![]() |
|
|
Vol. 18, Issue 4, 1143-1152, April 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



*Department of Cell and Developmental Biology, Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan;
Research Information Research Division, National Institute of Informatics, Tokyo 101-8430, Japan;
Laboratory for Gene Expression Analysis, Center for Information Biology, National Institute of Genetics, Shizuoka 411-8540, Japan; and
Laboratory for Cell Adhesion and Tissue Patterning, Center for Developmental Biology, RIKEN, Kobe 650-0047, Japan
Submitted August 24, 2006;
Revised December 13, 2006;
Accepted January 8, 2007
Monitoring Editor: Marianne Bronner-Fraser
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
These signaling molecules mentioned above are repeatedly used in many aspects of embryonic morphogenesis; however, the outputs are quite different depending on when and where the signaling takes place. As the activities of these molecules must be tightly regulated, such molecules need to go through many regulatory steps to be secreted. In addition to regulation at transcriptional and translational levels, recent findings have revealed that the activities of some of these molecules are regulated at the transportation and secretion levels. For example, in Drosophila development, the activity of Spitz, one of the TGF-alpha homologues, is confined by the activity of the transporter Star and a Golgi apparatus-resident protease known as Rhomboid (Lee et al., 2001
; Urban et al., 2002
). In this present article we report another example of the regulation of a growth factor at the secretion level.
While searching for genes specifically expressed in the embryonic hindbrain/pharyngeal area, we found the CNIL gene to be transiently expressed in a restricted manner, i.e., only in r3 and r5. CNIL is one of the homologues of the Drosophila gene cornichon (cni), which is necessary for the transportation of Gurken (one of the TGF-alpha homologues) to a transitional endoplasmic reticulum (tER) site (Herpers and Rabouille, 2004
) and promotes the incorporation of Gurken into coat protein complex II (COPII) vesicles (Boekel et al., 2006
). Another important piece of information has come from the study of Erv14p, the yeast homolog of CNIL. Erv14p of budding yeast interacts with COPII components and is localized in the ER and Golgi membranes. Mutation of the COPII-binding site (carboxyl-terminus domain) of Erv14p causes the accumulation of the transmembrane protein Axl2p in the ER and thus a lack of Axl2p protein localization to the nascent bud tips or to the mother bud site (Powers and Barlowe, 2002
). Likewise, we found that when CNIL function was suppressed by introducing a plasmid designed to express the carboxyl-terminusdeleted form (
C) of CNIL, the distribution of cranial NCCs was perturbed, and resulted in a cranial nerve-misrouted phenotype quite resembling that of the ErbB4 KO mouse embryo. ErbB4 is known to bind many EGF motifcontaining molecules such as HB-EGF, betacellulin (BTC), epiregulin (EREG), and neuregulins (Nrg1, 2, 3, 4; reviewed in Olayioye et al., 2000
; Carpenter, 2003
). Because Drosophila Cornichon (Roth et al., 1995
) is known to be a transporter of Gurken (TGF-alpha homolog), in this study we searched for EGF motifcontaining protein transported by CNIL. Among known ErbB4 ligands, we found that HB-EGF bound CNIL and was efficiently secreted into the culture medium when both molecules were coexpressed in cultured cells. Because HB-EGF expression is ubiquitous in the developing hindbrain, CNIL seems to restrict HB-EGF/ErbB4 signaling to r3 and r5 by its specific expression in these rhombomeres. Because signaling transmitted by ErbB receptors is involved in many aspects of embryonic development, these findings may better explain the precise spatial and temporal pattern of ErbB receptor activation during embryonic development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
Rabbit anti-CNIL antibody was raised against a peptide (GNPARARERLKNIERIC) that is a part of chicken CNIL. For production of the rat anti-chicken HB-EGF antibody, the protein directed by the N-terminally 6xhistidine-tagged whole ORF was synthesized in Escherichia coli by using the pColdI vector (Takara, Tokyo, Japan).
Cloning of Chicken CNIL cDNA
A 186-base pair fragment of CNIL cDNA was amplified from a st-17/18 chicken embryo cDNA library by degenerate PCR using the primers recognizing sites where mouse cni and cnil amino acid sequences were conserved. The sequences of the primers were 5'-TTYGCNGCNTTYTGYTAYATG-3' and 5'-CCAYTCNGCNGCRCANARRAACAT-3'. The cDNA library was then screened with the fragment thus generated as a probe, after which 5'-RACE was performed to obtain the entire ORF.
Homology alignment was carried out with the ClustalW (European Molecular Bioinformatics Institute, http://www.ebi.ac.uk/clustalw/) computer program. The putative transmembrane regions were deduced by the use of SMART software (http://smart.embl-heidelberg.de/).
In situ Hybridization
Whole-mount in situ hybridization was performed as described earlier (Watari et al., 2001
). Digoxigenin-labeled RNA probes were used at 0.5 µg/ml for the SOX10 probe and at 0.1 µg/ml for the chicken CNIL probe (0.8-kb cDNA fragment covering nearly the entire ORF). For transcription of the chicken SOX10 antisense riboprobe, a cDNA fragment amplified by RT-PCR with the following primers was used: 5'-AATGGCACTTGCCTGAGCACCTC-3' and 5'-CTCCGTGGCTGGTACTTGTAGTC-3'.
Construction of Vectors
Expression vectors were constructed by using either a modified pCApA vector (Niwa et al., 1991
) or pcDNA3.1/Myc-His(+)A (Invitrogen, Carlsbad, CA). For some vectors, a C-terminal FLAG epitope (Hopp et al., 1988
) or enhanced green fluorescent protein (eGFP) was added as a tag. A C-terminus deletion of CNIL was introduced by PCR. ARIA (NRG1), was cloned by RT-PCR with 5'-GATATCATGTGGGCCACCTCTGAAGG-3' and 5'-GTCGACTTATACAGCAATAGGGTCTT-3' as primers, and then the HA epitope was added as described earlier (Wang et al., 2001
). The cDNA of Rat NTAK (NRG2) cDNA was kindly donated by S. Higashiyama. To make an expression vector of the secreted form of HB-EGF, sHB-EGF, we inserted a stop codon after the 152nd codon. To make sARIA-HA and sNTAK-3*FLAG, we amplified each cDNA fragment by using primer set (5'-GAATTCAATGTGGGCCACCTCTGAAGG-3'/5'-TCTAGATTAGAAGCTGGCCATTACG-TAGT-3') and (5'-GAATTCAATGCGGCAGGTTTGCTGCTC-3'/5'-CTCGAGCTTCTGGTACAGCTCCTCAG-3'), respectively. Then these fragments were subcloned into the p3XFLAG CMV13 (Sigma, St. Louis, MO). An ErbB4-eGFP expression plasmid was constructed by inserting human ErbB4 cDNA (a gift from N. E. Hynes) into pCApA vector together with an eGFP cassette for a C-terminal tag.
In Ovo Electroporation
In ovo electroporation of st-9 embryos was performed as described previously (Kubo et al., 2003
). DNA solution (pCA-CNIL or pCA-
C-CNIL: 7.5 mg/ml, pCAGAP-eGFP:1.6 mg/ml, and 0.05% W/V fast green) was injected into the lumen of the hindbrain. pCAGAP-eGFP drives the expression of eGFP (Ichii, unpublished results). The anode was placed just beside the hindbrain, and a cathode-tungsten microelectrode was inserted into the lumen of the hindbrain. Electric pulses were applied for 25 ms, three times, each at 7 V. The embryos were allowed to develop at 38.5°C up to the desired stage and processed for further experiments. For rescue experiments, pCA-sHB-EGF, p3XFLAG CMV13-sARIA-HA or p3XFLAG-CMV13-sNTAK was also added (sHB-EGF and sNTAK-3XFLAG at 8.4 mg/ml and sARIA-HA at 7.5 mg/ml).
CNIL Knockdown with Small Interfering RNA
For RNA interference (RNAi) of the CNIL gene in the chick developing hindbrain, 25 mer double-stranded RNAs (60 µM, Stealth RNAi; Invitrogen) were electroporated into the hindbrain of st-9 chick embryos. The target sequences of the small interfering RNAs (siRNAs) were as follows: CNIL 715, 5' CGCCATCCCTATGCGGCTCAATAAA 3'; CNIL 87, 5' CATCTGGCATATCATCGCTTTCGAT 3'; CNIL 236, 5' TCCATGGGCTCTTCTGTCTGATGTT 3'; HB-EGF 447, 5' CATCCTGCATATGCCAGCCAGGATA 3'; HB-EGF 461, 5' CAGCCAGGATATCATGGAGAGAGAT 3'; and HB-EGF 567, 5' TGTCCTCTCTGTGCCTTGTCATCAT 3'. The numbers indicate the start nucleotide positions in the genes (CNIL; GenBank Accession number AB232677, HB-EGF; AF131224). Medium GC-content control RNA (Invitrogen) was used for the negative control. The effectiveness of siRNAs was confirmed by transfecting HEK-293T cells with siRNA, and the protein produced by CNIL or HB-EGF expression plasmids was detected by Western blotting with anti-CNIL or anti-HB-EGF antibody. The concentration of the siRNAs was 60 µM in distilled water. The electroporation conditions were the same as for the other expression plasmid DNAs.
Whole-Mount Immunostaining of Chicken Embryos
Whole-mount immunostaining of st-19/20 embryos was performed as described previously (Davis et al., 1991
) with mAb specific for chicken neurofilaments (Hatta et al., 1987
). HRP-conjugated anti-mouse IgG (1:200; GE Healthcare, Chalfont St. Giles, United Kingdom) was used for the secondary antibody; and diaminobenzidine (1 mg/ml in PBST, Sigma), as the colorimetric substrate. Some embryos were dehydrated with methanol and cleared in benzylalcohol-benzylbenzoate (1:2).
Immunohistochemistry
St-12-13 embryos were sectioned at 20 µm and then treated with rat anti-cHB-EGF overnight at 4°C. After having been washed with PBS, the sections were treated with Alexa Fluor 488 goat anti-rat IgG (1:200; Molecular Probes, Eugene, OR) and Alexa Fluor 568 phalloidin (Molecular Probes). The samples were mounted by using FluorSave Reagent (Calbiochem, La Jolla, CA).
Cell Culture
Human embryonic kidney derived HEK-293 and HEK-293T cells were cultured in a 1:1 mixture of DMEM and Ham's F12 medium supplemented with 10% fetal bovine serum.
To establish ErbB4-eGFP stable transfectants (HEK-293::ErbB4-eGFP), we transfected HEK-293 cells with pCAErbB4-eGFP vector and pPGK-Puro by using Effectine Transfection Reagent (QIAGEN, Santa Clarita, CA) according to the manufacturer's protocol and then subsequently selected with puromycin.
Activation of ErbB4 by sHB-EGF, sARIA (sNRG1), or sNTAK (sNrg2)
HEK-293T cells were transfected with sHB-EGF, sARIA, or sNTAK expression vectors. After 24 h, the medium was changed to that without serum, and the cells were incubated for another 24 h. Each conditioned medium was centrifuged at 6000 x g relative centrifugal force to remove floating cells. HEK-293::ErbB4-eGFP cells starved overnight in medium without serum were incubated in these conditioned media for 5 min and then immediately lysed with Laemmli's sample buffer (Laemmli, 1970
).
Coimmunoprecipitation
HEK-293T cells cultured in 10-cm dishes were transfected with 2 µg plasmid DNA of each construct. After 36 h of incubation, the cells were pelleted and lysed with 0.1% Triton X-100 in TBS. FLAG or eGFP fusion proteins were immunoprecipitated with the respective anti-FLAG M2 (Sigma) or rabbit anti-GFP antibody (Molecular Probes). The immunoprecipitates were dissolved in Laemmli's sample buffer and boiled for 5 min.
Cell-Surface Biotinylation
Biotinylation of the cell surface was performed as described previously (Gechtman et al., 1999
). HEK293T cells were transfected with pcDNA3.1 cHB-EGF-eGFP and pcDNA3.1 CNIL, pcDNA3.1
C-CNIL or pcDNA3.1/Myc-His(+)A vectors at a ratio of 1:3. After 36 h, the cells were washed with ice-chilled 1 mM Ca2+, 1 mM Mg2+/HCMF (HBSS), and subsequently biotinylated by using 0.1 mg/ml EZ-Link Sulfo-NHS-Biotin (Pierce, Rockford, IL) in HBSS. The reaction was quenched by 1 mM Ca2+, 1 mM Mg2+/TBS. The biotinylation procedure was performed on ice. Cells were lysed by 0.5% Triton X-100, 0.5% NP-40/TBS. cHB-EGF-EGFP was immunoprecipitated by use of mouse anti-GFP (Roche) and protein G Sepharose (GE Healthcare). The immunoprecipitates were dissolved in Laemmli's sample buffer.
Brefeldin A Treatment
HEK-293T cells were transfected with equal amounts of pcDNA3.1cHB-EGF-eGFP and pcDNA3.1CNIL,
C-CNIL, or vector without insert. After 10 h of transfection, brefeldin A or the same volume of vehicle (ethanol) was added (20 mg/l) in order to block secretion. The cells were incubated overnight and harvested.
Concentration of sHB-EGF from Conditioned Medium
Equal amounts of pcDNA3.1cHB-EGF and pcDNA3.1CNIL,
C-CNIL, or vector without insert were used to transfect HEK-293T cells. After 24 h, the medium was changed to medium without serum, and then the cells were cultured further for 24 h. The conditioned medium was centrifuged at 16,100 rcf for 10 min to remove floating cells, and sHB-EGF was concentrated with a Microcon YM-3 (Millipore, Bedford, MA).
Western Blotting
Antibodies used for Western blotting were the following: rabbit anti-GFP (1:400; Molecular Probes), anti-FLAG M2 (1:200; Sigma), rat anti-cHB-EGF (1:200; this study), rabbit anti-actin (1:800; Sigma), anti-activated MAP kinase (1:1000; Sigma), HRP-conjugated anti-rabbit IgG (1:5000; Jackson ImmunoResearch, West Grove, PA), biotin-conjugated anti-rat IgG (1:1000; GE Healthcare), HRP-conjugated anti-mouse IgG (1:2500; GE Healthcare), HRP-conjugated avidin (1:10,000; Zymed, South San Francisco, CA), and HRP-conjugated anti-rat IgG (1:2000; Jackson ImmunoResearch). Blots were detected with ECL Plus (GE Healthcare).
| RESULTS |
|---|
|
|
|---|
C; truncated at amino acid residue No. 95 at the end of the second transmembrane domain) was constructed for perturbing the CNIL function in the present study. This truncation deletes the suspected COPII-interaction domain (corresponding to amino acid residues 97-101 of the Erv14p, underlined in Figure 1; Powers and Barlowe, 2002
|
|
C-CNIL expression plasmid and introduced it into the st-9 chick embryonic hindbrain (r3 to r5) by in ovo electroporation. Positions of the exogenous gene expression were monitored by viewing the fluorescence of eGFP (enhanced green fluorescent protein) from a coelectroporated expression vector (Figure 3E). The injection points were mainly in r3-r5. This
C-CNIL was expected to act as a dominant-negative molecule, because it lacked the putative COPII-binding domain. This strategy was adopted from a similar experiment on the yeast cnil homolog Erv14p; i.e., when amino-acid numbers 97-101 of the Erv14p were replaced with alanines, COPII-binding competence was abolished (Powers and Barlowe, 1998
C-CNIL expression plasmids were introduced at st-9, and the embryos were then examined at st-20 for cranial nerve formation. Abnormal axonal projection of the trigeminal (Vth cranial nerve) and facial (VIIth) nerves was observed after immunohistochemical staining for neurofilaments (Figure 3B). The frequency of such abnormalities observed as a consequence of the
C-CNIL action was 17/36. Less frequently (9/30), the same phenotype was observed by overexpression of the wild-type CNIL. The introduction of the control eGFP expression vector yielded the abnormal phenotype at a much lower frequency (4/33). The frequency of the above phenotype was very significantly higher when
C-CNIL was introduced into the chick embryonic hindbrain than when the control eGFP was used for the transfection (p = 0.00167; Mann-Whitney U test). The p values of wild-type CNIL versus eGFP and
C-CNIL versus wild-type were 0.0823 and 0.15708, respectively (not statistically significant). When
C-CNIL was introduced into the r3-r5 neuroepithelium, there appeared abnormal nerve connections between the Vth and VIIth ganglia (Figure 3B). The phenotype was further characterized by whole-mount in situ hybridization with the chicken SOX10 anti-sense RNA probe, which detects the migrating NCCs of the glial lineage (Kuhlbrodt et al., 1998
C-CNIL expression vectorinjected embryos, NCCs were distributed among the mesenchymal cells surrounding r3 of the neural tube, where NCCs usually do not migrate (7/20 embryos). This phenotype was less frequently seen in control GFP expression vectorinjected embryos (2/18 embryos). Thus, CNIL was shown to play an important role in establishing discrete NCC streams from the hindbrain to the periphery and proper formation of cranial nerves. However, hindbrain segmentation and rhombomere identities were not drastically altered, as judged from the morphologically distinct rhombomeric boundaries, the expression pattern of Hoxb1 in r4, and the distribution of motor neuron cell bodies (data not shown). Further detailed marker expression analyses may be necessary in a future study.
|
C-CNIL Transfection
To examine if forced activation of the ErbB4 signaling pathway could prevent the cranial nerve defects that resulted from the expression of
C-CNIL in the chicken embryonic hindbrain, we performed coelectroporation of st-9 chicken embryonic neural tubes with the
C-CNIL expression vector together with one of the expression vectors of the secreted (s) form of known ErbB4 ligands ([HB-EGF, neuregulin-1 [NRG1, ARIA in chicken], and neuregulin-2 [NRG2, NTAK in rat]). The agonistic activities of these proteins were confirmed by downstream MAPK phosphorylation in ErbB4-expressing cultured cells (Figure 4A). All the ligands showed similar agonistic activities in this experiment. Because BTC and EREG were not detected in st12-13 chicken embryos, and NRG3 and NRG4 were not detected in E9.0 mouse embryos by RT-PCR, these ligands were not used for this experiment. Embryos after electroporation were collected at st-20, and their cranial nerves were immunostained with an anti-neurofilament antibody. Representative specimens for each combination of the expression vectors are shown in Figure 4, BD. The frequency of the cranial nerve-defect phenotype was 3/21, 15/19, and 8/20 for
C-CNIL + sHB-EGF,
C-CNIL + sNRG1, and
C-CNIL + sNRG2, respectively. These frequencies were statistically compared with the frequency when only
C-CNIL was introduced (17/36, previous section) by using the Mann-Whitney U test. The results indicated that only the secreted form of HB-EGF (sHB-EGF) could prevent the cranial nerve defect caused by
C-CNIL (Figure 4B; the p value between the
C-CNIL vs.
C-CNIL + sHB-EGF was 0.00127 <0.05). The introduction of sNRG1 caused a slightly higher frequency of the defect than that of
C-CNIL (Figure 4C; p = 0.0246 < 0.05). The introduction of sNRG2 apparently did not rescue the embryos from the above phenotype (Figure 4D; p = 0.6057 > 0.05). When sHB-EGF, sNRG1 or sNRG2 alone was ectopically expressed, sHB-EGF alone did not cause any abnormality in the cranial nerve development at a statistically high frequency (4/19), but sNRG1 and sNRG2 elicited the abnormal cranial nerve phenotype (15/19 and 8/20, respectively) at frequencies comparable to those with
C-CNIL. Because sNRG1 and sNRG2 can bind and stimulate not only ErbB4 but also ErbB2/ErbB3 (required for proper NCCs migration and proliferation, Britsch et al., 1998
), overexpression of these ligands would seem to have caused the above cranial nerve phenotype. Also, the phosphorylation pattern of ErbB4 differs after stimulation by NRG1 or by NRG2 (Sweeney et al., 2000
). This difference might be one of the reasons why the cranial nerve defect-frequencies differed between sNRG1- and sNRG2-expressing embryos. Altogether, only sHB-EGF could rescue the embryos from the cranial nerve defect caused by
C-CNIL.
|
C-CNIL, the HB-EGF expression pattern in the developing hindbrain was examined by immunohistochemical staining using antiserum raised against chicken HB-EGF (Figure 5, A and B). The specificity of the antibody used was confirmed by the colocalized signals of the immunofluorescence and the green fluorescence in the cultured cells expressing HB-EGF-eGFP. In addition, cells that did not express HB-EGF-eGFP were not stained by the antiserum (data not shown). Furthermore, this antiserum stained somites in st-19 chick embryos (data not shown), confirming the similar findings in mouse embryos (Golding et al., 2004b
|
C-CNIL were included in the immunoprecipitates when HB-EGF was specifically immunoprecipitated. Interestingly,
C-CNIL precipitated with HB-EGF more efficiently than did the wild type. The reciprocal experiment showed that HB-EGF was efficiently included with the immunoprecipitated
C-CNIL (Figure 5E). These data are consistent with the observation made in budding yeast; the precipitation of Axl2 is detected only with COPII binding sitemutated Erv14p. These data together with the information about Drosophila cni and yeast homolog protein Erv14p suggest that CNIL could act as a transporter of HB-EGF in r3 and in r5.
Extracellular Secretion of HB-EGF Is Facilitated by CNIL
To analyze the influence of CNIL on the secretion of HB-EGF, we first examined whether the amount of cell-surface HB-EGF was dependent on CNIL. HEK-293T cells were transfected with HB-EGF-eGFP and CNIL expression plasmid, and then the cell-surface proteins were labeled with biotin. After immunoprecipitation with anti-GFP antibody, cell-surface HB-EGF was detected with HRP-conjugated avidin and a chemiluminescence system. As seen in Figure 6A, the total amount of HB-EGF in the whole cell lysate was reduced by coexpression of CNIL. The ratio of the amount of cell-surface HB-EGF against the total amount of HB-EGF did not differ so much among the samples with or without CNIL or
C. This reduction in HB-EGF in the lysate of CNIL-expressing cells might have been caused by promoted secretion of HB-EGF into the culture medium. Actually, this reduction was suppressed by inhibition of vesicle transport from the ER-to-Golgi apparatus by treating cells with brefeldin A (Figure 6B). We next examined whether CNIL facilitated the secretion of HB-EGF into the culture medium. HEK-293T cells were cotransfected with the HB-EGF expression plasmid and the wild-type or
C-CNIL expression plasmid. After 24 h of incubation, the secreted HB-EGF (sHB-EGF) proteins in the culture media were concentrated with a centrifugal filter device. The specimens were separated on an SDS-PAGE gel, and the HB-EGF was detected with anti-HB-EGF antibody. The results indicated that the wild-type CNIL dramatically enhanced the secretion of the sHB-EGF into the culture medium (Figure 6C). This CNIL-enhanced secretion of HB-EGF well matches the facilitation of budding yeast Axl2p packaging into COPII vesicles in the reconstituted budding reaction by the cnil homolog Erv14p (Powers and Barlowe, 2002
). Moreover, the results of the coexpression of both the wild-type CNIL and
C-CNIL along with the HB-EGF indicated that
C-CNIL acted as a dominant-negative form.
C-CNIL suppressed the reduction in HB-EGF from cell lysates caused by wild-type CNIL (Figure 6D), as well as the enhancement of HB-EGF secretion into the culture medium (Figure 6E).
|
C-CNILexpressing embryos (Figure 7, D and E). The frequencies of the above phenotype were 2/18, 9/19, and 7/20 for control siRNA-, CNIL siRNA, and HB-EGF siRNAinjected embryos, respectively. These frequencies of abnormality were comparable to that frequency for
C-CNILexpressing embryos. These results support our contention that
C-CNIL acts as a dominant-negative molecule and also suggest that CNIL is a main transporter of HB-EGF in the cells of chick embryonic hindbrain and that HB-EGF would be the main agonist of ErbB4.
|
| DISCUSSION |
|---|
|
|
|---|
|
C-CNILcaused cranial nerve defect seems to have arisen due to faulty HB-EGF secretion. We also showed that CNIL promoted the secretion of HB-EGF from cultured cells into the culture medium. Because the amount of cell-surface HB-EGF was rather reduced in wild-type CNIL-expressing cells, shedding of HB-EGF may also be promoted by CNIL in the cultured cells, although such a function has not been reported to be operative in other organisms. Because the rhombencephalic expression of the proteases involved in HB-EGF shedding was not investigated, whether promoted shedding of HB-EGF, as seen in the cultured cells, also takes place in the chick hindbrain is not known. Anyway, we suspect that CNIL promotes the secretion of HB-EGF in r3 and r5 and that only these rhombomeres receive the HB-EGF stimulus to initiate the repulsion by the mesenchyme. The expression level of HB-EGF in the hindbrain is low, and so far, we have not confirmed any reduction in the HB-EGF secretion in vivo after introduction of
C-CNIL. However, our knockdown experiment using siRNA has clearly shown that CNIL and HB-EGF have important roles in cranial nerve development.
In the developing vertebrate hindbrain, so far NRG1 has been the only suspected ligand of ErbB4, but our present finding indicates that HB-EGF is another ligand for Erb4 in this area. Knockout mice of nrg1 also showed cranial nerve defects, but the phenotype is different from that of ErbB4 KO mice and that of
C-CNILexpressing chick embryos. The proximal ganglia of cranial nerves appeared to be missing in nrg1 KO mouse embryos, and NCC generation or survival seemed to be dependent on NRG1 protein (Meyer and Birchmeier, 1995
). In the mouse hindbrain, the protein encoded by cnil, which is expressed in r3 and r5, does not seem to carry Nrg1, because nrg1 is strongly expressed in r2, 4, and 6, as reported previously (Dixon and Lumsden, 1999
). Also, we could not detect any physical interaction between CNIL and NRG1 in coexpressing cells (data not shown). The expression patterns of ErbB4 and NRG1 in the developing hindbrain slightly differ between the chick and mouse. As mentioned above, strong expression domains of ErbB4 and Nrg1 do not overlap in the mouse hindbrain. In the chick hindbrain, the expression domains of ErbB4 and NRG1 partially overlap at the region between the basal plate and the alar plate in r3 of the st-12-13 embryos (Dixon and Lumsden, 1999
). At this moment we do not know how this difference between mouse and chicken affects the selection of the NCC migration path.
As was shown in Figure 2, E and 2F, CNIL was expressed in migrating NCCs emigrating from r5. ErbB4 expression in these cells was not observed in the chick hindbrain (Dixon and Lumsden, 1999
). At this moment we do not know what ligand-receptor system is supported by CNIL in these cells. Gene expression analysis of these CNIL-positive NCCs and forced expression of
C-CNIL in r5-r6 may reveal CNIL function in r5-derived NCCs in the future.
We did not examine presently whether mouse HB-EGF has an expression pattern similar to that of the chicken in the developing hindbrain. Our present study suggests that the secreted form of HB-EGF has an important role in the selection of NCC migration path in the chick hindbrain. There was not much difference in the amount of cell-surface HB-EGF between the in the wild-type CNIL- and
C-CNILexpressing cells. Membrane-bound HB-EGF is known to transmit juxtacrine signals to neighboring cells (Iwamoto and Mekada, 2000
). Because HB-EGF KO mice (Iwamoto et al., 2003
) and mice in which the HB-EGF locus was replaced with an uncleavable form (HBuc) or a transmembrane domain-truncated form (HB
; Yamazaki et al., 2003
) have already been generated, examination of the cranial nerve phenotypes of their embryonic hindbrain is anticipated. Such studies should clarify which form of the HB-EGF acts dominantly for the barrier function against NCC migration in mice.
As far as we have checked, we have found no hindbrain segmentation defects or identity alteration of r4; however, there remains a possibility that more detailed analysis using proper markers may reveal some defects in the
C-CNILexpressing neural tube.
There are many mouse gene mutants that show cranial nerve defects, including COUP-TF1 (Qiu et al., 1997
), Hoxa3 (Manley and Capecchi, 1997
; Watari et al., 2001
), ErbB2 (Lee et al., 1995
), ErbB3 (Erickson et al., 1997
), ErbB4 (Gassman et al., 1995
), nrg1 (Meyer and Birchmeier, 1995
), Semaphorin III/D (SemaIII, collapsin-1; Taniguchi et al., 1997
), Neuropillin-1 (Kitsukawa et al., 1997
), and the Hes1 and Hes5 double mutant (Hatakeyama et al., 2006
). Among these, ErbB2, ErbB3, nrg1 mutants have cranial ganglia of reduced size, suggesting that their products are necessary for the survival of the NCC precursors. But ErbB4, SemaIII, and Nrp1 mutants have ganglia of normal size. Recently, the Semaphorin/Neuropilin signaling system in the chick hindbrain was also shown to be necessary for the proper stream-like migration of neural crest cells (Osborne et al., 2005
). Signals necessary for the survival or the migration path selection of the NCCs would seem to intermingle with each other. More information is still needed to unravel the complex interactions among different tissues, e.g., hindbrain neural tube, NCCs, ectoderm, and surrounding mesenchyme. Also, the downstream targets of transcription factors whose mutants exhibit cranial nerve defects should be investigated. Studies on the downstream signaling of ErbB4, activated by HB-EGF, would help to identify the molecules responsible for repulsive property of mesenchymal cells adjoining r3.
CNIL is expressed in many tissues, including cancer cells (our unpublished results). Further studies on the CNIL protein should reveal the relationship between cellular behavior and ErbB4 activity in other tissues, which relationship cannot be clarified by just analyzing the expression patterns of ErbB4 and its ligands.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Osamu Chisaka (chisaka{at}lif.kyoto-u.ac.jp)
| REFERENCES |
|---|
|
|
|---|
Britsch, S., Li, L., Kirchhoff, S., Theuring, F., Brinkmann, V., Birchmeier, C., Riethmacher, D. (1998). The ErbB2 and ErbB3 receptors and their ligand, neuregulin-1, are essential for development of the sympathetic nervous system. Genes Dev 12, 18251836.
Carpenter, G. (2003). ErbB-4: mechanism of action and biology. Exp. Cell Res 284, 6677.[CrossRef][Medline]
Davis, C. A., Holmyard, D. P., Millen, K. J., Joyner, A. L. (1991). Examining pattern formation in mouse, chicken and frog embryos with an En-specific antiserum. Development 111, 287298.[Abstract]
Dixon, M. and Lumsden, A. (1999). Distribution of neuregulin-1 (nrg1) and erbB4 transcripts in embryonic chick hindbrain. Mol. Cell. Neurosci 13, 237258.[CrossRef][Medline]
Eickholt, B. J., Mackenzie, S. L., Graham, A., Walsh, F. S., Doherty, P. (1999). Evidence for collapsin-1 functioning in the control of neural crest migration in both trunk and hindbrain regions. Development 126, 21812189.[Abstract]
Erickson, S. L., O'Shea, K. S., Ghaboosi, N., Loverro, L., Frantz, G., Bauer, M., Lu, L. H., Moore, M. W. (1997). ErbB3 is required for normal cerebellar and cardiac development: a comparison with ErbB2-and heregulin-deficient mice. Development 124, 49995011.[Abstract]
Fraser, S., Keynes, R., Lumsden, A. (1990). Segmentation in the chick embryo hindbrain is defined by cell lineage restrictions. Nature 344, 431435.[CrossRef][Medline]
Gassmann, M., Casagranda, F., Oriori, D., Simon, H., Lai, C., Klein, R., Lemke, G. (1995). Aberrant neural and cardiac development in mice lacking the ErbB4 neuregulin receptor. Nature 378, 390394.[CrossRef][Medline]
Gechtman, Z., Alonso, J. L., Raab, G., Ingber, D. E., Klagsbrun, M. (1999). The shedding of membrane-anchored heparin-binding epidermal-like growth factor is regulated by the Raf/mitogen-activated protein kinase cascade and by cell adhesion and spreading. J. Biol. Chem 274, 2882828835.
Golding, J. P., Trainor, P., Krumlauf, R., Gassmann, M. (2000). Defects in pathfinding by cranial neural crest cells in mice lacking the neuregulin receptor ErbB4. Nat. Cell Biol 2, 103109.[CrossRef][Medline]
Golding, J. P., Sobieszczuk, D., Dixon, M., Coles, E., Christiansen, J., Wilkinson, D., Gassmann, M. (2004a). Roles of erbB4, rhombomere-specific, and rhomobomere-independent cues in maintaining neural crest-free zones in the embryonic head. Dev. Biol 266, 361372.[CrossRef][Medline]
Golding, J. P., Tsoni, S., Dixon, M., Yee, K. T., Partridge, T. A., Beauchamp, J. R., Gassmann, M., Zammit, P. S. (2004b). Heparin-binding EGF-like growth factor shows transient left-right asymmetrical expression in mouse myotome pairs. Gene Expr. Pat 5, 39.[CrossRef]
Graham, A., Heyman, I., Lumsden, A. (1993). Even-numbered rhombomeres control the apoptotic elimination of neural crest cells from odd-numbered rhombomeres in chick hindbrain. Development 119, 233245.[Abstract]
Graham, A., Francis-West, P., Brickell, P., Lumsden, A. (1994). The signaling molecule BMP-4 mediates apoptosis in the rhombencephalic neural crest. Nature 372, 684686.[CrossRef][Medline]
Hamburger, V. G. and Hamilton, H. L. (1951). A series of normal stages in the development of the chick embryo. J. Morphol 88, 4992.[CrossRef]
Hatakeyama, J., Sakamoto, S., Kageyama, Y. (2006). Hes1 and Hes5 regulate the development of the cranial and spinal nerve systems. Dev. Neurosci 28, 92101.[CrossRef][Medline]
Hatta, K., Takagi, S., Fujisawa, H., Takeichi, M. (1987). Spatial and temporal expression pattern of N-cadherin cell adhesion molecules correlated with morphogenetic processes of chicken embryos. Dev. Biol 120, 215227.[CrossRef][Medline]
Herpers, B. and Rabouille, C. (2004). mRNA localization and ER-based protein sorting mechanisms dictate the use of transitional endoplasmic reticulum-Golgi units involved in Gurken transport in Drosophila oocytes. Mol. Biol. Cell 15, 53065317.
Hopp, T. P., Prickett, K. S., Price, V. L., Libby, R. T., March, C. J., Cerretti, D. P., Urdal, D. L., Conlon, P. J. (1988). A short polypeptide marker sequence useful for recombinant protein identification and purification. Biotechnology 6, 12041210.[CrossRef]
Iwamoto, R. and Mekada, E. (2000). Heparin-binding EGF-like growth factor: a juxtacrine growth factor. Cytokine Growth Factor Rev 11, 335344.[CrossRef][Medline]
Iwamoto, R., et al. (2003). Heparin-binding EGF-like growth factor and ErbB signaling is essential for heart function. Proc. Natl. Acad. Sci. USA 100, 32213226.
Kitsukawa, T., Shimizu, M., Sanbo, M., Hirata, T., Taniguchi, M., Bekku, Y., Yagi, T., Fujisawa, H. (1997). Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice. Neuron 19, 9951005.[CrossRef][Medline]
Kubo, F., Takeichi, M., Nakagawa, S. (2003). Wnt2b controls retinal cell differentiation at the ciliary marginal zone. Development 130, 587598.
Kuhlbrodt, K., Herbarth, B., Sock, E., Hermans-Borgmeyer, I., Wegner, M. (1998). Sox10, a novel transcriptional modulator in glial cells. J. Neurosci 18, 237250.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680685.[CrossRef][Medline]
Le Douarin, N. M. and Kalcheim, C. (1999). The Neural Crest. 2nd ed Cambridge University Press.
Lee, K.-F., Simon, H., Chen, H., Bates, B., Hung, M.-C., Hauser, C. (1995). Requirement for neuregulin receptor erbB2 in neural and cardiac development. Nature 378, 394398.[CrossRef][Medline]
Lee, S., Urban, J. R., Freeman, M. (2001). Drosophila rhomboid-1 defines a family of putative intramembrane serine proteases. Cell 107, 173182.[CrossRef][Medline]
Lumsden, A. and Krumlauf, R. (1996). Patterning of the vertebrate neuraxis. Science 274, 11091115.
Manley, N. R. and Capecchi, M. R. (1997). Hox group 3 paralogous genes act synergistically in the formation of somitic and neural crest-derived structures. Dev. Biol 192, 274288.[CrossRef][Medline]
Meyer, D. and Birchmeier, C. (1995). Multiple essential functions of neuregulin in development. Nature 378, 386390.[CrossRef][Medline]
Niwa, H., Yamamura, K., Miyazaki, J. (1991). Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193199.[CrossRef][Medline]
Olayioye, M. A., Neve, R. M., Lane, H. A., Hynes, N. (2000). The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J 19, 31593167.[CrossRef][Medline]
Osborne, N. J., Begbie, J., Chilton, J. K., Schmidt, H., Erickholt, B. J. (2005). Semaphorin/Neuropilin signaling influences the positioning of migratory neural crest cells within the hindbrain of the chick. Dev. Dyn 232, 939949.[CrossRef][Medline]
Powers, J. and Barlowe, C. (1998). Transport of Axl2p depends on Erv14p, an ER-vesicle protein related to the Drosophila cornichon gene product. J. Cell Biol 142, 12091222.
Powers, J. and Barlowe, C. (2002). Erv14p directs a transmembrane secretory protein into COPII-coated transport vesicles. Mol. Biol. Cell 13, 880891.
Qiu, Y., Pereira, F. A., DeMayo, F. J., Lydon, J. P., Tsai, S. Y., Tsai, M. J. (1997). Null mutation of mCOUP-TFI results in defects in morphogenesis of the glossopharyngeal ganglion, axonal projection, and arborization. Genes Dev 11, 19251937.
Roth, S., Neuman-Silberberg, F. S., Barcelo, G., Schüpbach, T. (1995). Cornichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila. Cell 81, 967978.[CrossRef][Medline]
Sweeney, C., Lai, C., Riese, D. J. II, Diamonti, A. J., Cantley, L. C., Caraway, K. L. III. (2000). Ligand discrimination in signaling through an ErbB4 receptor homodimer. J. Biol. Chem 275, 1980319807.
Taniguchi, M., Yuasa, S., Fujisawa, H., Saga, S., Mishina, M., Yagi, T. (1997). Disruption of semaphorinIII/D gene causes severe abnormality in peripheral nerve projection. Neuron 19, 519530.[CrossRef][Medline]
Trainor, P., Sobieszczuk, D., Wilkinson, D., Krumlauf, R. (2002). Signalling between the hindbrain and paraxial tissues dictates neural crest migration pathways. Development 129, 433442.[Medline]
Urban, S., Lee, J. R., Freeman, M. (2002). A family of Rhomboid intramembrane proteases activates all Drosophila membrane-tethered EGF ligands. EMBO J 21, 42774286.[CrossRef][Medline]
Voiculescu, O., Charnay, P., Schneider-Maunoury, S. (2000). Expression pattern of a Krox-20/Cre knock-in allele in the developing hindbrain, bones, and peripheral nervous system. Genesis 26, 123126.[CrossRef][Medline]
Wang, J. Y., Miller, S. J., Falls, D. L. (2001). The N-terminal region of neuregulin isoforms determines the accumulation of cell surface and released neuregulin ectodomain. J. Biol. Chem 276, 28412851.
Watari, N., Kameda, Y., Takeichi, M., Chisaka, O. (2001). Hoxa3 regulates integration of glossopharyngeal nerve precursor cells. Dev. Biol 240, 1531.[CrossRef][Medline]
Yamazaki, S., et al. (2003). Mice with defects in HB-EGF ectodomain shedding show severe developmental abnormalities. J. Cell Biol 163, 469475.
This article has been cited by other articles:
![]() |
J. Schwenk, N. Harmel, G. Zolles, W. Bildl, A. Kulik, B. Heimrich, O. Chisaka, P. Jonas, U. Schulte, B. Fakler, et al. Functional Proteomics Identify Cornichon Proteins as Auxiliary Subunits of AMPA Receptors Science, March 6, 2009; 323(5919): 1313 - 1319. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||