|
|
|
|
Vol. 18, Issue 4, 1497-1506, April 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





*Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan;
Graduate School of Medicine, University of Tokyo, Bunkyoku, Tokyo 113-0033, Japan; and
Research Center for Glycoscience, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305-8566, Japan
Submitted October 2, 2006;
Revised January 26, 2006;
Accepted February 1, 2007
Monitoring Editor: Reid Gilmore
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
One idea to explain how saturated chains in mammalian GPI are synthesized is that GPI may use lipid remodeling. In lower microorganisms, processing of lipid moieties of GPI, called lipid remodeling, is well known, but the physiological significance is still an outstanding issue. In Saccharomyces cerevisiae, sn-2linked acyl chain in PI moiety is changed to C26:0 chain and/or diacylglycerol moiety is replaced with ceramide after GPI is transferred to proteins and inositol-linked palmitic acid is removed (Sipos et al., 1997
; Bosson et al., 2006
). Bloodstream form of Trypanosoma brucei, a causative agent of African sleeping sickness, exchanges both acyl chains in PI of GPI strictly to myristate (C14:0) in the ER before attachment of GPI to variant surface glycoproteins (Morita et al., 2000
). In contrast, very little is known so far in mammalian cells except for the presence of deacylation of inositol-linked acyl chain after conjugation of GPI with proteins in the ER. We previously reported Chinese hamster ovary (CHO) cells with defects in Golgi/ER-resident post-GPI-attachment to proteins (PGAP)2 (Tashima et al., 2006
). In PGAP2-deficient CHO cells, the surface expression of GPI-APs was decreased owing to rapid secretion of cleaved GPI-APs into the culture medium. We found that two sequential cleavages of GPI took place in the Golgi and cell surface in PGAP2-deficient CHO cells (Tashima et al., 2006
). First, GPI-APs were converted to lyso-GPI-APs by phospholipase A (PLA) activity by the time when newly synthesized GPI-APs exit from the trans-Golgi network. Second, this event was followed by cleavage of lyso-GPI-APs by phospholipase D (PLD) activity on the cell surface, resulting in secretion of GPI-APs. Although we have not identified the surface PLD yet, it seemed different from GPI-PLD, a well-known PLD abundant in serum, and might be specific for lyso-form GPI-APs because normal GPI-APs carrying two lipid chains are resistant to this PLD activity. We hypothesized that lyso-GPI-AP was an intermediate in the process of fatty acid remodeling, which ought to be reacylated with a saturated chain in the presence of PGAP2. We expected that if the PLA activity involved in the fatty acid remodeling is lost in PGAP2-deficient cells, GPI-APs would remain unremodeled and have two lipid chains as normal GPI-APs, resulting in recovery of the surface expressions due to the resistant to the surface PLD. To prove our hypothesis, here we report establishment and characterization of double-mutant cells from PGAP2-deficient CHO cells, in which surface expression of GPI-APs was indeed restored, and we reveal the significance of fatty acid remodeling on the raft association of GPI-APs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Plasmid Construction
The expression vector of human PGAP3/PERLD1, constructed in pCMV· SPORT6, was purchased from Mammalian Gene Collection (clone ID 3855206; National Center for Biotechnology Information accession no. BC010652). Yeast PER1, amplified by polymerase chain reaction (PCR) (primers CTCCGTCGACCATGAGGTTAGCTGTGGTTGTGAC and GTGCTGCGGCCGCTAGTACAATTGTCTATTACCCCAATAGG) from pRS316T-PER1 (Fujita et al., 2006a
), was subcloned into SalI and NotI sites of pCMV·SPORT6 vector. pME-hPGAP3/PERLD1-3HA, which expresses hPGAP3 carboxy-terminally tagged with three hemagglutinin (HA)-tags, was constructed by subcloning hPGAP3 amplified by PCR (primers GTGTACGGTGGGAGGTCTAT and GCTGACGCGTGTCCAGCTTGAACTTGTCCTCT) into EcoRI and MluI sites of pME-3HA vector (a gift from Dr. K. Ohishi). All fragments obtained by PCR were confirmed by sequencing. pMSCV-rPGAP2-zeo-hPGAP3 was constructed by ligation of EcoRIXbaI fragment of rat PGAP2 from pME-Py-rPGAP2 (Tashima et al., 2006
), XbaIBstZ17I fragment of SV40-zeo from pcDNA3.1-zeo (Invitrogen), and SspIBamHI fragment of CMV-hPGAP3 from pCMV·SPORT6-hPGAP3 and EcoRIBamHI vector portion of pMSCV-neo (Clontech, Mountain View, CA). pME-pgkpuro-HFGF-CD59 and pME-pgkhyg-HFGF-CD59 were constructed by subcloning EcoRINotI fragment of HFGF-CD59 into pME-pgkpuro and pME-pgkhyg (gifts from Dr. K. Ohishi), respectively.
Cloning of Chinese Hamster PGAP3
A partial cDNA of hamster PGAP3 was obtained from CHO cDNA library by nested PCR with two degenerated primer sets of de1U (5'-CARTTYCAYGGNAARTGGCCNTT-3') and de4L (5'-ARRTANARNSWRTCRTCYTC-3'), and de2U (5'-TTYCAYACNMGNGAYACNGA-3') and de3L (5'-ATRTGCCADATNGCRTGNGCRTC-3'). Based on the sequence of obtained partial hamster PGAP3 cDNA, several new primers were designed, and PCRs with these primers and those corresponding to vector portion were done to obtained longer cDNA containing full coding region.
Analysis of PGAP3 mRNA by Sequencing and Real-Time Reverse Transcription (RT)-PCR
Total RNAs were obtained from GD3S-C37 (wild-type cells) and DM2&3-C2 (double-mutant cells) by using TRIzol (Invitrogen). First strand cDNAs were synthesized by PrimeScript RTase (Takara, Kyoto, Japan) with mixture of oligo(dT) and random primers as manufacturer's protocol. Real-time PCR was performed with SYBR Premix EX Taq (Takara) and Prism 7900HT (Applied Biosystems, Foster City, CA). Two sets of primer, set A (5'-ACTGAAGCACTTCCGCTCCCT-3' and 5'-GGCAGAAGCTGGCTCTTGGAT-3' and set B (5'-CACATCAGCACCATTCCAGTC-3' and 5'-AGGAGAAGCAGCAGGAACCAG-3') were used for hamster PGAP3, and 5'-GCTGTCCCTGTATGCCTCTGG-3' and 5'-TCTCGGCTGTGGTGGTGAAG-3' were used for
-actin as internal control. The data were analyzed by SDS2 software (Applied Biosystems), and each standard curve was automatically produced whose R2 values of
-actin, primer set A and B were 0.989, 0988, and 0.995, respectively. The amounts of PGAP3 mRNA were normalized by
-actin and those of GD3S-C37 were set as ratio = 1. PGAP3 cDNA containing full-length of coding region was amplified from DM2&3-C2 RNA by Phusion DNA polymerase (Finnzymes, Espoo, Finland) with primers 5'-AGTGCAACATGAACACAGATACTTCC3' and 5'GTGAGAGCCAGCAAGGGGT3' and subcloned into pBluescriptII vector. The sequence of six independent clones revealed that two of six clones had 19 base pairs insertion (TCCTGTCTGTCTGTTTCAG) between 60th and 61th amino acids. To examine whether this insertion was specific to DM2&3-C2 cells, the region of 190 base pairs containing this site from both GD3S-C37 and DM2&3-C2 RNAs was amplified by PCR (35 cycles) with primer set A (see above) and amplified DNA fragments were applied to 3% agarose gel.
Fluorescence-activated Cell Sorting (FACS) Analysis
Cells (5 x 106) were suspended in 0.4 ml of Opti-MEM I (Invitrogen) with 2025 µg of the indicated plasmids and electroporated at 260 V and 1000 µF by using a Gene Pulser (Bio-Rad). Two days after transfection, cells were stained with antibodies against CD59 or uPAR and PE-conjugated goat anti-mouse IgG and analyzed by FACS Caliber (BD Biosciences).
Establishing Mutant Cells
C84 and AM-B cells were treated with 0.24 mg/ml ethyl methanesulfonate (EMS) for 24 h, cultured for 1 wk, and CD59-positive cells were enriched twice by auto MACS (Miltenyi Biotec, Auburn, CA) with biotinylated 5H8 anti-CD59 and streptavidin microbeads and sorted in FACS Vantage after staining with 5H8 anti-CD59 and PE-conjugated anti-mouse IgG, and limiting-diluted to obtained clones. The majority of cloned cell lines were double mutants of PGAP1 and PGAP2. DM1&2-C14 and -C17 were obtained from AM-B and C84 cells, respectively. To obtain double-mutant cells of PGAP2 and PGAP3, sorted CD59-positive cells were treated with PI-PLC, and PI-PLCsensitive cells were collected and limiting diluted. DM2&3-C2 was established from C84 cells.
Purification of PI from Surface GPI-APs
About 2 x 109 cells, expressing HFGF-CD59, were suspended in 12 ml of buffer A [9.6% (wt/vol) sucrose, 20 mM HEPES-NaOH, pH 7.4, and protease inhibitors (10 µg/ml leupeptin, 10 µg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride)], destroyed by nitrogen cavitation (PARR Instrument, Moline, IL) (300 psi at 4°C for 20 min) and centrifuged at 10,000 x g at 4°C for 10 min. The supernatant was transferred to a new tube. The pellet was resuspended in 6 ml of buffer A, destroyed again by nitrogen cavitation (300 psi at 4°C for 15 min) and centrifuged. The supernatant was saved. Finally, the pellet was resuspended in 2 ml of buffer A, passed through a 22-gauge needle 10 times, and centrifuged again. All supernatants were combined (
18 ml in total), and 1.5 ml each of the combined supernatant was placed on each of 10 ml of a continuous sucrose gradient (2050%, wt/vol) in 20 mM HEPES-NaOH, pH 7.4, prepared in 12 tubes by Gradient Master (BioComp Systems, Minneapolis, MN). After ultracentrifugation at 35,000 rpm (SW41 rotor) at 4°C for 1618 h, fractions of 1 ml were collected from the top using Piston Gradient Fractionator (BioComp Systems). Aliquots of each fraction were applied to SDS-polyacrylamide gel electrophoresis (PAGE)/Western blotting with antibodies against CD59, transferrin receptor (TfR), syntaxin6, and ribophorins II to determine fractions containing the plasma membrane without contaminating ER membrane. Typically, fractions 26 (total 60 ml from 12 tubes) were used for further steps. These combined fractions were divided into six tubes for SW28 rotor and mixed with 27 ml of chilled 20 mM HEPES-NaOH, pH 7.4, per tube. After ultracentrifugation at 25,000 rpm (SW28 rotor) at 4°C for 1618 h, the pellets were suspended in total 11 ml of Tris-buffered saline-E (TBS-E) (20 mM Tris-Cl, pH 7.4, 150 mM NaCl, and 1 mM EDTA) containing 60 mM 1-octyl-
-D-glucoside and protease inhibitors, and lysed for 2 h at 4°C. After ultracentrifugation at 28,000 rpm (SW41 rotor) at 4°C for 1 h, the supernatant was transferred to a new tube and incubated with 100 µl of bed volume of glutathione beads overnight. The glutathione (GSH) beads were washed with 1 ml of TBS-E containing 60 mM 1-octyl-
-D-glucoside twice followed by 1 ml of TBS-E containing 1% Triton X (TX)-100 three times. The binding proteins were eluted four times after 5-min incubation on ice with 200 µl each of elution buffer (20 mM GSH, 30 mM Tris-Cl, and 1% TX-100 in TBS-E). All eluates were combined, mixed with 14 µl of 10% deoxycholate and 80 µl of trichloroacetic acid (TCA), incubated on ice for 30 min, and centrifuged at 4°C for 20 min. The pellet was washed with 1 ml of ethanol twice, air-dried, resuspended in 200 µl of 2x sample buffer, applied to SDS-PAGE, and transferred to polyvinylidene difluoride (PVDF) membrane. PI was purified from PVDF membrane, as described previously (Fontaine et al., 2003
). PVDF membrane was stained with 0.1% Ponceau S in 5% acetic acid, and the band corresponding to HFGF-CD59 was cut, washed with water four times, and incubated with a mixture of 500 µl of 0.3 M NaOAc, pH 4.0, buffer and 500 µl of freshly dissolved 1 M sodium nitrite for 3 h at 37°C. After washing the PVDF membrane strips with 1 ml of water four times, PI was extracted in 400 µl of butan-1-ol saturated with water three times. The extracted PI in butan-1-ol was dried up under N2 stream, dissolved in 200 µl of chloroform/methanol 4:1 (C/M 4:1), and immediately applied to a column (200-µl bed) of Si60 silica (Sigma-Aldrich) packed in a glass Pasteur pipette plugged with glass wool and prewashed with 1 ml of C/M 1:4 three times followed by 1 ml of C/M 4:1 three times. After washing the column with 0.4 ml of C/M 4:1 five times, PI was eluted with 0.2 ml of C/M 1:4 five times, dried up under N2 stream, and redissolved in 100 µl of C/M 2:3 for mass spectrometry.
Electrospray Ionization Mass Spectrometric (ESI-MS) Analysis of Phospholipids
The ESI-MS analyses were performed using a 4000Q TRAP, quadrupole-linear ion trap hybrid MS (Applied Biosystems/MDS Sciex, Foster City, CA) with a LC-10AD VP high-performance liquid chromatography system combined with SIL-10AD VP autosampler (Shimadzu, Kyoto, Japan). Phospholipids were subjected directly to ESI-MS analysis without LC separation by flow injection; typically, 4 µl of sample was applied. The mobile phase composition was acetonitrile/methanol/water (6:7:2) (plus 0.1% ammonium formate) at a flow-rate of 8 µl/min. The scan range of the instrument was set at m/z 400950 at a scan speed of 1000 Da/s. The trap fill-time was set at 3 ms in the positive ion mode and at 5 ms in the negative ion mode. The ion spray voltage was set at 5500 V in the positive ion mode and at 4500 V in the negative ion mode. Neutral loss scanning of 277 Da (phosphorylinositol + NH4) was used for the detection of positive-molecular-weightrelated ions of PI (M + NH4) and precursor ion scanning of m/z 241 (phosphorylinositol H2O) was used for the detection of negative-molecular-weightrelated ions of PI (M H) (Taguchi et al., 2005
). Nitrogen was used as curtain gas (setting of 10, arbitrary units) and as collision gas (set to "high"). The declustering potential was set at 20 V to minimize in-source fragmentation. The enhanced product ion scanning used at collision energy of 55 eV in the negative ion mode. Q1 resolution was set to high, and Q3 resolution was set to unit mass. Collision energy of the neutral loss scanning was set at 25 to 40 eV in the positive ion mode.
Immunofluorescence Microscopy
CHO cells transfected with pME-PGAP3/PERLD1-3HA by using Lipofectamine 2000 (Invitrogen) were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature. After quenching with 40 mM ammonium chloride in PBS, the cells were permeabilized with PBS containing 0.1% TX-100 and 2.5% goat serum for 1 h at room temperature and stained with rabbit anti-GPP130 and mouse anti-HA antibodies followed by Alexa 594-conjugated goat anti-rabbit IgG and Alexa 488-conjugated goat anti-mouse IgG antibodies. The pictures were taken by BX50 microscope (Olympus, Tokyo, Japan) and VB-6010 charge-coupled device (CCD) camera (Keyence, Osaka, Japan).
Detergent-resistant Membrane (DRM) Fractionation
Cells were detached from the plate by using PBS containing 2.5 mM EDTA and 0.5% bovine serum albumin. After centrifugation, the cell pellet was resuspended in MBS-E [25 mM 2-(N-morpholino)ethanesulfonic acid, pH 6.5, 150 mM NaCl, and 5 mM EDTA] containing protease inhibitors supplemented with 1% TX-100, incubated for 20 min on ice, and homogenized by a potter-type Teflon homogenizer. The volume of lysis buffer was
20 times the weight of cell pellet (typically 2530 million cells/ml lysis buffer). One milliliter of lysate was mixed with 1 ml of 80% (wt/vol) sucrose in MBS-E, transferred to a centrifuge tube for SW41, overlaid with 7 ml of 30% and 2 ml of 5% sucrose in MBS-E, ultracentrifuged at 38,000 rpm for 1618 h at 4°C, and fractionated from the top using Piston Gradient Fractionator (BioComp Systems) with each fraction of 1 ml (total 11 fractions). Fractions 24, 58, and 911 were combined as top, middle, and bottom fractions, respectively. Aliquots of each fraction were mixed with 6x sample buffer, without a reducing reagent, and applied to 420% gradient SDS-PAGE.
Fractionation of GPI-APs with Octyl-Sepharose
3B2A, C10 (PGAP1 single-deficient), and DM1&2-C17 (PGAP1 and PGAP2 double-mutant) cells (5 x 107) were transfected with pME-Neo2dH-VSVGts-FF-mEGFP-GPI (Tashima et al., 2006
). Cells were cultured for half a day at 37°C followed by 1.5 d at 32°C and harvested. The cell pellets were lysed in 5 ml of lysis buffer (60 mM 1-octyl-
-D-glucoside and protease inhibitors in TBS-E) for 1 h at 4°C. After centrifugation at 15,000 rpm at 4°C for 15 min, the supernatants were incubated with M2 anti-FLAG beads overnight. The immunoprecipitates were washed twice with 0.5 ml of buffer (30 mM 1-octyl-
-D-glucoside in TBS-E), twice with 0.5 ml of buffer (20 mM Tris-HCl, pH 7.4, and 0.1% Nonidet P-40), and twice with 0.5 ml of buffer (20 mM Tris-HCl, pH 7.4, and 0.03% Nonidet P-40). FLAG-mEGFP-GPI was eluted with 100 µl of 0.1 M ammonium acetate containing 1 mg/ml FLAG-peptide (Sigma-Aldrich) and 0.03% Nonidet P-40 four times (total volume 400 µl). One hundred microliters of the eluate was mixed with 100 µl of buffer (0.1 M ammonium acetate, 0.03% Nonidet P-40, and 10% 1-propanol), loaded onto an octyl-FF column (GE Healthcare), and chromatographed in ÁKTA (GE Healthcare) at a flow rate of 0.5 ml/min by using a 540% gradient of 1-propanol. Fractions of 0.7 ml were collected, dried, and subjected to SDS-PAGE/Western blotting by using M2 antibody against FLAG-tag followed by HRP-conjugated anti-mouse IgG antibody.
| RESULTS |
|---|
|
|
|---|
|
|
|
-actin as an internal control, the amount of PGAP3 transcript in DM2&3-C2 was assessed to be <20% of that in GD3S-C37 (Figure 3D). By sequencing full-length RT-PCR products, we found a 19-base pair insertion (TCCTGTCTGTCTGTTTCAG) after the 60th amino acid that caused frame shift followed by appearance of immature stop codon closely downstream of this site. The last 15 base pairs of this insertion were almost the same as sequence of mouse PGAP3 intron 1 acceptor site (GTTTGTCTGTTTCAG; Evidence Viewer, National Center for Biotechnology Information, Bethesda, MD), indicating the presence of splicing defect between exons 1 and 2. Moreover, we detected other minor but abnormal PGAP3 transcripts in DM2&3-C2 by RT-PCR around exons 1 and 2 junction with primer set A, which may reflect aberrant splicing (Figure 3E, asterisks). Thus, these results indicated that PGAP3 was the gene responsible for the second mutation.
Immunofluorescent microscopic analysis of HA-tagged PGAP3 expressed in CHO cells revealed its main localization in the Golgi with weaker staining of punctate unidentified organelle and the ER (Figure 3F). Together with the previous report that PGAP2 is localized mainly to the Golgi (Tashima et al., 2006
), it is suggested that the fatty acid remodeling most likely occurs in the Golgi. This is in contrast to two other examples of fatty acid remodeling of GPI known to occur in the ER in bloodstream form of T. brucei (Morita et al., 2000
) and S. cerevisiae (Sipos et al., 1997
; Bosson et al., 2006
). Two proteins, Per1p (Fujita et al., 2006a
) and Gup1p (Sipos et al., 1997
; Bosson et al., 2006
), in yeast, which are involved in removal of sn-2 chain and incorporation of C26:0 chain, respectively, are localized to the ER.
A Defect in PGAP1 Inhibits Fatty Acid Remodeling Mediated by PGAP3 and PGAP2
We also obtained a different kind of double-mutant cell line with restored surface expression of GPI-APs from C84 and another line from PGAP2-deficient AM-B cells (Tashima et al., 2006
). We found that the surface GPI-APs on these double-mutant cells were resistant to PI-PLC (Figure 4Ad), indicating that the PGAP1 gene (Tanaka et al., 2004
) was defective, in addition to PGAP2. Moreover, these double-mutant clones, termed DM1&2-C14 and -C17 (data not shown), became like a PGAP2-single mutant after transfection of PGAP1 (Figure 4Ae). PGAP1 is the inositol-deacylase that removes palmitic acid linked to inositol in GPI before GPI-APs exit from the ER (Tanaka et al., 2004
). The palmitoylated inositol renders GPI-APs resistant to PI-PLC. That the defect in PGAP1 restored the surface expression of GPI-APs indicated either that elimination of palmitic acid from inositol is required for the subsequent removal of unsaturated sn-2 chain (three lipid chains remained); that removal of sn-2 chain occurs, but the presence of inositol-linked palmitoyl chain inhibited the action of the PLD that cleaves off the proteins (two lipid chains remained); or that PLD cleaves GPI, but the proteins are still attached to the membrane via palmitic acid (one lipid chain remained). To determine the number of chains linked to GPI-APs in DM1&2-C17 cells, we used hydrophobic chromatography with octyl-Sepharose, with which lyso GPI-AP (one lipid chain) was nicely separated from two-lipid-chain GPI-AP (Tashima et al., 2006
). With a gradient concentration of 1-propanol, FLAG-mEGFP-GPI, a model GPI-AP from DM1&2-C17 cells, was reproducibly eluted in fractions 1620 (Figure 4Bc) like three-chained FLAG-mEGFP-GPI from PGAP1-deficient cells (Figure 4Bb), whereas the same GPI-APs from wild-type cells bearing two lipid chains was eluted earlier in fractions 1518 (Figure 4Ba), indicating that surface GPI-APs expressed on DM1&2-C17 had three lipid chains. Our attempt to directly analyze the lipid moiety by liquid chromatography-MS/MS has not been successful due to inability to recover inositol-acylated PI after nitrous acid deamination of GPI-AP. There are reports that inositol-acylated acetylcholine esterase (Roberts et al., 1988
) and CD59 from human erythrocytes (Rudd et al., 1997
), and CD52 from spleen cells (Treumann et al., 1995
) had a highly unsaturated fatty acid at sn-2 position. Together, we conclude that inositol-deacylation is an essential step in fatty acid remodeling.
|
| DISCUSSION |
|---|
|
|
|---|
|
Recent several reports, including the present report, have revealed components and their functions in the lipid remodeling in yeast and mammalian cells. There are similarity and difference between two systems. First, homologous components are used. PGAP3 in mammalian system and PER1p (Fujita et al., 2006a
) in yeast are involved in generation of lyso-GPI-APs. PGAP3 and PER1p are functionally interchangeable between both species. PGAP3 does not have a lipase-like motif but has several serine and histidine residues that are conserved in active sites of PLA2 family (Fujita et al., 2006a
). It is clear that PGAP3 is required for PLA2 activity; however, we still do not know whether PGAP3 is an enzyme itself or a factor that regulates the enzyme activity. A sequence homologue of PGAP2 (Tashima et al., 2006
) in yeast is CWH43p (Martin-Yken et al., 2001
). The yeast mutant cwh43-2, originally isolated for its Calcofluor White hypersensitivity, shows several cell wall defects, which notably include increased release of Cwp1p, a GPI-AP (Martin-Yken et al., 2001
) as seen in our PGAP2-deficient CHO cells (Tashima et al., 2006
). Because many GPI-APs, such as Cwp1p, Cwp2p, Gas1p, and Dcw1p, are involved in yeast cell wall biogenesis (Kitagaki et al., 2002
), we assume that such cell wall defects are caused by aberrant biogenesis of GPI-APs due to defective remodeling, although precise involvement of CWH43p is yet to be determined. PGAP2 does not have any known motif or domain, and its precise function is currently under investigation. PGAP1 (Tanaka et al., 2004
) and the yeast homologue Bst1p (Fujita et al., 2006b
) are deacylases of an acyl chain linked to inositol of GPI in the ER, and they are required for subsequent remodeling in both species. Yeast Gup1p belongs to membrane-bound O-acyl transferase family and is required for the addition of C26 fatty chain to the sn-2 position (Bosson et al., 2006
). Although mammalian acyltransferase for the remodeling has not been identified, several mammalian proteins belong to this family, and one of them may function in the remodeling.
Second, both systems use the particular fatty acid for the replacement, i.e., C18:0 fatty acid in CHO cells and C26:0 in yeast, indicating that acyltransferases have narrow substrate specificities, yet the possibility that only particular lipids are available in the lumen of the ER/Golgi has not been excluded.
Third, in CHO cells the remodeling is thought to take place mainly in the Golgi, based on the localization of PGAP2 (Tashima et al., 2006
) and PGAP3, although we cannot exclude the possibility that it dose occur in the ER, whereas in yeast the ER is the main site of the remodeling (Bosson et al., 2006
; Fujita et al., 2006b
). Although determination of PI structure in mammalian GPI-APs still in the ER is necessary for more precise localization of the site of the remodeling, it is not practical at the moment to collect an enough amount of ER-form of GPI-APs for lipid chain analysis. It is interesting to notice that the integration of GPI-APs into rafts also takes place in the same compartments where GPI-APs undergo the remodeling, the ER in yeast (Bagnat et al., 2000
) and the Golgi in mammals (Brown and Rose, 1992
). The observation that GPI-APs before the remodeling associate very weakly with rafts puts a concern about the theory that lipid rafts are formed in the Golgi in mammalian cells, because the theory is based upon both the fact that GPI-APs become competent for the recovery into detergent resistant membranes in the Golgi during their transports and an assumption that GPI-APs are always integrated into rafts if rafts are present there. Now, we have another possibility that lipid rafts are formed in earlier organelles such as ER, but that only GPI-APs that undergo the remodeling in the Golgi are able to associate with rafts. Our separate study demonstrated that GPI-APs expressed in PGAP1 mutants have considerable affinity for lipid rafts, although weaker, compared with those expressed in wild-type cells, as judged by conventional DRM fractionation method (Maeda and Kinoshita, unpublished observation). As the lipid structure of GPI-APs in PGAP1 mutant cells are unchanged through all the way from the ER to the cell surface, PGAP1 mutant cells will be useful to reevaluate where lipid rafts are formed.
Fourth, the transport of Gas1p from the ER to the Golgi was substantially delayed in per1-deleted yeast (Ng et al., 2000
; Fujita et al., 2006b
), whereas we did not observe significant transport delay of GPI-APs from the ER to the surface in CHO DM2&3-C2 cells (Maeda and Kinoshita, our unpublished observation). It is suggested that the raft association may be required for the efficient exit from the ER in yeast but may not be required for exit from the Golgi in mammalian cells. Because the defect of either PGAP1 (Tanaka et al., 2004
) or Bst1p (Elrod-Erickson and Kaiser, 1996
; Fujita et al., 2006b
) similarly caused the delayed transport of GPI-APs from the ER to the Golgi, the ER may more strictly regulate the sorting to exit site or transport vesicles than the Golgi.
GPI-APs on human erythrocytes, such as acetylcholine esterase (Roberts et al., 1988
) and CD59 (Rudd et al., 1997
), and CD52 on a population of spleen cells (Treumann et al., 1995
), maintain inositol-linked palmitate on the cell surface, presumably due to an insufficient activity of PGAP1. Interestingly, such GPI-APs had a highly unsaturated lipid chain at the sn-2 position, indicating that fatty acid remodeling was also affected in these molecules. The results obtained from the analysis of PGAP1&2 double-mutant cells in this study was compatible with these known GPI structures, indicating that inositol deacylation by PGAP1 is an essential step in fatty acid remodeling.
Finally, raft disrupting reagents have been commonly used to study biological significance of the raft association of GPI-APs, but such reagents may exert side effects. Genetic manipulation of fatty acid remodeling should be useful in studying the function of rafts on sorting of and signaling from GPI-APs.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Taroh Kinoshita (tkinoshi{at}biken.osaka-u.ac.jp)
Abbreviations used: AP, anchored protein; CHO, Chinese hamster ovary; DAF, decay accelerating factor; DRM, detergent-resistant membrane; ER, endoplasmic reticulum; PGAP, post-GPI-attachment to proteins; PI, phosphatidylinositol; PLA, phospholipase A
| REFERENCES |
|---|
|
|
|---|
Benting, J., Rietveld, A., Ansorge, I., Simons, K. (1999). Acyl and alkyl chain length of GPI-anchors is critical for raft association in vitro. FEBS Lett 462, 4750.[CrossRef][Medline]
Bosson, R., Jaquenoud, M., Conzelmann, A. (2006). GUP1 of Saccharomyces cerevisiae encodes an O-acyltransferase involved in remodeling of the GPI anchor. Mol. Biol. Cell 17, 26362645.
Brewis, I. A., Ferguson, M. A., Mehlert, A., Turner, A. J., Hooper, N. M. (1995). Structures of the glycosyl-phosphatidylinositol anchors of porcine and human renal membrane dipeptidase. Comprehensive structural studies on the porcine anchor and interspecies comparison of the glycan core structures. J. Biol. Chem 270, 2294622956.
Brown, D. A. and Rose, J. K. (1992). Sorting of GPI-anchored proteins to glycolipid-enriched membrane subdomains during transport to the apical cell surface. Cell 68, 533544.[CrossRef][Medline]
Elrod-Erickson, M. J. and Kaiser, C. A. (1996). Genes that control the fidelity of endoplasmic reticulum to Golgi transport identified as suppressors of vesicle budding mutations. Mol. Biol. Cell 7, 10431058.[Abstract]
Ferguson, M. A. (1999). The structure, biosynthesis and functions of glycosylphosphatidylinositol anchors, and the contributions of trypanosome research. J. Cell Sci 112, 27992809.[Abstract]
Fontaine, T., Magnin, T., Melhert, A., Lamont, D., Latge, J. P., Ferguson, M. A. (2003). Structures of the glycosylphosphatidylinositol membrane anchors from Aspergillus fumigatus membrane proteins. Glycobiology 13, 169177.
Fujita, M., Umemura, M., Yoko-o, T., Jigami, Y. (2006a). PER1 is required for GPI-phospholipase A2 activity and involved in lipid remodeling of GPI-anchored proteins. Mol. Biol. Cell 17, 52535264.
Fujita, M., Yoko, O. T., Jigami, Y. (2006b). Inositol deacylation by Bst1p is required for the quality control of glycosylphosphatidylinositol-anchored proteins. Mol. Biol. Cell 17, 834850.
Hancock, J. F. (2006). Lipid rafts: contentious only from simplistic standpoints. Nat. Rev. Mol. Cell Biol 7, 456462.[CrossRef][Medline]
Harder, T. and Simons, K. (1997). Caveolae, DIGs, and the dynamics of sphingolipid-cholesterol microdomains. Curr. Opin. Cell Biol 9, 534542.[CrossRef][Medline]
Ikezawa, H. (2002). Glycosylphosphatidylinositol (GPI)-anchored proteins. Biol. Pharm. Bull 25, 409417.[CrossRef][Medline]
Kerwin, J. L., Tuininga, A. R., Ericsson, L. H. (1994). Identification of molecular species of glycerophospholipids and sphingomyelin using electrospray mass spectrometry. J. Lipid Res 35, 11021114.[Abstract]
Kitagaki, H., Wu, H., Shimoi, H., Ito, K. (2002). Two homologous genes, DCW1 (YKL046c) and DFG5, are essential for cell growth and encode glycosylphosphatidylinositol (GPI)-anchored membrane proteins required for cell wall biogenesis in Saccharomyces cerevisiae. Mol. Microbiol 46, 10111022.[CrossRef][Medline]
Lichtenberg, D., Goni, F. M., Heerklotz, H. (2005). Detergent-resistant membranes should not be identified with membrane rafts. Trends Biochem. Sci 30, 430436.[CrossRef][Medline]
Marquardt, T., Shirasaki, R., Ghosh, S., Andrews, S. E., Carter, N., Hunter, T., Pfaff, S. L. (2005). Coexpressed EphA receptors and ephrin-A ligands mediate opposing actions on growth cone navigation from distinct membrane domains. Cell 121, 127139.[CrossRef][Medline]
Martin-Yken, H., Dagkessamanskaia, A., De Groot, P., Ram, A., Klis, F., Francois, J. (2001). Saccharomyces cerevisiae YCRO17c/CWH43 encodes a putative sensor/transporter protein upstream of the BCK2 branch of the PKC1-dependent cell wall integrity pathway. Yeast 18, 827840.[CrossRef][Medline]
McConville, M. J. and Ferguson, M. A. (1993). The structure, biosynthesis and function of glycosylated phosphatidylinositols in the parasitic protozoa and higher eukaryotes. Biochem. J 294, 305324.[Medline]
Melkonian, K. A., Ostermeyer, A. G., Chen, J. Z., Roth, M. G., Brown, D. A. (1999). Role of lipid modifications in targeting proteins to detergent-resistant membrane rafts. Many raft proteins are acylated, while few are prenylated. J. Biol. Chem 274, 39103917.
Moffett, S., Brown, D. A., Linder, M. E. (2000). Lipid-dependent targeting of G proteins into rafts. J. Biol. Chem 275, 21912198.
Morita, Y. S., Paul, K. S., Englund, P. T. (2000). Specialized fatty acid synthesis in African trypanosomes: myristate for GPI anchors. Science 288, 140143.
Ng, D. T., Spear, E. D., Walter, P. (2000). The unfolded protein response regulates multiple aspects of secretory and membrane protein biogenesis and endoplasmic reticulum quality control. J. Cell Biol 150, 7788.
Paladino, S., Sarnataro, D., Pillich, R., Tivodar, S., Nitsch, L., Zurzolo, C. (2004). Protein oligomerization modulates raft partitioning and apical sorting of GPI-anchored proteins. J. Cell Biol 167, 699709.
Raza Shaikh, S., Dumaual, A. C., LoCassio, D., Siddiqui, R. A., Stillwell, W. (2003). Acyl chain unsaturation in PEs modulates phase separation from lipid raft molecules. Biochem. Biophys. Res. Commun 311, 793796.[CrossRef][Medline]
Redman, C. A., Thomas-Oates, J. E., Ogata, S., Ikehara, Y., Ferguson, M. A. (1994). Structure of the glycosylphosphatidylinositol membrane anchor of human placental alkaline phosphatase. Biochem. J 302, 861865.[Medline]
Ritter, T. E., Fajardo, O., Matsue, H., Anderson, R. G., Lacey, S. W. (1995). Folate receptors targeted to clathrin-coated pits cannot regulate vitamin uptake. Proc. Natl. Acad. Sci. USA 92, 38243828.
Roberts, W. L., Myher, J. J., Kuksis, A., Low, M. G., Rosenberry, T. L. (1988). Lipid analysis of the glycoinositol phospholipid membrane anchor of human erythrocyte acetylcholinesterase. Palmitoylation of inositol results in resistance to phosphatidylinositol-specific phospholipase C. J. Biol. Chem 263, 1876618775.
Rudd, P. M., Morgan, B. P., Wormald, M. R., Harvey, D. J., van den Berg, C. W., Davis, S. J., Ferguson, M. A., Dwek, R. A. (1997). The glycosylation of the complement regulatory protein, human erythrocyte CD59. J. Biol. Chem 272, 72297244.
Sabharanjak, S., Sharma, P., Parton, R. G., Mayor, S. (2002). GPI-anchored proteins are delivered to recycling endosomes via a distinct cdc42-regulated, clathrin-independent pinocytic pathway. Dev. Cell 2, 411423.[CrossRef][Medline]
Schroeder, R., London, E., Brown, D. (1994). Interactions between saturated acyl chains confer detergent resistance on lipids and glycosylphosphatidylinositol (GPI)-anchored proteins: GPI-anchored proteins in liposomes and cells show similar behavior. Proc. Natl. Acad. Sci. USA 91, 1213012134.
Shenoy-Scaria, A. M., Kwong, J., Fujita, T., Olszowy, M. W., Shaw, A. S., Lublin, D. M. (1992). Signal transduction through decay-accelerating factor. Interaction of glycosyl-phophatidylinositol anchor and protein tyrosine kinases p56lck and p59fyn1. J. Immunol 149, 35353541.[Abstract]
Simons, K. and Ikonen, E. (1997). Functional rafts in cell membranes. Nature 387, 569572.[CrossRef][Medline]
Simons, K. and Toomre, D. (2000). Lipid rafts and signal transduction. Nat. Rev. Mol. Cell Biol 1, 3139.[CrossRef][Medline]
Sipos, G., Reggiori, F., Vionnet, C., Conzelmann, A. (1997). Alternative lipid remodelling pathways for glycosylphosphatidylinositol membrane anchors in Saccharomyces cerevisiae. EMBO J 16, 34943505.[CrossRef][Medline]
Taguchi, R., Houjou, T., Nakanishi, H., Yamazaki, T., Ishida, M., Imagawa, M., Shimizu, T. (2005). Focused lipidomics by tandem mass spectrometry. J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci 823, 2636.[CrossRef][Medline]
Tanaka, S., Maeda, Y., Tashima, Y., Kinoshita, T. (2004). Inositol deacylation of glycosylphosphatidylinositol-anchored proteins is mediated by mammalian PGAP1 and yeast Bst1p. J. Biol. Chem 279, 1425614263.
Tansey, M. G., Baloh, R. H., Milbrandt, J., Johnson, E. M. Jr. (2000). GFRalpha-mediated localization of RET to lipid rafts is required for effective downstream signaling, differentiation, and neuronal survival. Neuron 25, 611623.[CrossRef][Medline]
Tashima, Y., Taguchi, R., Murata, C., Ashida, H., Kinoshita, T., Maeda, Y. (2006). PGAP2 is essential for correct processing and stable expression of GPI-anchored proteins. Mol. Biol. Cell 17, 14101420.
Treumann, A., Lifely, M. R., Schneider, P., Ferguson, M. A. (1995). Primary structure of CD52. J. Biol. Chem 270, 60886099.
Wong, Y. W. and Low, M. G. (1992). Phospholipase resistance of the glycosyl-phosphatidylinositol membrane anchor on human alkaline phosphatase. Clin. Chem 38, 25172525.
Zhang, J., Pekosz, A., Lamb, R. A. (2000). Influenza virus assembly and lipid raft microdomains: a role for the cytoplasmic tails of the spike glycoproteins. J. Virol 74, 46344644.
This article has been cited by other articles:
![]() |
T. Kinoshita, M. Fujita, and Y. Maeda Biosynthesis, Remodelling and Functions of Mammalian GPI-anchored Proteins: Recent Progress J. Biochem., September 1, 2008; 144(3): 287 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Umemura, M. Fujita, T. Yoko-o, A. Fukamizu, and Y. Jigami Saccharomyces cerevisiae CWH43 Is Involved in the Remodeling of the Lipid Moiety of GPI Anchors to Ceramides Mol. Biol. Cell, November 1, 2007; 18(11): 4304 - 4316. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ueda, R. Yamaguchi, M. Ikawa, M. Okabe, E. Morii, Y. Maeda, and T. Kinoshita PGAP1 Knock-out Mice Show Otocephaly and Male Infertility J. Biol. Chem., Oc |