![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 18, Issue 4, 1302-1311, April 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
,,,,
*Apoptosis Research Centre, Children's Hospital of Eastern Ontario Research Institute, University of Ottawa, Ottawa, Ontario, K1H 8L1, Canada; INSERM U563, Toulouse, F-31000, France; Institut Claudius Régaud, Toulouse, F-31052, France; and Université Toulouse III Paul Sabatier, Toulouse, F-31000, France
Submitted June 12, 2006;
Revised January 19, 2007;
Accepted January 31, 2007
Monitoring Editor: Marvin P. Wickens
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). However, under conditions of cellular stress, cap-dependent translation is compromised due to the modification or proteolytic degradation of several proteins that are required for translation initiation. For example, endoplasmic reticulum stress causes phosphorylation of eIF2-
, which decreases the rate of cap-dependent translation initiation (Harding et al., 1999). Caspase-mediated cleavage of eIF4G family members, which form a scaffold on which the translation initiation complex assembles, reduces cap-dependent translation during apoptosis (Marissen and Lloyd, 1998). Thus, for translation of many mRNA transcripts to continue under such conditions these messages rely on an alternative initiation mechanism.
Internal ribosome entry sites (IRESs) are believed to permit translation initiation by directly recruiting the ribosome to the vicinity of the start codon, thereby bypassing the need for cap-binding and ribosome scanning (Hellen and Sarnow, 2001). Moreover, IRES elements allow translation of a subset of proteins to persist under conditions of reduced cap-dependent translation, such as apoptosis (Holcik et al., 2000; Hellen and Sarnow, 2001). Translation of the X-linked inhibitor of apoptosis (XIAP), an antiapoptotic protein that binds to caspases-3, -7, and -9 to inhibit their activity (reviewed in Liston et al., 2003), is mediated by a 162 nucleotide IRES element located within its 1.7 kb-long 5' untranslated region, thereby allowing de novo XIAP synthesis during cellular stress and apoptosis (Holcik et al., 1999). Thus, by exploiting an IRES-dependent translation mechanism, a new XIAP protein can be produced when it is required to block or delay the progression of apoptosis (Holcik and Sonenberg, 2005; Lewis and Holcik, 2005).
Several proteins that modulate IRES function, known as IRES trans-acting factors (ITAFs), have recently been identified (reviewed in Spriggs et al., 2005). These ITAFs interact with various IRES elements to regulate their activity by affecting ribosome recruitment or modifying the structure of the IRES RNA itself. For example, the La autoantigen, PTB, unr, and hnRNP C1/C2 stimulate the activity of several IRES elements (Holcik and Korneluk, 2000; Kim et al., 2001; Mitchell et al., 2001; Holcik et al., 2003), whereas HuR inhibits p27 IRES activity (Kullmann et al., 2002). The XIAP ITAFs identified thus far are the La autoantigen and hnRNP C1/C2 (Holcik and Korneluk, 2000; Holcik et al., 2003); however, the identities of additional protein factors that modulate XIAP IRES function remain unknown.
We have used an RNA-affinity chromatography approach to isolate and identify novel XIAP IRES-binding proteins. We find that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) interacts with XIAP IRES RNA both in vitro and in vivo and that hnRNP A1 negatively regulates XIAP IRES activity. Significantly, hnRNP A1–mediated negative regulation of XIAP IRES activity is controlled by the subcellular localization of hnRNP A1, as XIAP IRES-dependent translation is significantly reduced when hnRNP A1 accumulates in the cytoplasm. On the basis of our findings, we conclude that hnRNP A1 is a novel negative regulator of IRES-mediated XIAP translation, whose activity is regulated by subcellular distribution of the protein.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The bicistronic reporter plasmid p
gal/5'(–162)/CAT containing the minimal functional region of the human XIAP IRES was previously described (Holcik et al., 1999). The hnRNP A1 coding sequence was PCR amplified from cDNA generated by reverse transcription of total RNA from 293T cells using oligo dT18 primer and the Bulk 1st-Strand Synthesis kit (Amersham Biosciences, Piscataway. NJ). The FLAG epitope was incorporated into the N-terminus of hnRNP A1 using the following primers: 5'-ccggaattcatggattacaaggacgacgacgataagtctaagtcagagtctcctaaagag (EcoRI recognition site is underlined; FLAG coding sequence is italicized) and 5'-tgctctagattaaaatcttctgccactgcc (XbaI recognition site is underlined). The resulting PCR product was cloned into the pCI vector (Invitrogen) using EcoRI and XbaI to generate the FLAG-hnRNP A1 plasmid. A plasmid for expressing recombinant glutathione S-transferase (GST)-hnRNP A1 was generated by PCR amplification of the hnRNP A1 coding sequence (without the AUG start codon) using the primers 5'-ccggaattctatctaagtcagagtctcctaaagag (EcoRI recognition site is underlined) and 5'-ccgctcgagttaaaatcttctgccactgcc (XhoI recognition site is underlined). The resulting PCR product was digested with EcoRI and XhoI and cloned into the pGEX-KG vector. A plasmid expressing FLAG-tagged hnRNP A1 F1 mutant was generated by mutation of the F-peptide within hnRNP A1 as previously described (Allemand et al., 2005). Briefly, hnRNP A1 F1 mutant sequence was amplified with the primers: 5'-ccggaattcatggattacaaggacgacgacgataagtctaagtcagagtctcctaaagag (EcoRI recognition site is underlined; FLAG coding sequence is italicized) and 5'-tgctctagattaaaatcttctgccgtcgccataatcgtcatcgtcatcgtcaccgccatagccaccttggtttcgtgg (XbaI recognition site is underlined; base pair changes to generate the F1 mutant are italicized). The resulting PCR product was cloned into the pCI vector (Invitrogen) using EcoRI and XbaI. All plasmid constructs were confirmed by nucleotide sequencing.
RNA-Affinity Chromatography
Isolation of XIAP IRES-binding proteins was performed using a modified RNA-affinity chromatography protocol (Kim et al., 2004). Briefly, XIAP IRES RNA and HIAP2 IRES RNA were transcribed in vitro with the MEGAShortscript transcription kit according to the manufacturer's protocol (Ambion, Austin, TX) and were biotinylated at the 5' end with the 5' EndTag Nucleic Acid Labeling System according to the manufacturer's instructions (Vector Laboratories, Burlingame, CA). The biotinylated RNAs (60 µg) were conjugated to Avidin-agarose beads (Sigma, St. Louis, MO) in the presence of incubation buffer (10 mM Tris-Cl, pH 7.4, 150 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride, 0.05% [vol/vol] Nonidet P-40) at 4°C for 2 h with continuous rotation. Unbound RNAs were removed by washing beads twice with incubation buffer. 293T protein extract (2 mg in incubation buffer) was added to the coated beads, along with 120 µg yeast tRNA (Sigma) and 800 U of Prime RNase inhibitor (Eppendorf, Fremont, CA). Reactions were incubated at room temperature with continuous rotation for 30 min, followed by incubation at 4°C with continuous rotation for 2 h. Beads were washed five times with incubation buffer, resuspended in 50 µl of 1x SDS-PAGE loading dye, and boiled for 5 min to elute bound proteins. Proteins were separated by 10% SDS-PAGE and visualized using Sypro Ruby stain (Genomic Solutions, Ann Arbor, MI). Protein bands were excised and identified by in-gel trypsin digestion and mass peptide fingerprinting at the Protein Function Discovery Centre (Queen's University, Kingston, ON, Canada).
RNA–Protein Complex Immunoprecipitation
In vivo cross-linking and coprecipitation of RNA–protein complexes was performed as described previously (Niranjanakumari et al., 2002). Cross-linked RNA–protein complexes were immunoprecipitated using anti-hnRNP A1 (Santa Cruz Biotechnology), anti-La (Chan and Tan, 1987), or anti-GAPDH (Advanced ImmunoChemical, Long Beach, CA) antibodies at 1:50 dilution. After immunoprecipitation and cross-link reversal, RNA was isolated using Trizol reagent following the manufacturer's protocol (Invitrogen). cDNA was generated from the isolated RNA using an oligo dT18 primer and Superscript II (Invitrogen). The partial coding sequences of XIAP and actin were PCR amplified from the resulting cDNA using the primers 5'-gcggtgctttagttgtcat (XIAP forward), 5'-tcgggtatatggtgtctgata (XIAP reverse), 5'-ctggaacggtgaaggtgaca (actin forward), and 5'-aagggacttcctgtaacaatgca (actin reverse). PCR products were visualized on a 1.5% agarose gel by ethidium bromide staining.
UV Cross-Linking of RNA–Protein Complexes
RNA–protein UV cross-linking experiments and oligonucleotide competition experiments were performed as previously described (Holcik et al., 2003). For competition experiments, unlabeled XIAP IRES RNA, unlabeled HIAP2 IRES RNA, or unlabeled RNA oligonucleotides were incubated with GST-hnRNP A1 for 15 min before the addition of 32P-labeled XIAP IRES RNA. Sequences of RNA oligonucleotides used for competition experiments are as follows: –25 (5'-ggacaaguccuauuuucaagagaag), –50 (5'-auaauguucucuuuuuagaaaaggu), –75 (5'-uguuucacauuuuggauuuccuaau), and –100 (5'-uccuauaacaaaagucuguugcuug).
Nitrocellulose Filter Bindings Assays
The filter binding assays were performed essentially as described (Bonnal et al., 2005). Briefly, increasing amounts of a purified GST-hnRNP A1 were added to an in vitro transcribed 32P-labeled RNA corresponding to the XIAP IRES or HIAP2 IRES in a total volume of 10 µl GS binding buffer (5 mM HEPES-KOH, pH 7.6, 30 mM KCl, 2 mM MgCl2, 0.2 mM DTT, and 4% glycerol) containing 400 ng of yeast tRNA. The mixture was allowed to incubate 10 min at room temperature. Eight microliters of each binding reaction was applied to a presoaked nitrocellulose membrane on a slot dot apparatus (Hybrislot manifold, Bethesda Research Laboratories, Bethesda, MD) under moderate suction. Each slot dot was washed with 300 µl of cold GS buffer and the membranes were dried for 1 h at room temperature. The filters were exposed in a phosphoimager cassette (Molecular Dynamics, Sunnyvale, CA) overnight and revealed. The quantifications were performed with the Image Quant v1.1 software (Molecular Dynamics), and the data were corrected for the background (RNA retention without any added protein), which was <2%. The fraction of RNA bound was plotted against the protein concentration.
-Galactosidase and CAT Analysis
Transiently transfected cells were washed in 1 ml phosphate-buffered saline (PBS) and harvested in 300 µl CAT ELISA kit lysis buffer according to the protocol provided by the manufacturer (Roche Molecular Biochemicals, Indianapolis, IN). -Galactosidase (gal) enzymatic activity was determined by spectrophotometric assay using o-nitrophenyl--D-galactopyranoside as previously described (MacGregor et al., 1991). CAT levels were determined using the CAT ELISA kit according to the protocol provided by the manufacturer (Roche Molecular Biochemicals). Relative IRES activity was calculated as the ratio of CAT/gal.
Western Blot Analysis
Cells were washed in 1 ml PBS and lysed in 100 µl RIPA buffer for 30 min at 4°C, followed by centrifugation at 12,000 x g for 10 min to pellet debris. Protein concentration was assayed by Bradford (Bio-Rad, Richmond, CA), and equal amounts of protein extract were separated by 10% SDS-PAGE and transferred to PVDF membrane. Samples were analyzed by Western blotting using mouse monoclonal anti-hnRNP A1 (Santa Cruz Biotechnology), rabbit polyclonal anti-XIAP (Aegera Therapeutics, Montreal, Quebec, Canada), or mouse-monoclonal anti-GAPDH (Advanced ImmunoChemical) followed by secondary antibody (horseradish peroxidase–conjugated anti-mouse or anti-rabbit IgG; Amersham Biosciences). Antibody complexes were detected using the ECL or ECL Plus systems (Amersham Biosciences).
Quantitative RT-PCR Analysis
Total RNA was isolated from transfected cells using the Absolutely RNA miniprep kit according to the manufacturer's instructions (Stratagene, La Jolla, CA). cDNA was generated using an oligo dT18 primer and the Bulk 1st-Strand Synthesis kit according to the protocol provided by the manufacturer (Amersham Biosciences). The synthesized cDNA was used as the template for quantitative PCR using the QuantiTect SYBR Green PCR kit (Qiagen) and analyzed on an ABI Prism 7000 detection system (Columbia, MD) using the ABI Prism 7000 SDS software. Quantitative PCR reactions were carried out to detect gal (forward: 5'-actatcccgaccgccttact; reverse: 5'-ctgtagcgctgatgttgaa), CAT (forward: 5'-gcgtgttacggtgaaaacct; reverse: 5'-gggcgaagaacttgtccata), XIAP (forward: 5'-gcggtgctttagttgtcat; reverse: 5'-tcgggtatatggtgtctgata), or GAPDH (forward: 5'-acagtcagccgcatcttctt; reverse: 5'-acgaccaaatccgttgactc).
Immunofluorescence Microscopy
Immunofluorescence microscopy was performed as described (Allemand et al., 2005). FLAG-tagged proteins were detected using mouse monoclonal anti-FLAG M2 (Sigma) and Alexa Fluor 488–conjugated goat anti-mouse IgG secondary antibody (Molecular Probes, Eugene, OR).
XIAP Protein Stability Analysis
XIAP protein stability was determined essentially as described (Yoon et al., 2006). Cells were treated with 10 µg/ml cycloheximide (Sigma) 18 h after transfection. After 45 min of cycloheximide treatment, protein extracts were harvested by lysis in 100 µl RIPA buffer (0-h time point). Protein extracts were subsequently harvested at 1-, 2-, 4-, and 8-h time points, protein concentration was assayed by Bradford (Bio-Rad), and equal amounts of protein extract were separated by 10% SDS-PAGE, transferred to PVDF membrane, and analyzed by Western blot using antibodies against XIAP and GAPDH.
Subcellular Fractionation
Cells were washed in 1 ml of ice-cold PBS, resuspended in 400 µl of buffer A (10 mM HEPES-KOH, pH 7.5, 10 mM KCl, 1 mM DTT, 1 mM PMSF) containing protease inhibitors, and incubated on ice for 15 min. Nonidet P-40 was added to a final concentration of 0.3% and cells were incubated for an additional 10 min on ice. Nuclei were pelleted by centrifugation at 1500 x g for 5 min, and the cytoplasmic fraction was collected to a new tube and clarified by centrifugation at 13,000 x g for 15 min. The nuclei pellet was washed two times with 1 ml of buffer A, then resuspended in 50 µl of buffer B (20 mM HEPES-KOH, pH 7.5, 400 mM NaCl, 1 mM DTT, 1 mM PMSF) containing protease inhibitors, and incubated on ice for 30 min, with mixing every 5 min. Nuclear debris was pelleted at 13,000 x g for 5 min, and the nuclear fraction was collected to a new tube.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Holcik et al., 2003). To gain a better understanding of XIAP IRES function, we used an RNA-affinity chromatography approach (Kim et al., 2004) followed by mass-peptide fingerprinting to isolate and identify proteins that interact with XIAP IRES RNA. We used the minimal functional XIAP IRES element that retains full activity and encompasses nucleotides –162 to +1 in the 5' untranslated region of XIAP mRNA for these experiments (Holcik et al., 1999). Whole-cell protein extract was prepared from HEK293T cells, which was incubated with either avidin-agarose beads alone, avidin-agarose beads conjugated to biotin-labeled XIAP IRES RNA, or avidin-agarose beads conjugated to biotin-labeled HIAP2 IRES RNA (the 149-nucleotide minimal functional IRES sequence; Warnakulasuriyarachchi et al., 2004). When XIAP IRES RNA was used as an affinity matrix, we were able to isolate at least six distinct proteins (Figure 1A, lane 2), whereas a control reaction using avidin-agarose beads alone did not yield any proteins (Figure 1A, lanes 1 and 3). The use of HIAP2 IRES RNA as an affinity matrix resulted in the isolation of a different set of proteins than that isolated using XIAP IRES RNA (Figure 1A, compare lane 4 to lane 2), indicating that the proteins isolated with XIAP IRES RNA were not simply nonspecific RNA-binding proteins. We first subjected the p52 protein isolated with XIAP IRES RNA to mass-peptide fingerprinting because it is the same molecular weight as the La autoantigen, which was previously shown to interact with XIAP IRES and which we therefore expected to isolate using this technique. Indeed, the p52 protein was identified as the La autoantigen, confirming that we were able to isolate XIAP IRES-binding proteins using an RNA-affinity chromatography approach (data not shown). Similarly, we also isolated hnRNP C1/C2 using this technique, as determined by Western blot analysis (p44 protein; data not shown). We then subjected the p37 protein isolated using XIAP IRES RNA to mass-peptide fingerprinting and identified it as hnRNP A1 with 42% sequence coverage (Figure 1B).
|
We next assessed whether the endogenous hnRNP A1 associates with endogenous XIAP mRNA in cells. RNA–protein complexes were formaldehyde cross-linked in whole cells, and after cell lysis RNA–protein complexes were immunoprecipitated, and RNA was isolated from these immunoprecipitates. cDNA was produced by reverse transcription, followed by PCR amplification with XIAP and actin-coding sequence-specific primers. As shown previously (Holcik and Korneluk, 2000), we were able to isolate XIAP mRNA by immunoprecipitation with La antibodies (Figure 1D, lane 4) but not with GAPDH antibodies (negative control, Figure 1D, lane 3). Immunoprecipitation with hnRNP A1 antibodies coprecipitated XIAP mRNA (Figure 1D, lane 2), confirming that endogenous hnRNP A1 associates with endogenous XIAP mRNA in cells in vivo. Importantly, we were unable to amplify the high-abundance actin transcript from our immunoprecipitates, indicating that our coimmunoprecipitation of XIAP mRNA is specific.
hnRNP A1 Binds within the Core RNP-Binding Site of the XIAP IRES
Our observations that hnRNP A1 is associated with XIAP IRES RNA both in vitro and in vivo suggest that hnRNP A1 can bind directly to the XIAP IRES sequence. To determine if hnRNP A1 binds directly to XIAP IRES RNA, we performed a UV-cross-linking experiment using a radiolabeled XIAP IRES RNA probe and purified recombinant GST-hnRNP A1. Increasing amounts of recombinant GST-hnRNP A1 were incubated with 32P-labeled XIAP IRES RNA, followed by UV cross-linking and separation by SDS-PAGE. We find that XIAP IRES RNA is cross-linked to GST-hnRNP A1 in vitro (Figure 2A), indicating that hnRNP A1 does indeed bind directly to XIAP IRES RNA. To test the specificity of this interaction, we coincubated GST-hnRNP A1 and 32P-labeled XIAP IRES RNA with excess unlabeled XIAP IRES RNA (specific competitor) or excess unlabeled HIAP2 IRES RNA (nonspecific competitor) in our UV cross-linking assay. We find that whereas excess unlabeled XIAP IRES RNA effectively competes with 32P-labeled XIAP IRES RNA for binding to GST-hnRNP A1 (Figure 2B, lanes 3 and 4), excess unlabeled HIAP2 IRES RNA does not (Figure 2B, lanes 6 and 7). Therefore, the in vitro binding of GST-hnRNP A1 to XIAP IRES RNA is specific.
|
), suggesting a bona fide and specific interaction.
The core RNP-binding site within the XIAP IRES is located between nucleotides –62 to –34 (Holcik and Korneluk, 2000). Therefore, we mapped the binding of hnRNP A1 using competitor oligonucleotides as described previously (Holcik and Korneluk, 2000). RNA oligonucleotide competitors that span the polypyrimidine tract within the core RNP-binding site and sequences immediately upstream of the start codon compete with 32P-labeled XIAP IRES RNA for binding to GST-hnRNP A1 (Figure 2D, lanes 4 and 5), indicating that hnRNP A1 binds these regions of the IRES sequence. These observations suggest that hnRNP A1 may modulate XIAP IRES activity by binding in the proximity of the core RNP-binding site, as has been previously observed for the La autoantigen (Holcik and Korneluk, 2000). We additionally tested whether mutations of the identified binding sites within the XIAP IRES abrogate the effect of hnRNP A1 on XIAP IRES activity (see below).
Cytoplasmic hnRNP A1 Negatively Regulates IRES-dependent Translation of XIAP
We have shown that hnRNP A1 can interact with the XIAP IRES both in vitro and in vivo, suggesting that hnRNP A1 may modulate XIAP IRES activity. Therefore, we examined whether overexpression of hnRNP A1 has any effect on XIAP IRES activity. To assess XIAP IRES activity, we used a previously described bicistronic reporter plasmid containing the minimal XIAP IRES element (pgal/5'(–162)/CAT; Holcik et al., 1999); translation of the first cistron (gal) is cap-dependent whereas translation of the second cistron (CAT) is dependent on XIAP IRES activity (Holcik et al., 1999). By calculating the ratio of CAT expression to gal expression, the relative IRES activity can be determined. HEK293T cells were transiently cotransfected with the pgal/5'(–162)/CAT bicistronic reporter plasmid and either a FLAG-tagged hnRNP A1 or green fluorescent protein (GFP)-expressing plasmid. We found that overexpression of FLAG-hnRNP A1 causes a decrease in XIAP IRES activity compared with a GFP control (Figure 3B), indicating that hnRNP A1 has a negative effect on XIAP IRES function. We next determined the effect of mutating the hnRNP A1 binding sites within the XIAP IRES using the same bicistrionic reporter approach. hnRNP A1 binds within the polypyrimidine tract contained in the core RNP-binding site of the XIAP IRES (Figure 2); we have found that the introduction of mutations within this sequence completely abrogates XIAP IRES activity (data not shown and Holcik et al., 1999), precluding us from assessing the effect of mutating this site on hnRNP A1 ITAF function. However, removal of the hnRNP A1 binding site adjacent to the start codon did not affect hnRNP A1 ITAF function (data not shown), suggesting that the hnRNP A1 binding site within the polypyrimidine tract may be sufficient for the negative regulation of XIAP IRES activity by hnRNP A1 in vivo.
|
), raising the possibility that overexpression of hnRNP A1 affects the integrity of the bicistronic RNA transcript (gal/IRES/CAT) produced from the pgal/5'(–162)/CAT plasmid, thus altering the ratio of CAT protein to gal protein. Therefore we determined the effect of overexpressing hnRNP A1 on the integrity of the gal/5'(–162)/CAT bicistronic RNA transcript using quantitative RT-PCR as described previously (Holcik et al., 2005). Total RNA was isolated from cells cotransfected with pgal/5'(–162)/CAT and a GFP- or hnRNP A1–expressing plasmid. cDNA was produced by reverse transcription, which served as a template for quantitative PCR using primers that amplify a portion of the gal coding region and a portion of the CAT coding region. As shown in Figure 3C, the ratio of CAT and gal cistrons was unchanged in cells cotransfected with the hnRNP A1–expressing plasmid compared with cells cotransfected with the GFP-expressing plasmid. These data confirm that the integrity of the bicistronic RNA transcript produced from the pgal/5'(–162)/CAT reporter plasmid is not affected when hnRNP A1 is overexpressed.
hnRNP A1 normally shuttles between the nucleus and the cytoplasm, with the bulk of the protein displaying nuclear localization (Pinol-Roma and Dreyfuss, 1992). We found that overexpressed FLAG-hnRNP A1 is mostly nuclear, although we saw some cytoplasmic accumulation of the protein (Figure 3A). Because translation is a cytoplasmic event, the modest effect of hnRNP A1 overexpression on XIAP IRES-dependent translation may be due to the different subcellular compartmentalization of hnRNP A1 and mRNAs containing the XIAP IRES. Notably, two reports have shown that hnRNP A1 accumulates in the cytoplasm during cellular stress (van der Houven van Oordt et al., 2000; Allemand et al., 2005), suggesting that hnRNP A1 ITAF activity for the XIAP IRES could be regulated by subcellular localization. We therefore hypothesized that hnRNP A1 should exert an inhibitory effect on IRES-dependent translation of XIAP only when hnRNP A1 is present in the cytoplasm. To test this hypothesis, we used a mutant version of hnRNP A1 (the F1 mutant) that fails to interact with the Trn1 transporter protein and thus remains cytoplasmically localized (Figure 3A; Allemand et al., 2005). HEK293T cells were transiently cotransfected with the pgal/5'(–162)/CAT bicistronic reporter plasmid and a plasmid expressing a FLAG-tagged hnRNP A1 F1 mutant. Although wild-type hnRNP A1 overexpression caused a 
28% decrease in XIAP IRES activity, the overexpression of the F1 mutant caused a 53% decrease in XIAP IRES activity (Figure 3B). Quantitative RT-PCR showed that overexpression of the F1 mutant has no effect on the integrity of the bicistronic reporter RNA (Figure 3C). These data indicate that cytoplasmic hnRNP A1 preferentially affects the activity of the XIAP IRES.
We also examined the effect of cytoplasmic hnRNP A1 on the expression of endogenous XIAP protein. Western blot analysis using anti-XIAP antibodies showed that overexpression of the F1 mutant reduces endogenous XIAP protein levels by nearly half (Figure 4A) but does not affect XIAP mRNA levels (Figure 4C). Importantly, overexpression of the F1 mutant does not affect global protein synthesis (Figure 4B) or the stability of XIAP protein (Figure 4D), indicating that the cytoplasmic hnRNP A1 F1 mutant specifically reduces translation of endogenous XIAP mRNA. Together with the data presented above, these findings demonstrate that cytoplasmic localization of hnRNP A1 is an important determinant of its ability to negatively regulate IRES-dependent translation of XIAP. More importantly, these data provide evidence that subcellular localization of an ITAF affects its ability to modulate IRES function.
|
; Allemand et al., 2005). Because we have observed that cytoplasmic hnRNP A1 significantly reduces XIAP IRES-dependent translation, we hypothesized that osmotic shock should lead to a decrease in XIAP protein levels because of accumulation of hnRNP A1 in the cytoplasm. Moreover, any decrease in XIAP levels caused by osmotic shock should be dependent on hnRNP A1. To determine if osmotic shock reduces XIAP protein levels, cells were grown in media containing 0.6 M sorbitol (osmotic shock medium [OSM]) or nonsupplemented growth media for 4 h, with samples harvested at 1-h intervals. Western blot analysis using anti-XIAP antibodies showed that XIAP protein levels decrease during osmotic shock (Figure 5A). Moreover, this decrease in XIAP protein levels correlates with the redistribution of hnRNP A1 from the nucleus to the cytoplasm during osmotic shock (Figure 5A). Examination of XIAP mRNA levels by quantitative RT-PCR showed that they were not affected by osmotic shock (Figure 5B). Interestingly, we also observed that osmotic shock–mediated cytoplasmic accumulation of hnRNP A1 causes an increase in FGF-2 protein levels (Supplementary Figure S1). FGF-2 is translated using an IRES-dependent mechanism (Vagner et al., 1995), and FGF-2 IRES activity was recently shown to be enhanced by hnRNP A1 (Bonnal et al., 2005). Therefore, our findings suggest that cytoplasmic accumulation of hnRNP A1 is also important for its positive regulation of IRES activity (such as FGF-2 IRES).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
hnRNP A1 was recently shown to interact with the FGF-2 IRES, causing an upregulation of FGF-2 IRES activity (Bonnal et al., 2005). This is in contrast to the negative regulation of XIAP IRES activity that we have observed for hnRNP A1. However, we have also observed that hnRNP A1 has a negative effect on the activities of the c-myc, BiP, and VEGF IRES elements in an in vitro translation assay (Bonnal et al., 2005). These findings suggest that hnRNP A1 may be a dual-function ITAF, although we do not yet understand how hnRNP A1 can both positively regulate some IRES elements and negatively regulate others. As a negative regulator of IRES, hnRNP A1 may block binding sites for potent inducers of IRES activity. Indeed, we show that hnRNP A1 binds within the XIAP IRES core RNP-binding site (Figure 2), where we have previously localized binding of the La autoantigen, a positive regulator of XIAP IRES activity (Holcik and Korneluk, 2000). However, we also find that hnRNP A1 does not effectively compete with the La autoantigen for binding to XIAP IRES RNA in an in vitro UV cross-linking assay (Supplementary Figure S2), suggesting that displacement of the La autoantigen from the XIAP IRES is not the mechanism by which hnRNP A1 reduces XIAP IRES activity. This observation does not rule out the possibility that hnRNP A1 disrupts the binding of an unidentified ITAF within the core RNP-binding site of the XIAP IRES. Alternatively, hnRNP A1 may bind to some IRES (such as XIAP) and modify its structure in such a way that renders it nonfunctional, whereas hnRNP A1 may provide critical structural remodeling of other IRES (such as FGF-2) to induce a conformation that is amenable to ribosome recruitment.
XIAP is the prototype member of the family of intrinsic inhibitor of apoptosis (IAP) proteins. XIAP is critically involved in a number of cellular functions including direct caspase binding and inhibition, modulation of receptor-mediated signal transduction, and protein ubiquitination (reviewed in Liston et al., 2003). IRES-dependent translation permits de novo synthesis of XIAP during conditions that inhibit cap-dependent translation (Holcik et al., 1999), and therefore allows XIAP expression to persist during the commitment phase of apoptosis. The decision whether to commit to death or not is dependent on the abundance and activity of XIAP, which is partially determined by the level of XIAP IRES activity and is therefore linked to the function of XIAP ITAFs, such as hnRNP A1. Under proapoptotic conditions XIAP activity must be removed to allow apoptosis to proceed. Pre-existing XIAP can be neutralized by binding of Smac/DIABLO, XAF1, or HtrA1/Omi to XIAP (Du et al., 2000; Verhagen et al., 2000; Liston et al., 2001; Suzuki et al., 2001). However, because of persistent IRES activity, new XIAP protein will continue to be produced, and therefore the abundance of XIAP protein may exceed the capacity of XAF1, Smac/DIABLO, and HtrA1/Omi to regulate XIAP activity. An hnRNP A1–mediated reduction in XIAP IRES function would serve to shut off de novo XIAP synthesis, and combined with the neutralization of pre-existing XIAP by XAF1, Smac/DIABLO, and HtrA2/Omi, would permit execution of the cell death program. On the basis of our observations, we hypothesize that hnRNP A1 is redistributed from the nucleus to the cytoplasm during cellular stress and binds to the XIAP IRES to reduce XIAP translation when cell death is favorable.
hnRNP A1 has been shown to undergo posttranslational modification during cellular stress and apoptosis, which may affect its ability to modulate XIAP IRES activity. During osmotic shock, a cellular stress that results in apoptosis (Qin et al., 1997; Edwards et al., 1998; Galvez et al., 2001), hnRNP A1 has been shown to accumulate in the cytoplasm (van der Houven van Oordt et al., 2000). This redistribution of hnRNP A1 is dependent on the phosphorylation of hnRNP A1 at several serine residues at the carboxy terminus of the protein (known as the F-peptide), which blocks Trn1-dependent nuclear import of hnRNP A1 (Allemand et al., 2005). In this case, osmotic stress causes the redistribution of hnRNP A1 to the cytoplasm where it can bind to the XIAP IRES to reduce XIAP translation. In support of this hypothesis we show that a cytoplasmically restricted mutant of hnRNP A1 significantly reduces XIAP IRES activity (Figure 3B) and causes a greater reduction in endogenous XIAP proteins levels than the primarily nuclear wild-type hnRNP A1 (Figure 4A). Moreover, exposure of cells to high-osmolarity growth medium reduces XIAP expression, and this reduction in XIAP protein levels can be abrogated by transient knockdown of hnRNP A1 (Figure 5C), indicating that the reduction of XIAP expression in response to osmotic shock is dependent on hnRNP A1. It is also important to note that because hnRNP A1 is normally present in the nucleus (Pinol-Roma and Dreyfuss, 1992), depletion of hnRNP A1 under normal growth conditions would be predicted to have only a modest effect on IRES-dependent translation of XIAP, which we in fact observed (Figure 5C and data not shown). A recent report has shown that treatment of cells with sodium butyrate causes redistribution of hnRNP A1 from the nucleus to the cytoplasm (Tan et al., 2006). Importantly, sodium butyrate treatment also results in a reduction in XIAP protein levels and sensitization of human glioma cells to tumor necrosis factor–related apoptosis-inducing ligand (TRAIL)-mediated apoptosis (Kim et al., 2005). We have observed that overexpression of a cytoplasmically localized mutant of hnRNP A1 significantly reduces XIAP IRES activity and decreases XIAP protein levels (Figures 3B and 4A), raising the possibility that sodium butyrate treatment sensitizes cells to apoptosis through the redistribution of hnRNP A1 from the nucleus to the cytoplasm, where hnRNP A1 significantly decreases IRES-dependent translation of XIAP.
Our findings suggest that a critical event for hnRNP A1-dependent regulation of XIAP translation is the relocalization of hnRNP A1 itself. Given that many other ITAFs are known to shuttle between the nucleus and the cytoplasm, we propose that the subcellular localization of ITAFs is critical for their role as regulators of IRES-dependent translation. Indeed, the c-myc ITAF hnRNP C1/C2 was found to translocate from the nucleus to the cytoplasm during the G2/M phase of the cell cycle, resulting in a concomitant increase in IRES-dependent translation of c-myc protein (Kim et al., 2003). Recent reports have described hnRNP A1 posttranslational modification in response stress stimuli (Allemand et al., 2005), and these posttranslational modifications are dependent on the activation of signaling pathways (van der Houven van Oordt et al., 2000). Future experiments delineating the signaling pathways that control hnRNP A1 modulation of XIAP IRES activity will increase our understanding of how XIAP IRES activity, and consequently cellular survival during stress, is regulated.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). 
Address correspondence to: Martin Holcik (martin{at}mgcheo.med.uottawa.ca)
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bonnal, S., Pileur, F., Orsini, C., Parker, F., Pujol, F., Prats, A. C., Vagner, S. (2005). Heterogeneous nuclear ribonucleoprotein A1 is a novel internal ribosome entry site trans-acting factor that modulates alternative initiation of translation of the fibroblast growth factor 2 mRNA. J. Biol. Chem 280, 4144–4153.
Chan, E. K. and Tan, E. M. (1987). Human autoantibody-reactive epitopes of SS-B/La are highly conserved in comparison with epitopes recognized by murine monoclonal antibodies. J. Exp. Med 166, 1627–1640.
Du, C., Fang, M., Li, Y., Li, L., Wang, X. (2000). Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33–42.[CrossRef][Medline]
Edwards, Y. S., Sutherland, L. M., Power, J. H., Nicholas, T. E., Murray, A. W. (1998). Osmotic stress induces both secretion and apoptosis in rat alveolar type II cells. Am. J. Physiol 275, L670–L678.[Medline]
Galvez, A., Morales, M. P., Eltit, J. M., Ocaranza, P., Carrasco, L., Campos, X., Sapag-Hagar, M., Diaz-Araya, G., Lavandero, S. (2001). A rapid and strong apoptotic process is triggered by hyperosmotic stress in cultured rat cardiac myocytes. Cell Tissue Res 304, 279–285.[CrossRef][Medline]
Harding, H. P., Zhang, Y., Ron, D. (1999). Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271–274.[CrossRef][Medline]
Hellen, C. U. and Sarnow, P. (2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev 15, 1593–1612.
Holcik, M., Gordon, B. W., Korneluk, R. G. (2003). The internal ribosome entry site-mediated translation of antiapoptotic protein XIAP is modulated by the heterogeneous nuclear ribonucleoproteins C1 and C2. Mol. Cell. Biol 23, 280–288.
Holcik, M., Graber, T., Lewis, S. M., Lefebvre, C. A., Lacasse, E., Baird, S. (2005). Spurious splicing within the XIAP 5' UTR occurs in the Rluc/Fluc but not the gal/CAT bicistronic reporter system. RNA 11, 1605–1609.
Holcik, M. and Korneluk, R. G. (2000). Functional characterization of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation. Mol. Cell. Biol 20, 4648–4657.
Holcik, M., Lefebvre, C., Yeh, C., Chow, T., Korneluk, R. G. (1999). A new internal-ribosome-entry-site motif potentiates XIAP-mediated cytoprotection. Nat. Cell Biol 1, 190–192.[CrossRef][Medline]
Holcik, M. and Sonenberg, N. (2005). Translational control in stress and apoptosis. Nat. Rev. Mol. Cell. Biol 6, 318–327.[CrossRef][Medline]
Holcik, M., Sonenberg, N., Korneluk, R. G. (2000). Internal ribosome initiation of translation and the control of cell death. Trends Genet 16, 469–473.[CrossRef][Medline]
Kapp, L. D. and Lorsch, J. R. (2004). The molecular mechanics of eukaryotic translation. Annu. Rev. Biochem 73, 657–704.[CrossRef][Medline]
Kim, E. H., Kim, H. S., Kim, S. U., Noh, E. J., Lee, J. S., Choi, K. S. (2005). Sodium butyrate sensitizes human glioma cells to TRAIL-mediated apoptosis through inhibition of Cdc2 and the subsequent downregulation of survivin and XIAP. Oncogene 24, 6877–6889.[CrossRef][Medline]
Kim, J. H., Paek, K. Y., Choi, K., Kim, T. D., Hahm, B., Kim, K. T., Jang, S. K. (2003). Heterogeneous nuclear ribonucleoprotein C modulates translation of c-myc mRNA in a cell cycle phase-dependent manner. Mol. Cell. Biol 23, 708–720.
Kim, J. H., Paek, K. Y., Ha, S. H., Cho, S., Choi, K., Kim, C. S., Ryu, S. H., Jang, S. K. (2004). A cellular RNA-binding protein enhances internal ribosomal entry site-dependent translation through an interaction downstream of the hepatitis C virus polyprotein initiation codon. Mol. Cell. Biol 24, 7878–7890.
Kim, Y. K., Back, S. H., Rho, J., Lee, S. H., Jang, S. K. (2001). La autoantigen enhances translation of BiP mRNA. Nucleic Acids Res 29, 5009–5016.
Kullmann, M., Gopfert, U., Siewe, B., Hengst, L. (2002). ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR. Genes Dev 16, 3087–3099.
Lewis, S. M. and Holcik, M. (2005). IRES in distress: translational regulation of the inhibitor of apoptosis proteins XIAP and HIAP2 during cell stress. Cell Death Differ 12, 547–553.[CrossRef][Medline]
Liston, P., Fong, W. G., Kelly, N. L., Toji, S., Miyazaki, T., Conte, D., Tamai, K., Craig, C. G., McBurney, M. W., Korneluk, R. G. (2001). Identification of XAF1 as an antagonist of XIAP anti-Caspase activity. Nat. Cell Biol 3, 128–133.[CrossRef][Medline]
Liston, P., Fong, W. G., Korneluk, R. G. (2003). The inhibitors of apoptosis: there is more to life than Bcl2. Oncogene 22, 8568–8580.[CrossRef][Medline]
MacGregor, G. R., Nolan, G. P., Fiering, S., Roederer, M., Herzenberg, L. A. (1991). Use of the E. coli lacZ (-galactosidase) as a reporter gene. In: Methods in Molecular Biology, ed. E. J. Murray and J. M. Walker. Clifton, NJ: Humana Press, Vol. 7, 217–235.
Marissen, W. E. and Lloyd, R. E. (1998). Eukaryotic translation initiation factor 4G is targeted for proteolytic cleavage by caspase 3 during inhibition of translation in apoptotic cells. Mol. Cell. Biol 18, 7565–7574.
Mayeda, A. and Krainer, A. R. (1992). Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2. Cell 68, 365–375.[CrossRef][Medline]
Mitchell, S. A., Brown, E. C., Coldwell, M. J., Jackson, R. J., Willis, A. E. (2001). Protein factor requirements of the Apaf-1 internal ribosome entry segment: roles of polypyrimidine tract binding protein and upstream of N-ras. Mol. Cell. Biol 21, 3364–3374.
Niranjanakumari, S., Lasda, E., Brazas, R., Garcia-Blanco, M. A. (2002). Reversible cross-linking combined with immunoprecipitation to study RNA-protein interactions in vivo. Methods 26, 182–190.[CrossRef][Medline]
Pinol-Roma, S. and Dreyfuss, G. (1992). Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm. Nature 355, 730–732.[CrossRef][Medline]
Qin, S., Minami, Y., Kurosaki, T., Yamamura, H. (1997). Distinctive functions of Syk and Lyn in mediating osmotic stress- and ultraviolet C irradiation-induced apoptosis in chicken B cells. J. Biol. Chem 272, 17994–17999.
Spriggs, K. A., Bushell, M., Mitchell, S. A., Willis, A. E. (2005). Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death Differ 12, 585–591.[CrossRef][Medline]
Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K., Takahashi, R. (2001). A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol. Cell 8, 613–621.[CrossRef][Medline]
Tan, H. T., Zubaidah, R. M., Tan, S., Hooi, S. C., Chung, M. C. (2006). 2-D DIGE analysis of butyrate-treated HCT-116 cells after enrichment with heparin affinity chromatography. J. Proteome Res 5, 1098–1106.[CrossRef][Medline]
Vagner, S., Gensac, M. C., Maret, A., Bayard, F., Amalric, F., Prats, H., Prats, A. C. (1995). Alternative translation of human fibroblast growth factor 2 mRNA occurs by internal entry of ribosomes. Mol. Cell. Biol 15, 35–44.[Abstract]
van der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J., Krainer, A. R., Moscat, J., Caceres, J. F. (2000). The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. J. Cell Biol 149, 307–316.
Verhagen, A. M., Ekert, P. G., Pakusch, M., Silke, J., Connolly, L. M., Reid, G. E., Moritz, R. L., Simpson, R. J., Vaux, D. L. (2000). Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43–53.[CrossRef][Medline]
Warnakulasuriyarachchi, D., Cerquozzi, S., Cheung, H. H., Holcik, M. (2004). Translational induction of the inhibitor of apoptosis protein HIAP2 during endoplasmic reticulum stress attenuates cell death and is mediated via an inducible internal ribosome entry site element. J. Biol. Chem 279, 17148–17157.
Yoon, A., Peng, G., Brandenburger, Y., Zollo, O., Xu, W., Rego, E., Ruggero, D. (2006). Impaired control of IRES-mediated translation in X-linked dyskeratosis congenita. Science 312, 902–906.
This article has been cited by other articles:
|
|
 |
|
  J.-Y. Lin, S.-R. Shih, M. Pan, C. Li, C.-F. Lue, V. Stollar, and M.-L. Li hnRNP A1 Interacts with the 5' Untranslated Regions of Enterovirus 71 and Sindbis Virus RNA and Is Required for Viral Replication J. Virol., June 15, 2009; 83(12): 6106 - 6114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Majumder, I. Yaman, F. Gaccioli, V. V. Zeenko, C. Wang, M. G. Caprara, R. C. Venema, A. A. Komar, M. D. Snider, and M. Hatzoglou The hnRNA-Binding Proteins hnRNP L and PTB Are Required for Efficient Translation of the Cat-1 Arginine/Lysine Transporter mRNA during Amino Acid Starvation Mol. Cell. Biol., May 15, 2009; 29(10): 2899 - 2912. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Pettit Kneller, J. H. Connor, and D. S. Lyles hnRNPs Relocalize to the Cytoplasm following Infection with Vesicular Stomatitis Virus J. Virol., January 15, 2009; 83(2): 770 - 780. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Shi, P. J. Frost, B. Q. Hoang, A. Benavides, S. Sharma, J. F. Gera, and A. K. Lichtenstein IL-6-Induced Stimulation of c-Myc Translation in Multiple Myeloma Cells Is Mediated by Myc Internal Ribosome Entry Site Function and the RNA-Binding Protein, hnRNP A1 Cancer Res., December 15, 2008; 68(24): 10215 - 10222. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kazadi, C. Loeuillet, S. Deutsch, A. Ciuffi, M. Munoz, J. S. Beckmann, D. Moradpour, S. E. Antonarakis, and A. Telenti Genomic determinants of the efficiency of internal ribosomal entry sites of viral and cellular origin Nucleic Acids Res., December 1, 2008; 36(21): 6918 - 6925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. D. Jo, J. Martin, A. Bernath, J. Masri, A. Lichtenstein, and J. Gera Heterogeneous Nuclear Ribonucleoprotein A1 Regulates Cyclin D1 and c-myc Internal Ribosome Entry Site Function through Akt Signaling J. Biol. Chem., August 22, 2008; 283(34): 23274 - 23287. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cammas, F. Pileur, S. Bonnal, S. M. Lewis, N. Leveque, M. Holcik, and S. Vagner Cytoplasmic Relocalization of Heterogeneous Nuclear Ribonucleoprotein A1 Controls Translation Initiation of Specific mRNAs Mol. Biol. Cell, December 1, 2007; 18(12): 5048 - 5059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Baird, S. M. Lewis, M. Turcotte, and M. Holcik A search for structurally similar cellular internal ribosome entry sites Nucleic Acids Res., July 9, 2007; 35(14): 4664 - 4677. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
, XIAP IRES; 
, HIAP2 IRES) is plotted as a function of protein concentration. The data presented represent the mean ± SD of three independent experiments. (D) GST-hnRNPA1 was incubated with 32P-labeled XIAP IRES RNA probe alone (No competitor) or a combination of 32P-labeled XIAP IRES RNA probe and 100-fold excess of unlabeled competitor RNA molecules, UV-cross-linked, separated by SDS-PAGE, and visualized by autoradiography. Gray boxes in the sequence schematic indicate hnRNP A1–binding sites (labeled as site A and site B).
