![]() |
|
|
Vol. 18, Issue 5, 1943-1952, May 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Anatomy, University of California, San Francisco, CA 94158-2517
Submitted September 18, 2006;
Revised February 6, 2007;
Accepted February 26, 2007
Monitoring Editor: Ben Margolis
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Although the molecular mechanisms controlling EMT have only recently begun to emerge, key roles have been identified for the zinc finger transcription factors Snail (Snail1) and Slug (Snail2; Savagner, 2001
; Huber et al., 2005
). Slug was discovered in the chick as a key regulator of mesoderm formation and neural crest migration, two developmental processes involving EMT (Nieto et al., 1994
). In the mouse, Snail fulfills some of the functions that Slug has during chick development (Sefton et al., 1998
; Nieto, 2002
). In cell culture experimental overexpression of Slug or Snail is sufficient to induce epithelial cells to undergo EMT (Savagner et al., 1997
; Batlle et al., 2000
; Cano et al., 2000
; Bolos et al., 2003
). Importantly, their expression is up-regulated in various epithelial cells (including Madin-Darby canine kidney [MDCK]) by growth factors that typically induce EMT such as transforming growth factor (TGF)
and fibroblast growth factor (FGF; Savagner et al., 1997
; Romano and Runyan, 2000
; Peinado et al., 2003
). Slug and Snail can directly repress the transcription of the E-cadherin gene by binding to E-Box sequences within its promoter (Batlle et al., 2000
; Cano et al., 2000
; Bolos et al., 2003
). Their role as inducers of EMT is partly due to the direct repression of E-cadherin expression that destabilizes cellcell adhesion, a phenomenon necessary for cell migration. This role is supported by the correlation observed in various invasive carcinomas between Slug or Snail expression and loss of E-cadherin transcription (Blanco et al., 2002
; Shih et al., 2005
; Uchikado et al., 2005
). Slug and Snail have additional functions associated with their role as triggers of EMT. Concomitantly with the induction of EMT, Snail expression can confer survival properties to the cells (Valdes et al., 2002
; Vega et al., 2004
; Robson et al., 2006
). Slug has a critical role in re-epithelialization of cutaneous wounds in mice and has been proposed to be required for cell extension movement (Savagner et al., 2005
). However, the process of re-epithelialization involves migration but does not require a full EMT.
Although the role of Slug and Snail as inducers of EMT start to be well understood, their implication in processes that do not require a complete EMT has been far less studied. One experimentally tractable model of how p-EMT is used during epithelial morphogenesis is the formation of tubules by MDCK epithelial cells. When MDCK cells are cultured in a three-dimensional (3D) gel of extracellular matrix (ECM), they form hollow spheres or cysts consisting of a monolayer of fully polarized cells, with their apical surfaces facing a central lumen and their basal surfaces contacting the ECM. Stimulation of these cysts with hepatocyte growth factor (HGF) causes the cysts to elaborate branching tubules, recapitulating some aspects of tubulogenesis in vivo (Montesano et al., 1991
; Pollack et al., 1998
; O'Brien et al., 2002
; O'Brien et al., 2004
). The first phase of MDCK tubulogenesis involves p-EMT. In the initial substep of this p-EMT phase, a subset of the fully polarized cells produce extensions of their basal surface, which radiate outward from the cyst. Although this involves cell movement, the epithelial cells at this point still retain some features of apico-basal polarity. In the second substep of the p-EMT phase, some of these cells migrate entirely away from the cyst wall, completely losing their apical surface and thus apico-basal polarity. These cells form chains of cells that retain some cellcell junctions and do not acquire full mesenchymal characteristics at any point. In the second phase of tubulogenesis, the cells redifferentiate into fully polarized epithelial cells and form tubules with lumens.
Here we have used the 3D MDCK tubulogenesis system to examine the expression and function of endogenous Slug in a process involving a p-EMT. Although the studies of Slug and Snail obtained either from embryonic systems or from classic 2D culture models have provided important insight into Slug and Snail, this 3D model provides a physiologically more relevant cell environment than classic 2D culture, while permitting the analysis of cellular and molecular mechanisms with much greater spatial and temporal resolution than is typically attainable in vivo.
We report that Slug is highly and transiently up-regulated by HGF during the p-EMT phase of MDCK tubulogenesis. However, HGF-induced Slug expression is not necessary for initiation of cell movement during tubulogenesis. Rather, the first detectable role of Slug is that it is required for the cells to survive during the p-EMT phase of tubulogenesis. Our work reveals that Slug's survival function in epithelial cells can precede EMT rather than being acquired concomitantly to complete EMT and is the primary function of Slug during p-EMT. Our data also show that MDCK tubulogenesis requires a specific factor promoting cell survival, even though cell death was previously not known to play a major role in this epithelial remodeling and morphogenetic process.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture
MDCK cells were maintained in minimal essential medium (MEM) Eagle's with Earle's balanced salt solution (Mediatech Cellgro, Herndon, VA) supplemented with 5% fetal bovine serum (FBS; Hyclone, Logan, UT), 100 U/ml penicillin, and 100 mg/ml streptomycin in 5% CO2, 95% air. MDCK T23T.1 cells were obtained from T. S. Jou (National Taiwan University, Tapei) and were maintained as described for MDCK with addition of 150 µg/ml zeocin.
Growth of cysts in 3D collagen type I gels was performed as described previously (Pollack et al., 1998
) with the following modifications. Briefly, cells were trypsinized into a single-cell suspension, centrifuged, and mixed to a type I collagen solution containing 66% Vitrogen 100 (3 mg/ml; Cohesion, Palo Alto, CA). Cells (n = 20004000) mixed with 150 µl of collagen solution were plated on the top of a cell-free gelled collagen layer onto anopore membrane filters with a 10-mm diameter and 0.2-µm pore size (Nunc). The collagen mixture was allowed to gel at 37°C, and then medium was added. Cells were fed every 23 d and grown for 910 d until cysts with lumen were formed. To induce tubulogenesis, MDCK cysts were treated by addition of HGF to the medium at the indicated concentration during the indicated time.
RNA Extraction and Relative and Quantitative RT-PCR Analysis
Cysts embedded in collagen were rinsed with phosphate-buffered saline (PBS) and homogenized in lysis buffer (Qiagen, Chatsworth, CA) using a homogenizer. The homogenate was treated with 200 µg/ml Proteinase K (Qiagen) for 30 min at 55°C before RNA extraction. Total RNA were extracted on columns using the RNeasy Mini kit (Qiagen). DNase I treatment was done directly on the column. 0.51 µg of total RNA were reverse-transcribed as previously described (Leroy et al., 2004
). Relative RT-PCR was done as previously described with the internal standard and the specific gene studied amplified in the same tube (Leroy et al., 2004
). The yield of cDNA was normalized using the expression of the gene coding for Gapdh as an internal standard. Linear amplification ranges were tested and experiments were done with 28 cycles for Slug and 23 cycles for Gapdh. The volume of each cDNA sample was adjusted to give the same PCR signal strength for Gapdh after 2224 cycles, i.e., in its linear amplification range. The expected fragment (358 base pairs for Slug and 271 base pairs for Gapdh) were visualized on a 2% agarose gel. Quantitative RT-PCR was done using SYBR green PCR master mix (Applied Biosystems, Foster City, CA) and the Mx4000 multiplex quantitative PCR system and software (Stratagene, La Jolla, CA).
Annealing was at 59°C and primers used were as follows: for Slug: Forward primer: 5' AGCAGTTGCACTGTGATGCC 3', Reverse primer: 5' ACACAGCAGCCAGATTCCTC 3'; for E-cadherin : Forward primer 5' GAGAGCGGTGGTCAAAGAGC 3', Reverse primer: 5' GAGGAGTTCAGGGAGCTCAG 3', for Snail: Forward primer: 5' TGCCCTCAAGATGCACATCC 3', Reverse primer: 5' TGACATCTGAGTGGGTCTGC 3'; for p53 : Forward primer 5' TGTGGTGGTGCCTTATGAGC 3', Reverse primer: 5' ATGGCGAGAGGTAGATTGCC 3'; for Bid : Forward primer 5' AGCTACTTCCTGGATGGTGG 3', Reverse primer: 5' CATAGGTGAGCAGGTTCTGG 3'; for Gapdh : Forward primer 5' CAGTTGTGGATCTGACCTGC 3', Reverse primer: 5' CCTTGGAGGCCATGTAGACC 3'.
Generation of Stable MDCK Transfectants
The cloning and sequencing of the canine Slug cDNA is described in supplemental experimental procedures. Slug antisense construct was generated by inserting a 5'XbaI-3'BamHI fragment corresponding to the full-length Slug CDS excised from a pBluescript-Slug construct in the pIND(SP1) ecdysone-inducible vector (Invitrogen, Carlsbad, CA). MDCK T23T.1 cells (Lai et al., 2003
) were cotransfected with this construct and a blasticidin-resistant gene using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen). Stable transfectants were isolated after 23 wk of culture in the selective medium. Different transfectant clones were selected that show a knockdown of Slug transcripts specifically when the inducer ponasterone A (Invitrogen) is added.
Immunoblotting
Cysts were isolated from collagen by treatment with 4000 U/ml collagenase type IV (Worthington, Lakewood, NJ). Isolated cysts were rinsed with PBS, lysed with 1% sodium dodecyl sulfate (SDS) solution, boiled and shaken for 5 min. The protein concentration in the lysates was determined using a BCA protein assay (Pierce). Samples were run on SDS-page gels, electrotransferred to immobilon-P membrane (Millipore, Bedford, MA). Blots were blocked and hybridized in 0.05% tween in PBS (PBST) containing 5% milk, washed with PBST, and revealed with detection reagent (Amersham Biosciences, Piscataway, NJ). Gapdh was used as an internal marker to normalize protein amounts between samples. Quantification was done using Quantity one software (Bio-Rad, Richmond, CA).
Immunofluorescence Staining
Immunofluorescence staining of cysts cultured in collagen gel was done as previously described (Pollack et al., 1998
; O'Brien et al., 2001
) with some modifications. Briefly, samples were rinsed with PBS before treatment with collagenase type VII (Sigma, St. Louis, MO) at 37°C for 10 min and fixed with 4% paraformaldehyde in PBS for 30 min at 4°C. Samples were rinsed with PBS, permeabilized with 0.2% Triton X-100 in PBS for 10 min, and permeabilized and blocked with 0.7% fish gelatin (Sigma) and 0.025% saponin in PBS for 30 min. Samples were then incubated in primary antibodies at 4°C overnight and extensively washed. Samples were incubated at RT for a minimum of 4 h with the corresponding Alexa Fluorconjugated secondary antibody at a dilution of 1:300 and Alexa Fluor phalloidin and Hoechst (1:1000 each) then washed extensively. All incubations and washing were done with the blocking solution. Samples were rinsed with PBS before be mounted using ProLong gold (Invitrogen). MDCK monolayer on filter were similarly processed but with shorter times of incubation and lower concentration of antibodies or dyes (Alexa Fluorconjugated secondary antibody at a dilution of 1:600 and Alexa Fluor phalloidin and Hoechst; 1:3000 each).
Image Analysis
Cysts were analyzed for immunofluorescence using a Zeiss 510 LSM confocal microscope (Thornwood, NY). Samples were viewed using an argon laser (488 line) and helium-neon lasers (543 and 633 lines) and a 2-photon 780 in conjunction with a Zeiss 510 confocal laser scan head attached to a Zeiss Axiovert 200M microscope. Digital images of optical sections were collected with a Zeiss Plan Apo 63x 1.40 NA objective. Images were analyzed using LSM 510 software and resized with Adobe Photoshop 8 software (San Jose, CA).
RESULTS
Slug mRNA Levels Are Transiently Up-regulated in MDCK Cysts by HGF during the p-EMT Phase of Tubulogenesis
In 2D culture, Slug and Snail have been shown to be up-regulated at the transcriptional level in different cell types by EMT-inducing growth factors such as FGF and TGF
. To determine if these genes are up-regulated during the p-EMT phase of HGF-induced MDCK tubulogenesis, we analyzed their mRNA expression during a time course of HGF stimulation of cysts. As described previously 10 ng/ml HGF is the optimal concentration to induce MDCK tubulogenesis (O'Brien et al., 2004
). Under these conditions extensions are first seen after
6 h of HGF treatment; chains appear at the earliest after 9 h, but most of the chains start to form by 1216 h (Figure 1). By 24 h of treatment the p-EMT phase has ended, and the redifferentiation phase of tubulogenesis begins. Although a certain degree of asynchrony is observed, the majority of the cysts follow the time frame presented in Figure 1. Using both relative and quantitative RT-PCR analysis, we found that Slug mRNA levels are highly up-regulated following HGF stimulation of cysts (Figure 2, A and B). We also observed an induction of Snail expression, which is much more modest than Slug as shown by quantitative RT-PCR analysis (Supplementary Figure S1) and confirmed this by Northern blot analysis (not shown). We therefore concentrated on Slug. Slug mRNA levels increase as much as five times within 6 h of HGF treatment as measured by quantitative RT-PCR, and this increase is maintained at 12 h. Notably, this up-regulation of mRNA is transient, with a significant decrease observed after 24 h of HGF exposure (Figure 2B).
|
|
Together these results show that Slug is highly and transiently up-regulated after HGF stimulation of MDCK cysts specifically during the time when cells undergo the p-EMT phase of tubulogenesis. This up-regulation occurs as an early response to HGF treatment and is HGF dose-dependent. However, we cannot conclude from our results that Slug mRNA levels are increasing by regulation at the transcriptional level, or alternatively by stabilization of the mRNA. HGF is involved in cancer and metastasis and is usually described as an inducer of EMT (Birchmeier et al., 2003
) and blocking Slug expression has been previously shown to interfere with the HGF pathway in NBTII bladder cells (Savagner et al., 1997
). However, regulation of Slug by HGF has not been reported previously, as far as we know.
Slug Protein Levels Are Specifically Up-regulated in the Nuclei of the Cells Forming Chains
To determine the expression of Slug protein in the treated cysts, we raised an anti-canine Slug antibody that recognizes Slug protein with high specificity both on Western blot and by immunofluorescence in 3D structures (described in Material and Methods and Supplementary Figure S2).
Slug protein levels were analyzed on total lysates extracted from MDCK cysts after different times of HGF treatment. After 6 h of treatment with 10 ng/ml HGF no significant increase in Slug protein is detectable (data not shown), and after 9 h a modest increase can be observed but not in all experiments performed. Slug protein levels are significantly increased after 16 h of treatment and return to baseline levels after 24 h (Figure 3A). With 50 ng/ml HGF, the increase in protein levels is higher, reaching as much as four times over Slug protein levels baseline, and still sustained at 24 h in accordance with the mRNA levels observed for the same high concentration of HGF (Figure 3B). The overall fold increase of the mRNA levels is clearly higher than for the protein levels with as much as 10x difference when 50 ng/ml HGF is used (Figure 2D). Furthermore, comparison of the kinetics of mRNA and protein induction reveals that the up-regulation of the mRNA precedes by several hours the appearance of the first extensions, whereas the detectable up-regulation of protein levels is only observed when formation of the first chains occurs (Figures 2, B and D, and 3, A and B).
|
Together these results show that both Slug mRNA and protein are up-regulated during the HGF-induced p-EMT phase of MDCK tubulogenesis. mRNA up-regulation is a very early event after HGF treatment. However, the nuclei of the cells in the cyst wall are all negative for Slug protein, whereas its expression is only detected in the nuclei of the cells that have started to form chains. Taken together our results suggests that Slug is not necessary for the induction of cell extensions, which is the initial substep of the p-EMT phase, but may have another specific function during this phase of tubulogenesis.
Slug Does Not Repress E-Cadherin Expression during the p-EMT Phase of Tubulogenesis
The well-established ability of the Snail family of transcription factors to directly repress the E-cadherin gene prompted us to determine if the up-regulation of Slug protein was accompanied by a concomitant repression of E-cadherin expression in our system. We first analyzed E-cadherin expression at the mRNA level using quantitative RT-PCR, and we surprisingly observed no decrease of E-cadherin mRNA for all times tested after treatment with 10 ng/ml HGF (Figure 4A). Indeed, on the contrary a small but statistically significant up-regulation of E-cadherin mRNA levels was observed after 12 h of HGF treatment even though Slug protein levels were increasing at this time (Figure 3A). E-cadherin up-regulation was transient and expression returned to initial levels at 24 h, i.e., when Slug protein levels also decreased. Furthermore with 50 ng/ml HGF, which induces higher expression of Slug protein, similar kinetics of up-regulation of E-cadherin mRNA were observed although with overall greater fold increases (Figure 4B). Western blot analysis of total lysates extracted from cysts treated under similar conditions shows that E-cadherin protein was not altered (Figure 4C).
|
These results suggest that Slug does not act as a repressor of E-cadherin expression during the p-EMT phase of MDCK tubulogenesis. Moreover, the similar kinetics of E-cadherin expression regardless of HGF concentration contrasts with the significant HGF-dose dependent expression of Slug and this further suggests that E-cadherin and Slug do not depend on each other at any detectable level of regulation.
Slug Is Necessary for the Survival of the Cells Forming Chains during the p-EMT of Tubulogenesis.
Our results show that during HGF-induced tubulogenesis Slug is specifically up-regulated in the nuclei of cells in chains, but does not repress E-cadherin in these cells. Furthermore, the fact that Slug is not detected in cells that have initiated p-EMT by forming extensions suggests that Slug does not act as an inducer of p-EMT. To further investigate the role of Slug in MDCK tubulogenesis, we sought to examine the consequences of loss of Slug expression during tubulogenesis. For this we needed to block Slug expression only after cysts were formed. As currently available inducible shRNA technology works poorly for MDCK cysts after 1012 d culture period, we pursued an antisense strategy analogous to that successfully used for other transcription factors, including Slug (Savagner et al., 1997
; Verrecchia et al., 2001
; Boudreau and Varner, 2004
; Kuphal et al., 2005
). Inducible expression of the antisense construct was conferred by a promoter whose expression is induced by ponasterone, an analog of ecdysone (Lai et al., 2003
).
First, we validated the efficiency and specificity of our approach to inducibly knock down Slug. MDCK cells stably transfected with Slug antisense were seeded in collagen and grown to form cysts without addition of the inducer. The cysts were then treated with HGF and simultaneously with ponasterone to induce expression of the Slug antisense. By quantitative RT-PCR analysis, we found that addition of ponasterone to the cysts treated with HGF inhibited the up-regulation of Slug mRNA by
50% after 6 h of treatment with HGF when compared with the level of up-regulation normally observed (Figure 5A). This inhibition was not observed when ponasterone was added to control cells showing that the inhibition is not due to a toxic effect of ponasterone (Figure 5A). We then confirmed that the inhibition of the up-regulation of Slug mRNA was reflected at the protein level. Figure 5B shows that Slug protein is not anymore up-regulated when ponasterone is added in combination with HGF, demonstrating that Slug protein is successfully knocked down.
|
We next analyzed the phenotypic effect of Slug knockdown. Slug knockdown cysts treated with HGF in presence of ponasterone were fixed and stained for actin and nuclei at different time points of the p-EMT phase for analysis by confocal microscopy. Appearance of normal cellular extensions from cysts was observed after HGF treatment despite Slug being knocked down, confirming that Slug is not required for the initial cell movement associated with p-EMT (Figure 6A). However, observation of later time points revealed that as a consequence of Slug knockdown, a large majority of cysts were subsequently devoid of chains, and this defect was not observed in the absence of ponasterone. Control cysts were not affected by the presence of ponasterone, confirming that the effect is due to Slug knockdown and not to a toxic effect of ponasterone (Figure 6, B and C). Quantification of the effect confirmed a marked reduction of cysts displaying chain formation; 17.5 ± 5.4% of the cysts had chains when Slug was knocked down compared with 73.5 ± 14.7% when ponasterone was not added, whereas control cysts have a similar percentage of cysts displaying chain formation in the presence or absence of ponasterone (Figure 6D).
|
P53 mRNA Expression Is Down-regulated during HGF-induced p-EMT Phase
In epithelial cells, Slug expression promotes resistance to programmed cell death elicited by DNA damage by directly repressing the transcription of factors known to be involved in programmed cell death, in particular the proapoptotic factors p53 and Bid (Kajita et al., 2004
). We then tested if in our model these factors were part of the downstream pathway of Slug and were repressed by Slug. Figure 7A shows that p53 mRNA levels were down-regulated after 16 h of HGF stimulation of cysts. In contrast, p53 mRNA levels were not changed when cysts were knockdown for Slug. However, Bid mRNA levels were not changed both in normal and Slug knockdown cysts (Figure 7B). Our results with p53 suggest that p53 is a direct target gene of Slug in our 3D system and that during the p-EMT of MDCK tubulogenesis, Slug acts as an anti-apoptotic factor by at least repressing p53 expression. In contrast to the work reported by Kajita et al. (2004)
, Bid mRNA levels were not observed to change in our system indicating that Bid is not a target gene of Slug in our system. This difference could reflect the fact that different downstream pathways are used, depending on the events that trigger programmed cell death.
|
| DISCUSSION |
|---|
|
|
|---|
A large body of evidence points to Slug as a key regulator of EMT, both from its ability to induce EMT and from its ability to repress the adhesion molecule E-cadherin and desmosomal components in various epithelial cells (Savagner et al., 1997
; Bolos et al., 2003
). These results are reinforced by a correlation in various epithelial cancer cells between Slug expression and loss of E-cadherin expression, a hallmark of invasive cells (Shih et al., 2005
; Uchikado et al., 2005
). In our MDCK 3D system, E-cadherin is not lost but rather is redistributed during the p-EMT phase of MDCK tubulogenesis (Pollack et al., 1998
). Our results show that this redistribution, which allows cells to migrate while remaining attached to their neighbors, is not accompanied by a decrease in E-cadherin levels despite high levels of Slug in the nuclei.
Slug has been recently reported to be involved in cell migration during re-epithelialization of adult keratinocytes, a process that also does not require full EMT. During this process, E-cadherin is not found repressed in cells expressing Slug but a functional relationship was observed between Slug expression and desmosome density. Although Slug is thought to repress the expression of some desmosomal components, there is no evidence that Slug is a direct repressor of desmosomal genes (Savagner et al., 1997
, 2005
). Dissociation of desmosomes is an initial and necessary step for these cells to start migrating. During extension formation in MDCK tubulogenesis, desmosomal components are also redistributed by internalization (Pollack et al., 1998
). However, Slug expression is induced several hours after the first cellular extensions are formed and extensions still form when Slug is knocked down, precluding a role for Slug in the dissolution of desmosomes during MDCK tubulogenesis.
We show that during MDCK tubulogenesis Slug is not involved in the induction of p-EMT. We also found an HGF-induced up-regulation of Snail mRNA levels with kinetics similar to that of Slug although Snail expression increases at much lower levels than Slug (Figure 5C and Supplementary Figure S1). However, Snail has been reported to be a more potent inducer of EMT and repressor of E-cadherin than Slug (Batlle et al., 2000
; Cano et al., 2000
). In addition the analogous role of Slug in chick neural crest migration is instead fulfilled in mammals by Snail (Sefton et al., 1998
). Because of the absence of available Snail antibodies that work in our system, we cannot rule out that Snail protein is expressed earlier than Slug protein and Snail may be the inducer of p-EMT. However, as E-cadherin expression is not repressed in our system, if Snail has a role in induction of p-EMT, it is also not as a repressor of E-cadherin.
Our work demonstrates a survival role for Slug during the p-EMT phase of MDCK tubulogenesis and suggests that Slug rescues the cells from apoptosis by repressing proapoptotic factors that otherwise would lead the cells to die during p-EMT. In our model, p53 is downstream of Slug, and this is in agreement with the work reported by Kajita et al. showing that in epithelial cells p53 is directly repressed by Slug rather than Slug being a downstream target of p53 as it has been demonstrated in mouse hematopoietic progenitor cells (Inoue et al., 2002
; Wu et al., 2005
). In addition, in our cells, we did not detect any expression of the proapoptotic factor Puma (data not shown), which is directly repressed by Slug in hematopoietic progenitor cells. Our results reinforce the differences already underlined by Kajita et al. between apoptotic pathways involved in epithelial cells and hematopoietic cells. We also cannot exclude that the factors involved in the apoptotic pathways are different also depending on what triggers apoptosis.
In epithelial cells, both Slug and Snail have a role as inducers of EMT but they have also been reported to confer survival properties to cells executing full EMT and suggested to be inducers of cell movement in some processes (Valdes et al., 2002
; Vega et al., 2004
; Savagner et al., 2005
; Robson et al., 2006
). Taken collectively, the data concerning the transcription factors of the Snail family in the animal kingdom lead to the interesting hypothesis that these factors could act primarily as survival factors and inducers of cell movement rather than as inducers of EMT (Barrallo-Gimeno and Nieto, 2005
). Recently, Slug/Snail have been proposed to be involved in survival of premigratory neural crest during development (Cheung et al., 2005
). Our work shows that Slug's primary function during MDCK tubulogenesis is cell survival, and we are able to dissociate this function from the initiation of cell movement. Slug knockout have been recently reported to block cell migration during re-epithelialization of keratinocytes (Savagner et al., 2005
), and it will be of interest to test if in that system Slug is also primarily involved in survival rather than in cell movement per se.
The link between cell survival and cell migration is particularly interesting in the context of the ECM as a large body of evidence emphasizes the importance of the ECM during morphogenesis (Boudreau and Bissell, 1998
; Bissell et al., 2002
). 3D culture models that integrate the complexity of multicellular architecture of cells embedded in ECM have proved important in unraveling the mechanisms involving modifications of cellcell and cellECM interactions during morphogenesis (O'Brien et al., 2002
; Debnath and Brugge, 2005
; Nelson and Bissell, 2005
). In our 3D model, Slug protein is only expressed in cells forming chains, which correlates with the replacement of cellcell contacts by cellECM interactions. In 2D cell culture, disruption of adherens junctions with an anti-E-cadherin antibody can lead to the induction of Slug expression showing that Slug expression can be a consequence of the disruption of cellcell interactions (Conacci-Sorrell et al., 2003
). Our 3D model reveals the importance of the control of cell survival during a process that involves migration. In contrast, Slug knock down does not result in apoptosis when tested in a scratch-wound healing assay (data not shown). This reinforces the idea that the Slug survival function may be required only in the context of migration within the 3D ECM environment; the MDCK tubulogenesis model provides a system to further investigate the relationship between Slug functions in survival and movement.
Our work also reveals that cell survival is the primary function of Slug in an EMT-related process. Slug or Snail confer survival properties that seems to be acquired by the cells concomitantly with full EMT (Valdes et al., 2002
; Vega et al., 2004
; Robson et al., 2006
). Our work suggests that Slug's survival function temporally precedes its role in inducing full EMT. The great majority of the work done on Slug and Snail in cell culture has used cancer cells or cells experimentally overexpressing Slug or Snail. Although these studies continue to provide new insights, such overexpression conditions could mask the primary function of these genes. It has been suggested recently that EMT is a sequential multistep program and that the loss of E-cadherin transcription, a hallmark of invasive cancer cells, is among the late steps of the process (Grunert et al., 2003
; Huber et al., 2005
). The fact that we find that both Slug and Snail are part of the HGF-induced genes during MDCK tubulogenesis supports this idea. The 3D MDCK tubulogenesis model allows us to follow the early steps of loss of epithelial polarity as cells are fully polarized in the cysts wall before HGF treatment, and this model provides access to the early steps of the EMT program. However, in this model EMT is controlled and cells never reach a full EMT. Given the multistep nature of EMT, we suggest that Slug (and Snail) may have different functions in different steps of EMT. In particular, in the steps reached by the cells during p-EMT in MDCK tubulogenesis, Slug appears to have primarily a survival function. In other steps of EMT or in full EMT, Slug may have other functions, such as an inducer of cell movement or a repressor of E-cadherin. This view provides an interesting framework to fully understand the function of these transcription factors and also implies that the Slug and Snail target genes may be different depending on the stage of EMT and other contextual factors. For instance in contexts where Slug or Snail are overexpressed and/or ectopically expressed in culture, they can be repressors of E-cadherin, desmosomal components, or other cellcell junction molecules and thus inducers of full EMT (Savagner et al., 1997
, 2005
; Batlle et al., 2000
; Bolos et al., 2003
; Cano et al., 2000
; Ikenouchi et al., 2003
, 2005
). Understanding what leads Slug or Snail to change from survival factors to inducers of cell movement or repressors of E-cadherin and other cellcell adherent molecules could be of major importance in understanding their role in pathologies such as cancer invasion and fibrosis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Pascale Leroy (pascale.leroy{at}ucsf.edu)
Abbreviations used: EMT, epithelial-mesenchymal transition; HGF, hepatocyte growth factor; p-EMT, partial epithelial-mesenchymal transition.
| REFERENCES |
|---|
|
|
|---|
Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J., Garcia De Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol 2, 8489.[CrossRef][Medline]
Birchmeier, C., Birchmeier, W., Brand-Saberi, B. (1996). Epithelial-mesenchymal transitions in cancer progression. Acta Anat. (Basel) 156, 217226.[Medline]
Birchmeier, C., Birchmeier, W., Gherardi, E., Vande Woude, G. F. (2003). Met, metastasis, motility and more. Nat. Rev. Mol. Cell Biol 4, 915925.[CrossRef][Medline]
Bissell, M. J., Radisky, D. C., Rizki, A., Weaver, V. M., Petersen, O. W. (2002). The organizing principle: microenvironmental influences in the normal and malignant breast. Differentiation 70, 537546.[CrossRef][Medline]
Blanco, M. J., Moreno-Bueno, G., Sarrio, D., Locascio, A., Cano, A., Palacios, J., Nieto, M. A. (2002). Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21, 32413246.[CrossRef][Medline]
Bolos, V., Peinado, H., Perez-Moreno, M. A., Fraga, M. F., Esteller, M., Cano, A. (2003). The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J. Cell Sci 116, 499511.
Boudreau, N. and Bissell, M. J. (1998). Extracellular matrix signaling: integration of form and function in normal and malignant cells. Curr. Opin. Cell Biol 10, 640646.[CrossRef][Medline]
Boudreau, N. J. and Varner, J. A. (2004). The homeobox transcription factor Hox D3 promotes integrin alpha5beta1 expression and function during angiogenesis. J. Biol. Chem 279, 48624868.
Cano, A., Perez-Moreno, M. A., Rodrigo, I., Locascio, A., Blanco, M. J., del Barrio, M. G., Portillo, F., Nieto, M. A. (2000). The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol 2, 7683.[CrossRef][Medline]
Cheung, M., Chaboissier, M. C., Mynett, A., Hirst, E., Schedl, A., Briscoe., J. (2005). The transcriptional control of trunk neural crest induction, survival, and delamination. Dev. Cell 8, 179192.[CrossRef][Medline]
Conacci-Sorrell, M., Simcha, I., Ben-Yedidia, T., Blechman, J., Savagner, P., Ben-Ze'ev, A. (2003). Autoregulation of E-cadherin expression by cadherin-cadherin interactions: the roles of beta-catenin signaling, Slug, and MAPK. J. Cell Biol 163, 847857.
Debnath, J. and Brugge, J. S. (2005). Modelling glandular epithelial cancers in three-dimensional cultures. Nat. Rev. Cancer 5, 675688.[CrossRef][Medline]
Grunert, S., Jechlinger, M., Beug, H. (2003). Diverse cellular and molecular mechanisms contribute to epithelial plasticity and metastasis. Nat. Rev. Mol. Cell Biol 4, 657665.[CrossRef][Medline]
Hay, E. D. (1995). An overview of epithelio-mesenchymal transformation. Acta Anat. (Basel) 154, 820.[Medline]
Huber, M. A., Kraut, N., Beug, H. (2005). Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr. Opin. Cell Biol 17, 548558.[CrossRef][Medline]
Ikenouchi, J., Furuse, M., Furuse, K., Sasaki, H., Tsukita, S., Tsukita, S. (2005). Tricellulin constitutes a novel barrier at tricellular contacts of epithelial cells. J. Cell Biol 171, 939945.
Ikenouchi, J., Matsuda, M., Furuse, M., Tsukita, S. (2003). Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J. Cell Sci 116, 19591967.
Inoue, A., et al. (2002). Slug, a highly conserved zinc finger transcriptional repressor, protects hematopoietic progenitor cells from radiation-induced apoptosis in vivo. Cancer Cell 2, 279288.[CrossRef][Medline]
Kajita, M., McClinic, K. N., Wade, P. A. (2004). Aberrant expression of the transcription factors Snail and Slug alters the response to genotoxic stress. Mol. Cell. Biol 24, 75597566.
Kalluri, R. and Neilson, E. G. (2003). Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Invest 112, 17761784.[CrossRef][Medline]
Kuphal, S., Palm, H. G., Poser, I., Bosserhoff, A. K. (2005). Snail-regulated genes in malignant melanoma. Melanoma Res 15, 305313.[CrossRef][Medline]
Lai, J. F., Juang, S. H., Hung, Y. M., Cheng, H. Y., Cheng, T. L., Mostov, K. E., Jou, T. S. (2003). An ecdysone and tetracycline dual regulatory expression system for studies on Rac1 small GTPase-mediated signaling. Am. J. Physiol. Cell Physiol 285, C711C719.
Leroy, P., Berto, F., Bourget, I., Rossi, B. (2004). Down-regulation of Hox A7 is required for cell adhesion and migration on fibronectin during early HL-60 monocytic differentiation. J. Leukoc. Biol 75, 680688.
Montesano, R., Schaller, G., Orci, L. (1991). Induction of epithelial tubular morphogenesis in vitro by fibroblast-derived soluble factors. Cell 66, 697711.[CrossRef][Medline]
Nelson, C. M. and Bissell, M. J. (2005). Modeling dynamic reciprocity: engineering three-dimensional culture models of breast architecture, function, and neoplastic transformation. Semin. Cancer Biol 15, 342352.[CrossRef][Medline]
Nieto, M. A. (2002). The snail superfamily of zinc-finger transcription factors. Nat. Rev. Mol. Cell Biol 3, 155166.[CrossRef][Medline]
Nieto, M. A., Sargent, M. G., Wilkinson, D. G., Cooke, J. (1994). Control of cell behavior during vertebrate development by Slug, a zinc finger gene. Science 264, 835839.
O'Brien, L. E., Jou, T. S., Pollack, A. L., Zhang, Q., Hansen, S. H., Yurchenco, P., Mostov, K. E. (2001). Rac1 orientates epithelial apical polarity through effects on basolateral laminin assembly. Nat. Cell Biol 3, 831838.[CrossRef][Medline]
O'Brien, L. E., Tang, K., Kats, E. S., Schutz-Geschwender, A., Lipschutz, J. H., Mostov, K. E. (2004). ERK and MMPs sequentially regulate distinct stages of epithelial tubule development. Dev. Cell 7, 2132.[CrossRef][Medline]
O'Brien, L. E., Zegers, M. M., Mostov, K. E. (2002). Opinion: building epithelial architecture: insights from three-dimensional culture models. Nat. Rev. Mol. Cell Biol 3, 531537.[CrossRef][Medline]
Peinado, H., Quintanilla, M., Cano, A. (2003). Transforming growth factor beta-1 induces snail transcription factor in epithelial cell lines: mechanisms for epithelial mesenchymal transitions. J. Biol. Chem 278, 2111321123.
Pollack, A. L., Runyan, R. B., Mostov, K. E. (1998). Morphogenetic mechanisms of epithelial tubulogenesis: MDCK cell polarity is transiently rearranged without loss of cell-cell contact during scatter factor/hepatocyte growth factor-induced tubulogenesis. Dev. Biol 204, 6479.[CrossRef][Medline]
Robson, E. J., Khaled, W. T., Abell, K., Watson, C. J. (2006). Epithelial-to-mesenchymal transition confers resistance to apoptosis in three murine mammary epithelial cell lines. Differentiation 74, 254264.[CrossRef][Medline]
Romano, L. A. and Runyan, R. B. (2000). Slug is an essential target of TGFbeta2 signaling in the developing chicken heart. Dev. Biol 223, 91102.[CrossRef][Medline]
Savagner, P. (2001). Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition. Bioessays 23, 912923.[CrossRef][Medline]
Savagner, P., Kusewitt, D. F., Carver, E. A., Magnino, F., Choi, C., Gridley, T., Hudson, L. G. (2005). Developmental transcription factor slug is required for effective re-epithelialization by adult keratinocytes. J. Cell. Physiol 202, 858866.[CrossRef][Medline]
Savagner, P., Yamada, K. M., Thiery, J. P. (1997). The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J. Cell Biol 137, 14031419.
Sefton, M., Sanchez, S., Nieto, M. A. (1998). Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development 125, 31113121.[Abstract]
Shih, J. Y., et al. (2005). Transcription repressor slug promotes carcinoma invasion and predicts outcome of patients with lung adenocarcinoma. Clin. Cancer Res 11, 80708078.
Thiery, J. P. (2002). Epithelial-mesenchymal transitions in tumour progression. Nat. Rev. Cancer 2, 442454.[CrossRef][Medline]
Uchikado, Y., Natsugoe, S., Okumura, H., Setoyama, T., Matsumoto, M., Ishigami, S., Aikou, T. (2005). Slug Expression in the E-cadherin preserved tumors is related to prognosis in patients with esophageal squamous cell carcinoma. Clin. Cancer Res 11, 11741180.
Valdes, F., Alvarez, A. M., Locascio, A., Vega, S., Herrera, B., Fernandez, M., Benito, M., Nieto, M. A., Fabregat, I. (2002). The epithelial mesenchymal transition confers resistance to the apoptotic effects of transforming growth factor Beta in fetal rat hepatocytes. Mol. Cancer Res 1, 6878.
Vega, S., Morales, A. V., Ocana, O. H., Valdes, F., Fabregat, I., Nieto, M. A. (2004). Snail blocks the cell cycle and confers resistance to cell death. Genes Dev 18, 11311143.
Verrecchia, F., Rossert, J., Mauviel, A. (2001). Blocking sp1 transcription factor broadly inhibits extracellular matrix gene expression in vitro and in vivo: implications for the treatment of tissue fibrosis. J. Invest. Dermatol 116, 755763.[CrossRef][Medline]
Wu, W. S., Heinrichs, S., Xu, D., Garrison, S. P., Zambetti, G. P., Adams, J. M., Look, A. T. (2005). Slug antagonizes p53-mediated apoptosis of hematopoietic progenitors by repressing puma. Cell 123, 641653.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. P. Wescott, M. Rovira, M. Reichert, J. von Burstin, A. Means, S. D. Leach, and A. K. Rustgi Pancreatic Ductal Morphogenesis and the Pdx1 Homeodomain Transcription Factor Mol. Biol. Cell, November 15, 2009; 20(22): 4838 - 4844. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Huang, Z.-G. Li, H. Rus, X. Wang, P. A. Jose, and S.-Y. Chen RGC-32 Mediates Transforming Growth Factor-{beta}-induced Epithelial-Mesenchymal Transition in Human Renal Proximal Tubular Cells J. Biol. Chem., April 3, 2009; 284(14): 9426 - 9432. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||