean percentage of total lipids were as follows: wild type 52%, pgp-2(kx48) 50%, apt-7(tm920) 45%, and glo-1(zu437) 47%. We did not detect any alterations in the levels of specific fatty acids in the glo mutants (not shown). These data indicate that the loss of Nile Red staining does not necessarily correlate with a significant decrease in the level of fat at the level of the organism.
PGP-2 Is Expressed in the Intestine and Localized to the Gut Granule Membrane
We investigated pgp-2 expression by using a gfp reporter expressed under the control of the pgp-2 promoter (pgp-2::gfp). Prior analysis has reported pgp-2::gfp expression in pharngeal and AWA neuronal cells; however, the design of pgp-2 reporter constructs used in prior studies was based on an incorrectly predicted first exon (Zhao et al., 2004
; Nunes et al., 2005
). Our cDNA analysis showed that exon 1 of pgp-2 is encoded 2.2 kb upstream of the predicted exon 1 (Wormbase WS160). We placed gfp under the control of a 7.6-kb sequence that extends from the predicted upstream gene C34G6.6 to the new predicted start codon of pgp-2. Embryonic expression of pgp-2::gfp was first seen in the daughters of the E blastomere (E2 stage), which generate the intestine (Figure 7B). Intestinal expression persisted through embryogenesis (Figure 7D) and into adulthood (Figure 7F). Rarely, weak expression of pgp-2::gfp was detected in embryonic and adult hypodermal cells (not shown). We never detected pharyngeal or AWA expression of the pgp-2::gfp reporter.
|
|
and
phosphates of ATP (Schneider and Hunke, 1998
|
| DISCUSSION |
|---|
|
|
|---|
The gut granule biogenesis pathways involving the GLO-1 Rab GTPase and the AP-3 complex appear to be active in pgp-2() animals. Late-stage pgp-2() embryos still are able to generate a limited number of birefringent compartments that are acidified (Figure 3), fat containing (Figure 6), and not marked with the gut granule protein GLO-3::GFP (data not shown). pgp-2() adults contain a limited number of organelles with weakly autofluorescent material; however, they are not acidified and do not act as terminal endocytic compartments (Figure 4). Currently, the identity of most of the compartments containing birefringent and autofluorescent material in pgp-2() is unclear. However, their formation depends upon GLO-1, GLO-4, and subunits of the AP-3 complex (Table 1), raising the possibility that they might represent aberrantly formed gut granules. Interestingly, the AP-3 complex mutants, like pgp-2() contain, reduced numbers of compartments containing birefringent material, autofluorescent material, and fat (Figures 3 and 6 and Table 1). The formation of these organelles in AP-3 complex mutants requires pgp-2(+) activity (Figure 3 and Table 1), suggesting that PGP-2 functions independently of, and possibly in parallel to, the AP-3 adaptor complex to facilitate gut granule biogenesis.
Prior studies led to the proposal that pgp-2 functions in a subset of neuronal cells to specifically control acidification of intestinal organelles and that pgp-2(+) activity is not necessary for lysosomal biogenesis (Nunes et al., 2005
). The conclusion that pgp-2 is expressed in a few chemosensory neurons and not in the intestine is based upon a reporter lacking the entire pgp-2 promoter. Our transcriptional reporter, which was designed based on experimental determination of the start of the pgp-2 coding sequence, indicates that pgp-2 is expressed in the intestine and not in chemosensory neurons (Figure 7). Furthermore, using tissue specific promoters we show that pgp-2 expression in the intestine, and not the nervous system, is sufficient for its function in gut granule biogenesis (Table 2 and Figure 9). The conclusion that PGP-2 is not required for lysosome biogenesis is based on the unaltered localization and morphology of the presumed lysosomal associated membrane protein LMP-1::GFP (Kostich et al., 2000
) in pgp-2() animals (Nunes et al., 2005
). However, current data indicate that LMP-1::GFP is not associated with embryonic or adult gut granules (Chen et al., 2006
and our unpublished observations); instead LMP-1::GFP may be present on other endosomal compartments such as conventional lysosomes that coexist with gut granules in intestinal cells. On the basis of our results we conclude that pgp-2 functions in intestinal cells to directly regulate the formation of gut granules.
ATP hydrolysis by ABC transporters fuels the transport of substrates across a membrane (Higgins, 1992
). The pgp-2(K440R), pgp-2(K1069R), and pgp-2(K440R; K1069R) mutations in the Walker A motifs of ATPase domain similarly disrupt the function of PGP-2 in gut granule formation (Figure 9 and Table 2); however, they do not alter the localization of PGP-2::GFP to gut granules (not shown). The mutations we generated in PGP-2 are equivalent to mutations in three other ABCB proteins: P-glycoprotein (Azzaria et al., 1989
), MDR3 (Urbatsch et al., 1998
), and STE-6 (Berkower and Michaelis, 1991
), that disrupt transport activity. These results strongly suggest that the role of PGP-2 in gut granule biogenesis actively involves its transporter activity.
We propose that PGP-2 regulates membrane traffic involved in gut granule biogenesis by controlling the membrane composition of the gut granule where PGP-2 is localized (Figure 8). Most eukaryotic ABC proteins act to export substrates unidirectionally across a cellular membrane (Borst and Elferink, 2002
). Presently, what PGP-2 could be transporting is a matter of speculation. However, proteins within an ABC subfamily have an evolutionarily conserved propensity to transport similar substrates (Holland et al., 2003
). A number of ABCB subfamily proteins, of which PGP-2 is a member, transport lipids and sterols from the cytosolic to the lumenal or exoplasmic leaflet of cellular membranes (Pohl et al., 2005
; van Meer et al., 2006
). PGP-2 might therefore function to control lipid or sterol-based signals that regulate membrane trafficking by promoting their removal from the cytosolic leaflet of a cellular membrane (Downes et al., 2005
; Maxfield and Tabas, 2005
). Alternatively, PGP-2 mediated movement of lipids or sterols from the cytosolic to luminal leaflet of a membrane could modify its physical properties to mechanically regulate membrane trafficking (Graham, 2004
; McMahon and Gallop, 2005
). Intriguingly, members of the Drs2 family of P-type ATPases mediate the movement of lipids from the lumenal to the cytosolic leaflet of membranes and function in vesicle transport to lysosomes in yeast (Gall et al., 2002
; Hua et al., 2002
; Wicky et al., 2004
). The identification and characterization of extragenic suppressors of pgp-2(), which could identify genes whose activity counteracts pgp-2(+), would be a first step in discerning the molecular activity of PGP-2 in organelle biogenesis.
Recently another ABC transporter has been directly implicated in endolysosomal organelle biogenesis. ABCA3 is a lamellar bodyassociated lipid transporter whose inactivation results in respiratory distress syndrome (Shulenin et al., 2004
). RNAi-mediated knockdown of ABCA3 expression results in the loss of lamellar bodyassociated proteins from cells, suggestive of a defect in the biogenesis (Cheong et al., 2006
) of this lysosome-related organelle (Weaver et al., 2002
). Two other ABC transporters are implicated in trafficking through the endolysosomal pathway: MdrA1 in Dictyostelium localizes to endolysosomal membranes and mdrA1() cells show decreased rates of endocytosis (Brazill et al., 2001
); and mutations in ABCA1 cause Tangier disease and result in increased rates of endocytosis (Zha et al., 2001
). Presently at least nine mammalian ABC transporters, ABCA1 (Neufeld et al., 2004
), ABCA2 (Zhou et al., 2001
), ABCA3 (Yamano et al., 2001
), ABCA5 (Kubo et al., 2005
), ABCB1 (Rajagopal and Simon, 2003
), ABCB9 (Zhang et al., 2000
), ABCC1 (Rajagopal and Simon, 2003
), ABCC4 (Jedlitschky et al., 2004
), and ABCG2 (Rajagopal and Simon, 2003
), are associated with late endosomes, lysosomes, or lysosome-related organelles. For most of these proteins it remains an open question whether they function in membrane trafficking and/or organelle biogenesis.
Gut Granules as Sites of Fat Storage
The studies presented here provide evidence that gut granules function as fat storage organelles in C. elegans adults and embryos. We found that two different lipid selective probes, Nile Red (Greenspan and Fowler, 1985
; Greenspan et al., 1985
) and BODIPY 493/503 (Gocze and Freeman, 1994
), stained autofluorescent gut granules of adults (Figure 5) and embryonic gut granules marked by birefringent material and GLO-1::GFP (Figure 6). Disrupting the activity of PGP-2, GLO-1, or the AP-3 adaptor complex subunit APT-7, three proteins that function in the biogenesis of acidified gut granules (this work and Hermann et al., 2005
) resulted in the loss or reduction of Nile Red staining in adult and embryonic intestinal cells and the mislocalization of Nile Redstained fat into the embryonic intestinal lumen (Figures 5 and 6). Furthermore, the genomic RNAi screen performed by Ashrafi et al. (2003)
identify four additional Glo genes, apt-6, glo-3, glo-4, and vps-16 (Hermann et al., 2005
), as having loss of Nile Redstained intestinal compartments. Notably, the vast majority of RNAi clones identified by Ashrafi et al. (2003)
that cause reduced Nile Red staining in the intestine do not cause obvious defects in the formation of autofluorescent gut granules (our unpublished observations), suggesting that gut granules do not nonspecifically accumulate the Nile Red dye. We therefore conclude that fat storage in C. elegans is a specialized function of the gut granule and think it likely that the loss of Nile Redstained fat exhibited by Glo mutants is a consequence of defects in properly forming gut granules.
Despite lacking Nile Red staining in intestinal cells, glo mutations do not or only slightly alter the overall level of fat/triacylglycerides in the animal. pgp-2(), and glo-1() contained wild-type amounts of fat, whereas apt-7() showed a slight decrease (Figure 5P). Studies to date have shown that animals with significantly decreased levels of fat are severely delayed in their development (Yang et al., 2006
). Consistent with our findings, the glo mutants we analyzed develop similarly to wild type (Hermann et al., 2005
and data not shown). The lack of a pronounced decrease in fat levels when the activity of the glo genes is disrupted would result if the amount of fat stored in gut granules was minor relative to the overall level of fat in the animal. Alternatively, the loss of gut granules might result in the redistribution of fat to other cells types. In both cases, fat outside the gut granule would not be visible by Nile Red staining, as the glo mutants do not contain obvious staining with this dye elsewhere in the animal.
Plant and animals cells store fat in lipid droplets (Murphy, 2001
), organelles that are structurally and functionally distinct from gut granules. Gut granules are lysosome-related organelles that are surrounded by a lipid bilayer (Leung et al., 1999
), act as terminal endocytic compartments (Clokey and Jacobson, 1986
), and have an acidic lumen due to the activity of the V-ATPase (Oka and Futai, 2000
). In contrast, lipid droplets do not have a vesicular structure and instead are composed of fatty acids, sterols, and embedded proteins surrounded by a phospholipid monolayer (Murphy, 2001
). PAT family proteins specifically associate with lipid droplets in mammalian and Drosophila cells and are essential regulators of lipid droplet biogenesis, homeostasis, and movement (Murphy, 2001
; Martin and Parton, 2005
; Welte et al., 2005
). Genes encoding members of the PAT family are broadly conserved, being found in Dictyostelium, Drosophila, and vertebrates; however, they appear to be lacking from the C. elegans genome (Lu et al., 2001
). This raises the possibility that lipid droplets are not generated in C. elegans, which would represent a significant mechanistic variation in fat metabolism between C. elegans and other systems.
Although lysosomes are major sites of lipid degradation in eukaryotic cells, fat is typically not found in significant quantities in lysosomes because of the rapid export of the products generated during lipid catabolism (Kolter and Sandhoff, 2005
). However, there are a few exceptional cases where lysosomes contain a greatly increased amount of fat. Human genetic diseases including Tay-Sachs and Niemann-Pick result from defective lipid degradation in/or lipid trafficking from lysosomes (Maxfield and Tabas, 2005
). Lamellar bodies are fat containing lysosome-related organelles that function in the synthesis and secretion of lung surfactant (Weaver et al., 2002
). It remains to be seen whether the pathways leading to lysosomal fat accumulation in these cases resemble the pathways by which fat accumulates in C. elegans gut granules. Further studies of gut granules formation and function should enhance our understanding of the lysosomal processes involved in regulating fat transport and metabolism.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Address correspondence to: Greg J. Hermann (hermann{at}lclark.edu)
| REFERENCES |
|---|
|
|
|---|
Azzaria, M., Schurr, E., Gros, P. (1989). Discrete mutations introduced in the predicted nucleotide-binding sites of the mdr1 gene abolish its ability to confer multidrug resistance. Mol. Cell. Biol 9, 52895297.
Babu, P. (1974). Biochemical genetics of Caenorhabditis elegans. Mol. Gen. Genet 135, 3944.[CrossRef]
Berkower, C. and Michaelis, S. (1991). Mutational analysis of the yeast a-factor transporter STE6, a member of the ATP binding cassette (ABC) protein superfamily. EMBO J 10, 37773785.[Medline]
Boehm, M. and Bonifacino, J. S. (2001). Adaptins: the final recount. Mol. Biol. Cell 12, 29072920.
Borst, P. and Elferink, R. O. (2002). Mammalian ABC transporters in health and disease. Annu. Rev. Biochem 71, 537592.[CrossRef][Medline]
Bossinger, O. and Schierenberg, E. (1996). The use of fluorescent marker dyes for studying intercellular communication in nematode embryos. Int. J. Dev. Biol 40, 431439.[Medline]
Brazill, D. T., Meyer, L. R., Hatton, R. D., Brock, D. A., Gomer, R. H. (2001). ABC transporters required for endocytosis and endosomal pH regulation in Dictyostelium. J. Cell Sci 114, 39233932.
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 7194.
Brock, T. J., Browse, J., Watts, J. L. (2006). Genetic regulation of unsaturated fatty acid composition in C. elegans. PLoS Genet 2, e108.[CrossRef][Medline]
Chen, C. C., Schweinsberg, P. J., Vashist, S., Mareiniss, D. P., Lambie, E. J., Grant, B. D. (2006). RAB-10 is required for endocytic recycling in the Caenorhabditis elegans intestine. Mol. Biol. Cell 17, 12861297.
Cheong, N., Madesh, M., Gonzales, L. W., Zhao, M., Yu, K., Ballard, P. L., Shuman, H. (2006). Functional and trafficking defects in ATP binding cassette A3 mutants associated with respiratory distress syndrome. J. Biol. Chem 281, 97919800.
Clokey, G. V. and Jacobson, L. A. (1986). The autofluorescent "lipofuscin granules" in the intestinal cells of Caenorhabditis elegans are secondary lysosomes. Mech. Ageing Dev 35, 7994.[CrossRef][Medline]
Davis, M. W., Hammarlund, M., Harrach, T., Hullett, P., Olsen, S., Jorgensen, E. M. (2005). Rapid single nucleotide polymorphism mapping in C. elegans. BMC Genomics 6, 118.[CrossRef][Medline]
Dell'Angelica, E. C. (2004). The building BLOC(k)s of lysosomes and related organelles. Curr. Opin. Cell Biol 16, 458464.[CrossRef][Medline]
Dell'Angelica, E. C., Mullins, C., Caplan, S., Bonifacino, J. S. (2000). Lysosome-related organelles. FASEB J 14, 12651278.
Di Pietro, S. M. and Dell'Angelica, E. C. (2005). The cell biology of Hermansky-Pudlak syndrome: recent advances. Traffic 6, 525533.[CrossRef][Medline]
Downes, C. P., Gray, A., Lucocq, J. M. (2005). Probing phosphoinositide functions in signaling and membrane trafficking. Trends Cell Biol 15, 259268.[CrossRef][Medline]
Gall, W. E., Geething, N. C., Hua, Z., Ingram, M. F., Liu, K., Chen, S. I., Graham, T. R. (2002). Drs2p-dependent formation of exocytic clathrin-coated vesicles in vivo. Curr. Biol 12, 16231627.[CrossRef][Medline]
Gocze, P. M. and Freeman, D. A. (1994). Factors underlying the variability of lipid droplet fluorescence in MA-10 Leydig tumor cells. Cytometry 17, 151158.[CrossRef][Medline]
Graham, T. R. (2004). Flippases and vesicle-mediated protein transport. Trends Cell Biol 14, 670677.[CrossRef][Medline]
Grant, B., Zhang, Y., Paupard, M.-C., Lin, S. X., Hall, D., Hirsh, D. (2001). Evidence that RME-1, a conserved C. elegans EH domain protein, functions in endocytic recycling. Nat. Cell Biol 3, 573579.[CrossRef][Medline]
Greenspan, P. and Fowler, S. D. (1985). Spectrofluorometric studies of the lipid probe, nile red. J. Lipid Res 26, 781789.[Abstract]
Greenspan, P., Mayer, E. P., Fowler, S. D. (1985). Nile red: a selective fluorescent stain for intracellular lipid droplets. J. Cell Biol 100, 965973.
Hermann, G. J., Schroeder, L. K., Hieb, C. A., Kershner, A. M., Rabbitts, B. M., Fonarev, P., Grant, B. D., Priess, J. R. (2005). Genetic analysis of lysosomal trafficking in Caenorhabditis elegans. Mol. Biol. Cell 16, 32733288.
Higgins, C. F. (1992). ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol 8, 67113.[CrossRef][Medline]
Hobert, O. (2002). PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. BioTechniques 32, 728730.[Medline]
In: ABC Proteins: From Bacteria to Man, ed. I. Holland, S. Cole, K. Kuchler, C. Higgins. (2003). San Diego, CA: Elsevier Science.
Hua, Z., Fatheddin, P., Graham, T. R. (2002). An essential subfamily of Drs2p-related P-type ATPases is required for protein trafficking between Golgi complex and endosomal/vacuolar system. Mol. Biol. Cell 13, 31623177.
Huizing, M., Boissy, R. E., Gahl, W. A. (2002). Hermansky-Pudlak syndrome: vesicle formation from yeast to man. Pigment Cell Res 15, 405419.[CrossRef][Medline]
Jedlitschky, G., Tirschmann, K., Lubenow, L. E., Nieuwenhuis, H. K., Akkerman, J. W., Greinacher, A., Kroemer, H. K. (2004). The nucleotide transporter MRP4 (ABCC4) is highly expressed in human platelets and present in dense granules, indicating a role in mediator storage. Blood 104, 36033610.
Jones, P. M. and George, A. M. (2004). The ABC transporter structure and mechanism: perspectives on recent research. Cell Mol. Life Sci 61, 682699.[CrossRef][Medline]
Kamath, R. S., et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231237.[CrossRef][Medline]
King, S. M. and Reed, G. L. (2002). Development of platelet secretory granules. Semin. Cell Dev. Biol 13, 293302.[CrossRef][Medline]
Kolter, T. and Sandhoff, K. (2005). Principles of lysosomal membrane digestion: stimulation of sphingolipid degradation by sphingolipid activator proteins and anionic lysosomal lipids. Annu. Rev. Cell Dev. Biol 21, 81103.[CrossRef][Medline]
Kontani, K., Moskowitz, I.P.G., Rothman, J. H. (2005). Repression of cell-cell fusion by components of the C. elegans vacuolar ATPase complex. Dev. Cell 8, 787794.[CrossRef][Medline]
Kornfeld, S. and Mellman, I. (1989). The biogenesis of lysosomes. Annu. Rev. Cell Biol 5, 483525.[CrossRef][Medline]
Kostich, M., Fire, A., Fambrough, D. M. (2000). Identification and molecular-genetic characterization of a LAMP/CD68-like protein from Caenorhabditis elegans. J. Cell Sci 113, 25952606.[Abstract]
Kubo, Y., Sekiya, S., Ohigashi, M., Takenaka, C., Tamura, K., Nada, S., Nishi, T., Yamamoto, A., Yamaguchi, A. (2005). ABCA5 resides in lysosomes, and ABCA5 knockout mice develop lysosomal disease-like symptoms. Mol. Cell. Biol 25, 41384149.
Laufer, J. S., Bazzicalupo, P., Wood, W. B. (1980). Segregation of developmental potential in early embryos of Caenorhabditis elegans. Cell 19, 569577.[CrossRef][Medline]
Leung, B., Hermann, G. J., Priess, J. R. (1999). Organogenesis of the Caenorhabditis elegans intestine. Dev. Biol 216, 114134.[CrossRef][Medline]
Li, W., Rusiniak, M. E., Chintala, S., Gautam, R., Novak, E. K., Swank, R. T. (2004). Murine Hermansky-Pudlak syndrome genes: regulators of lysosome-related organelles. BioEssays 26, 616628.[CrossRef][Medline]
Lu, X., Gruia-Gray, J., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Londos, C., Kimmel, A. R. (2001). The murine perilipin gene: the lipid droplet-associated perilipins derive from tissue-specific, mRNA splice variants and define a gene family of ancient origin. Mamm. Genome 12, 741749.[Medline]
Maduro, M. and Pilgrim, D. (1995). Identification and cloning of unc-119, a gene expressed in the Caenorhabditis elegans nervous system. Genetics 141, 977988.[Abstract]
Martin, S. and Parton, R. G. (2005). Caveolin, cholesterol, and lipid bodies. Semin. Cell Dev. Biol 16, 163174.[CrossRef][Medline]
Maxfield, F. R. and Tabas, I. (2005). Role of cholesterol and lipid organization in disease. Nature 438, 612621.[CrossRef][Medline]
McKay, R. M., McKay, J. P., Avery, L., Graff, J. M. (2003). C. elegans: a model for exploring the genetics of fat storage. Dev. Cell 4, 131142.[CrossRef][Medline]
McMahon, H. T. and Gallop, J. L. (2005). Membrane curvature and mechanisms of dynamic cell membrane remodelling. Nature 438, 590596.[CrossRef][Medline]
Mullins, C. and Bonifacino, J. S. (2001). The molecular machinery for lysosome biogenesis. BioEssays 23, 333343.[CrossRef][Medline]
Murphy, D. J. (2001). The biogenesis and function of lipid bodies in animals, plants and microorganisms. Prog. Lipid Res 40, 325438.[CrossRef][Medline]
Neufeld, E. B., et al. (2004). The ABCA1 transporter modulates late endocytic trafficking: insights from the correction of the genetic defect in Tangier disease. J. Biol. Chem 279, 1557115578.
Nunes, F., Wolf, M., Hartmann, J., Paul, R. J. (2005). The ABC transporter PGP-2 from Caenorhabditis elegans is expressed in the sensory neuron pair AWA and contributes to lysosome formation and lipid storage within the intestine. Biochem. Biophys. Res. Commun 338, 862871.[CrossRef][Medline]
Oka, T. and Futai, M. (2000). Requirement of V-ATPase for ovulation and embryogenesis in Caenorhabditis elegans. J. Biol. Chem 275, 2955629561.
Oka, T., Toyomura, T., Honjo, K., Wada, Y., Futai, M. (2001). Four subunit a isoforms of Caenorhabditis elegans vacuolar H+-ATPase. J. Biol. Chem 276, 330933085.
Pohl, A., Devaux, P. F., Herrmann, A. (2005). Function of prokaryotic and eukaryotic ABC proteins in lipid transport. Biochim. Biophys. Acta 1733, 2952.[Medline]
Pujol, N., Bonnerot, C., Ewbank, J. J., Kohara, Y., Thierry-Mieg, D. (2001). The Caenorhabditis elegans unc-32 gene encodes alternative forms of a vacuolar ATPase a subunit. J. Biol. Chem 276, 1191311921.
Rajagopal, A. and Simon, S. M. (2003). Subcellular localization and activity of multidrug resistance proteins. Mol. Biol. Cell 14, 33893399.
Raposo, G. and Marks, M. S. (2002). The dark side of lysosome-related organelles: Specialization of the endocytic pathway for melanosome biogenesis. Traffic 3, 237248.[CrossRef][Medline]
Roudier, N., Lefebvre, C., Legouis, R. (2005). CeVPS-27 is an endosomal protein required for the molting and the endocytic trafficking of the low-density lipoprotein receptor-related protein 1 in Caenorhabditis elegans. Traffic 6, 695705.[CrossRef][Medline]
Schneider, E. and Hunke, S. (1998). ATP-binding-cassette (ABC) transport systems: functional and structural aspects of the ATP-hydrolyzing subunits/domains. FEMS Microbiol. Rev 22, 120.[CrossRef][Medline]
Sheps, J. A., Ralph, S., Zhao, Z., Baillie, D. L., Ling, V. (2004). The ABC transporter gene family of Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug resistance in eukaryotes. Genome Biol 5, R15.[CrossRef][Medline]
Shulenin, S., Nogee, L. M., Annilo, T., Wert, S. E., Whitsett, J. A., Dean, M. (2004). ABCA3 gene mutations in newborns with fatal surfactant deficiency. N. Engl. J. Med 350, 12961303.
Simmer, F., Tijsterman, M., Parrish, S., Koushika, S. P., Nonet, M. L., Fire, A., Ahringer, J., Plasterk, R. H. (2002). Loss of the putative RNA-directed RNA polymerase RRF-3 makes C. elegans hypersensitive to RNAi. Curr. Biol 12, 13171319.[CrossRef][Medline]
Spritz, R. A. (1999). Multi-organellar disorders of pigmentation: intracellular traffic jams in mammals, flies and yeast. Trends Genet 15, 337340.[CrossRef][Medline]
Stinchcombe, J., Bossi, G., Griffiths, G. M. (2004). Linking albinism and immunity: the secrets of secretory lysosomes. Science 305, 5559.
Sulston, J. E., Schierenberg, E., White, J. G., Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol 100, 64119.[CrossRef][Medline]
Treusch, S., Knuth, S., Slaugenhaupt, S. A., Goldin, E., Grant, B. D., Fares, H. (2004). Caenorhabditis elegans functional orthologue of human protein h-mucolipin-1 is required for lysosome biogenesis. Proc. Natl. Acad. Sci. USA 13, 44834488.
Urbatsch, I. L., Beaudet, L., Carrier, I., Gros, P. (1998). Mutations in either nucleotide-binding site of P-glycoprotein (Mdr3) prevent vanadate trapping of nucleotide at both sites. Biochemistry 37, 45924602.[CrossRef][Medline]
van Meer, G., Halter, D., Sprong, H., Somerharju, P., Egmond, M. R. (2006). ABC lipid transporters: extruders, flippases, or flopless activators? FEBS Lett 580, 11711177.[CrossRef][Medline]
Weaver, T. E., Na, C. L., Stahlman, M. (2002). Biogenesis of lamellar bodies, lysosome-related organelles involved in storage and secretion of pulmonary surfactant. Semin. Cell Dev. Biol 13, 263270.[CrossRef][Medline]
Wei, M. L. (2006). Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function. Pigment Cell Res 19, 1942.[CrossRef][Medline]
Welte, M. A., Cermelli, S., Griner, J., Viera, A., Guo, Y., Kim, D. H., Gindhart, J. G., Gross, S. P. (2005). Regulation of lipid-droplet transport by the perilipin homolog LSD2. Curr. Biol 15, 12661275.[CrossRef][Medline]
Wicky, S., Schwarz, H., Singer-Kruger, B. (2004). Molecular interactions of yeast Neo1p, an essential member of the Drs2 family of aminophospholipid translocases, and its role in membrane trafficking within the endomembrane system. Mol. Cell. Biol 24, 74027418.
Yamano, G., Funahashi, H., Kawanami, O., Zhao, L. X., Ban, N., Uchida, Y., Morohoshi, T., Ogawa, J., Shioda, S., Inagaki, N. (2001). ABCA3 is a lamellar body membrane protein in human lung alveolar type II cells. FEBS Lett 508, 221225.[CrossRef][Medline]
Yang, F., et al. (2006). An ARC/Mediator subunit required for SREBP control of cholesterol and lipid homeostasis. Nature 442, 700704.[CrossRef][Medline]
Zha, X., Genest, J. Jr., McPherson, R. (2001). Endocytosis is enhanced in Tangier fibroblasts: possible role of ATP-binding cassette protein A1 in endosomal vesicular transport. J. Biol. Chem 276, 3947639483.
Zhang, F., Zhang, W., Liu, L., Fisher, C. L., Hui, D., Childs, S., Dorovini-Zis, K., Ling, V. (2000). Characterization of ABCB9, an ATP binding cassette protein associated with lysosomes. J. Biol. Chem 275, 2328723294.
Zhang, Y., Grant, B., Hirsh, D. (2001). RME-8, a conserved J-domain protein, is required for endocytosis in Caenorhabditis elegans. Mol. Biol. Cell 12, 20112021.
Zhao, C., Tampe, R., Abele, R. (2006). TAP and TAP-likeBrothers in arms? Naunyn Schmiedebergs Arch. Pharmacol 372, 444450.
Zhao, Z., Sheps, J. A., Ling, V., Fang, L. L., Baillie, D. L. (2004). Expression analysis of ABC transporters reveals differential functions of tandemly duplicated genes in Caenorhabditis elegans. J. Mol. Biol 344, 409417.[CrossRef][Medline]
Zhou, C., Zhao, L., Inagaki, N., Guan, J., Nakajo, S., Hirabayashi, T., Kikuyama, S., Shioda, S. (2001). Atp-binding cassette transporter ABC2/ABCA2 in the rat brain: a novel mammalian lysosome-associated membrane protein and a specific marker for oligodendrocytes but not for myelin sheaths. J. Neurosci 21, 849857.
This article has been cited by other articles:
![]() |
H. Kawai, T. Tanji, H. Shiraishi, M. Yamada, R. Iijima, T. Inoue, Y. Kezuka, K. Ohashi, Y. Yoshida, K. Tohyama, et al. Normal Formation of a Subset of Intestinal Granules in Caenorhabditis elegans Requires ATP-binding Cassette Transporters HAF-4 and HAF-9, Which Are Highly Homologous to Human Lysosomal Peptide Transporter TAP-Like Mol. Biol. Cell, June 15, 2009; 20(12): 2979 - 2990. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Jones and K. Ashrafi Caenorhabditis elegans as an emerging model for studying the basic biology of obesity Dis. Model. Mech., May 1, 2009; 2(5-6): 224 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Rabbitts, M. K. Ciotti, N. E. Miller, M. Kramer, A. L. Lawrenson, S. Levitte, S. Kremer, E. Kwan, A. M. Weis, and G. J. Hermann glo-3, a Novel Caenorhabditis elegans Gene, Is Required for Lysosome-Related Organelle Biogenesis Genetics, October 1, 2008; 180(2): 857 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sundaram, W. Han, N. Cohen, B. Echalier, J. Albin, and L. Timmons Caenorhabditis elegans ABCRNAi Transporters Interact Genetically With rde-2 and mut-7 Genetics, February 1, 2008; 178(2): 801 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Currie, B. King, A. L. Lawrenson, L. K. Schroeder, A. M. Kershner, and G. J. Hermann Role of the Caenorhabditis elegans Multidrug Resistance Gene, mrp-4, in Gut Granule Differentiation Genetics, November 1, 2007; 177(3): 1569 - 1582. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||