Molecular Biology of the Cell click for CBE Life Science Education Page

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E06-09-0867 on March 21, 2007

Vol. 18, Issue 6, 1992-2001, June 2007

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E06-09-0867v1
18/6/1992    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by L'honore, A.
Right arrow Articles by Fernandez, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by L'honore, A.
Right arrow Articles by Fernandez, A.

Identification of a New Hybrid Serum Response Factor and Myocyte Enhancer Factor 2-binding Element in MyoD Enhancer Required for MyoD Expression during Myogenesis

Aurore L'honore*, Vanessa Rana*, Nikola Arsic, Celine Franckhauser, Ned J. Lamb, and Anne Fernandez

Cell Biology Unit, Institut de Génétique Humaine, Centre National de la Recherche Scientifique, 34396 Montpellier Cedex 05, France

Submitted September 27, 2006; Revised February 6, 2007; Accepted March 14, 2007
Monitoring Editor: J. Silvio Gutkind


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MyoD is a critical myogenic factor induced rapidly upon activation of quiescent satellite cells, and required for their differentiation during muscle regeneration. One of the two enhancers of MyoD, the distal regulatory region, is essential for MyoD expression in postnatal muscle. This enhancer contains a functional divergent serum response factor (SRF)-binding CArG element required for MyoD expression during myoblast growth and muscle regeneration in vivo. Electrophoretic mobility shift assay, chromatin immunoprecipitation, and microinjection analyses show this element is a hybrid SRF- and MEF2 Binding (SMB) sequence where myocyte enhancer factor 2 (MEF2) complexes can compete out binding of SRF at the onset of differentiation. As cells differentiate into postmitotic myotubes, MyoD expression no longer requires SRF but instead MEF2 binding to this dual-specificity element. As such, the MyoD enhancer SMB element is the site for a molecular relay where MyoD expression is first initiated in activated satellite cells in an SRF-dependent manner and then increased and maintained by MEF2 binding in differentiated myotubes. Therefore, SMB is a DNA element with dual and stage-specific binding activity, which modulates the effects of regulatory proteins critical in controlling the balance between proliferation and differentiation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Skeletal muscle repair is fulfilled by satellite cells, quiescent myogenic progenitors located between the basement membrane and myofibers in both growing and mature muscle (Mauro, 1961Go; Schultz et al., 1978Go; Muir et al., 1965Go; Bischoff and Heintz 1994Go; Yablonka-Reuveni, 1995Go). They undergo mitogenic activation in response to exercise or damage-induced signals proliferate, differentiate, and fuse into pre-existing or newly formed myofibers during muscle regeneration (Grounds and Yablonka-Reuveni, 1993Go; Schultz and McCormick, 1994Go).

Among basic helix-loop-helix (bHLH) myogenic regulatory factors (MRFs), MyoD is the earliest to be induced and detected both in vivo upon muscle regeneration with activation of satellite cells and in ex vivo in cell lines derived from such precursors (Fütchbauer and Westphal, 1992Go; Grounds et al., 1992Go). Indeed, after isolation, activated satellite cells enter the cell cycle and express MyoD concomitantly with proliferating cell nuclear antigen (Smith et al., 1994Go; Yablonka-Reuveni and Rivera, 1994Go). This finding suggested a possible role for MyoD during satellite cell activation in regeneration (Yablonka-Reuveni and Rivera, 1994Go; Yablonka-Reuveni et al., 1999Go). In agreement with this, we have reported an early induction of MyoD 4–6 h after entry of quiescent myoblasts into the cell cycle (Kitzmann et al., 1998Go). In addition, muscles from MyoD–/– mutant mice are severely deficient in regenerative capacity after injury, supporting an essential role of MyoD in adult muscle (Megeney et al., 1996Go). Both in vivo and ex vivo studies using isolated myofibers and primary cultured myoblasts from MyoD–/– mice show that without MyoD, satellite cells undergo enhanced self-renewal rather than giving rise to progeny that can differentiate (Sabourin et al., 1999Go; Yablonka-Reuveni et al., 1999Go; Cornelison et al., 2000Go).

To better understand how postnatal skeletal muscle regeneration is controlled, it is essential to investigate the mechanisms that regulate MyoD expression in activated satellite cells, proliferating myoblasts, and postmitotic differentiating myoblasts. Previous studies have shown that a 24-kbp 5'-flanking region of mouse and human MyoD is sufficient to recapitulate endogenous MyoD expression during mouse muscle development and in mature postnatal muscles (Chen et al., 1999Go, 2001Go). Three regions were characterized among these 24-kbp in humans and mice: a minimal 275-base pair promoter called proximal regulatory region (PRR) (Goldhamer et al., 1992Go; Tapscott et al., 1992Go), and two muscle-specific enhancers with distinct but overlapping specificity, a 750-base pair distal regulatory region (DRR) at –5 kb (Tapscott et al., 1992Go; Asakura et al., 1995Go; Chen et al., 2002Go), and a 300-base pair core enhancer at –20 kb (Goldhamer et al., 1992Go, 1995Go; Chen et al., 1999Go, 2001Go). Whereas the core enhancer has been implicated in MyoD gene expression during development (Goldhamer et al., 1995Go; Chen et al., 1999Go, 2001Go), it is inactive after birth (Faerman et al., 1995Go). In contrast, targeted inactivation of the DRR showed it to be dispensable during development and essential in mature muscle (Chen et al., 2002Go). Recently, we reported that the DRR enhancer is sufficient to induce a reporter gene expression with the same kinetics as endogenous MyoD expression in vivo during satellite cell activation linked to muscle regeneration (L'honore et al., 2003Go). Sequence analysis of the human and mouse DRR MyoD gene revealed a conserved but noncanonical serum response factor (SRF)-binding sequence [CC(A/T)6AG]. Using satellite cell-derived myoblasts and in vivo muscle regeneration assays, we showed that this divergent MyoD-CArG-box binds SRF-containing complexes during proliferation and that it is required for transcriptional activation of MyoD in growing myoblasts and during regeneration (L'honore et al., 2003Go).

In the present study, we further analyzed the potential role of this DRR CArG-like element, and we show it binds an additional complex that does not contain SRF but instead myocyte enhancer factor 2 (MEF2) proteins during differentiation. Thus, the divergent CArG sequence in MyoD DRR represents a new hybrid element composed of binding sites for both SRF and MEF2 factors, and it was named SMB element for SRF/MEF2/Binding element. Analyzing MyoD expression after microinjection and reporter expression in stably transfected myoblasts, we show that this MyoD-SMB element enables a molecular relay from SRF-driven to MEF2-driven activation of MyoD transcription when progressing from myoblast proliferation to differentiation into myotubes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture
C2 mouse myoblast cells were grown in DMEM with 15% (vol/vol) fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin at 37°C in a humidified 5% CO2 incubator. For differentiation, confluent C2 cells were reefed with DMEM (2% FBS) for indicated times. Stable transfections were performed with Lipofectamine reagent (Invitrogen, Carlsbad, CA).

Overexpression and Purification of His-tagged Proteins
His-tagged proteins were expressed in bacteria His-MEF2C plasmid (kind gift from A. Lassar, Harvard Medical School, Boston, MA) and purified as described previously (Janknecht et al., 1991Go) by using nickel-nitrilotriacetic acid beads (QIAGEN, Valencia, CA). The integrity of proteins was analyzed by SDS-polyacrylamide gel electrophoresis and Coomassie blue staining, along with known amounts of bovine serum albumin to calculate the yield of tagged proteins.

Oligonucleotides and Electrophoretic Mobility Shift Assay (EMSA)
High-performance liquid chromatography-purified oligonucleotides (MWG Biotech, Roissy CDG, France) were labeled and purified as described previously (L'honore et al., 2003Go). Nuclear extracts from proliferated and differentiated C2 cells were prepared as described previously (Dignam et al., 1983Go).

For EMSA, 5 µg of nuclear extract was incubated for 15 min on ice in 1X retardation mix (10 mM Tris-Cl, pH 8, 0.1 mM EDTA, 10 mM MgCl2, 2 mM dithiothreitol, 15% glycerol, and 2 mg/ml bovine serum albumin [BSA]) and 250 ng of single-stranded DNA. Labeled probe was added to the mixture and incubated at 30°C for 10 min. For supershift and in vitro competition analysis, 0.2 µg of rabbit polyclonal antibody (SRF G20, sc-335X; MEF2 H300, sc-10794X; Santa Cruz Biotechnology, Santa Cruz, CA) or 10–100 ng of His-tagged proteins was included before probe addition and incubated with the mixture for 1 h on ice. Samples were resolved on a nondenaturing 5% polyacrylamide gel.

Chromatin Immunoprecipitation (ChIP) in C2
Proliferative or differentiated (3 d) C2C12 cells were prepared for ChIP as described previously (Thomas et al., 2001Go). Sonicated chromatin corresponding to 5 x 106 cells was subjected to immunoprecipitation at 4°C with 4 µg of antibodies against SRF (G-20; Santa Cruz Biotechnology), MEF2 (C-21; Santa Cruz Biotechnology), or matched nonimmune immunoglobulin G (IgG) (Sigma-Aldrich, St. Louis, MO) as negative control, in the presence of 0.5 mg/ml yeast tRNA and 10 mg/ml BSA. Immunoprecipitates were collected with protein A-Sepharose beads (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) and washed 5-fold in immunoprecipitation buffer (50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, and 1% NP-40). Immunoprecipitated DNA was isolated using Chelex-100 (Bio-Rad, Hercules, CA) as described previously (Nelson et al., 2006Go). Quantitative real-time polymerase chain reaction (PCR) (LC480; Roche Diagnostics, Mannheim, Germany) was performed using the IQ SYBR Green Supermix (Bio-Rad). Quantitation of proopiomelanocortin third exon was used as internal control to normalize MyoD DRR enrichment. -Fold recruitment was calculated relative to IgG control sample.

Microinjection and Immunofluorescence
Proliferating or 3-d differentiated C2 cells were microinjected with MyoD-wtCArG, -csCArG, -csMEF2, and -mutCArG oligonucleotides or buffer at concentration: 50 µg/ml in 50% phosphate-buffered saline in water (vol/vol). In all cases, injection solutions contained inert rabbit immunoglobins (1 mg/ml) to serve subsequently in identifying injected cells. Three hours after microinjection, cells were fixed with Formalin, and expression of MyoD in the injected cells was analyzed by double immunofluorescence. Cells were stained with Alexa Red-conjugated anti-rabbit antibodies (Molecular Probes Europe, Leiden, The Netherlands) to visualize injected cells and monoclonal anti-MyoD (5.8A; BD Biosciences PharMingen, San Diego, CA) followed by Alexa Green 488-conjugated anti-mouse (Molecular Probes Europe) to probe for MyoD expression.

Site-directed Mutagenesis
Construct 17.11wt containing the mouse DRR and PRR regions of MyoD gene fused to the beta-galactosidase gene was generously provided by Dr. S. J Tapscott (Fred Hutchinson Cancer Research Center, Seattle, WA) (Tapscott et al., 1992Go). Constructs 17.11m and 17.11cs were described previously (L'honore et al., 2003Go). Mutation of the CArG-box in the DRR of 17.11MEF2 plasmid was generated using the QuikChange mutagenesis kit (Stratagene La Jolla, CA) with the following oligonucleotide: CCCAAAAGCCAGCTCTCTATTTATAGCACCT (and its corresponding lower strand oligonucleotide).

For MyoD-green fluorescent protein (GFP) reporter constructs, the region containing the DRR and PRR of mouse MyoD was excised from p17.11 (15) and cloned into pBS. The SMB element in the DRR region was subsequently mutated to MEF2 or SRF consensus by the QuikChange system (Stratagene). After excising the intragenic region separating DRR and PRR, the shortened regulatory region was subcloned in place of the cytomegalovirus promoter in pEGFP-C1-MyoD.

Reporter Assays
Stably transfected C2 myoblasts at the indicated stages were either used for beta-galactosidase activity assays, as described previously (L'honore et al., 2003Go), or fixed for immunofluorescence analysis after 2 d in differentiation to monitor for MyoD-GFP expression (via enhanced green fluorescent protein [EGFP] fluorescence) together with the expression of myosin heavy chain, a marker of differentiation, using monoclonal MF20 from the Developmental Hybridoma Study Bank (University of Iowa, Iowa City, IA), followed by Alexa 555-conjugated anti-mouse IgGs (Molecular Probes Europe).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The MyoD-DRR Enhancer Contains a Divergent CArG Element, CCATTTATAG, Required In Vivo for DRR-driven Induction of MyoD during Regeneration
We have previously identified in MyoD DRR, a divergent CArG motif, CCATTTATAG, that binds SRF from myoblast nuclear extracts and is functionally required for induction of a DRR-driven reporter gene in transgenic mice during regeneration (L'honore et al., 2003Go). To further confirm and analyze the role of this newly identified CArG element, we have examined the induction of endogenous MyoD together with that of a MyoD-DRR–driven beta-galactosidase (beta-Gal) reporter transgene in mice Tibialis muscle (TA) after induction of regeneration by notexin injury. Shown in Figure 1 is an immunohistochemical analysis of beta-Gal and MyoD expression on cryosections from 4-d regenerating TA muscle in mice bearing a transgene with either wild-type (WT) or a CArG-mutated DRR enhancer. Staining in noninjured contralateral muscle from the WT-DRR transgenic mouse is also shown. MyoD is absent in sections from control muscle, and it is induced in regenerating muscle as shown in the top panels. Together with induction of endogenous MyoD, beta-Gal transgene expression is also induced in the case of the transgene carrying a wild type CArG-box in the DRR, showing this construct reliably mimics the expression of endogenous MyoD (middle panel). However, when the CArG-box in the DRR was mutated to a nonfunctional element (no longer able to bind SRF), the corresponding transgene did not show any induction of the reporter upon induction of regeneration, even though endogenous MyoD was effectively induced. These results show that the CArG element we identified in MyoD DRR enhancer is essential for MyoD induction in vivo in postnatal myogenesis.


Figure 1
View larger version (86K):
[in this window]
[in a new window]

 
Figure 1. Requirement for the CArG element in MyoD-DRR for MyoD induction during muscle regeneration. Transgenic mice carrying either the wild-type 17.11 MyoD-DRR-PRR-beta-galactosidase reporter construct (Asakura et al., 1995Go) (A–F) or the same construct mutated in the CArG-box present in the DRR enhancer (G–I) were subject to notexin injury of one of their TA muscle. Four days later, mice were killed, and both TA muscles were taken for cryosections and analysis of endogenous MyoD (A, D, and G) and beta-galactosidase reporter expression (B, E, and H) by double immunofluorescence. A–C show control staining in contralateral uninjured TA muscle.

 
MyoD-CArG Element: A Unique Hybrid Sequence Composed of Binding Sites for Both SRF and MEF2 Factors
To investigate whether SRF binding to the MyoD-CArG element could regulate MyoD gene expression during differentiation, we tested the capacity of MyoD-CArG–containing oligonucleotides to bind nuclear factors from proliferative and differentiated cell extracts by EMSAs. Specific probes spanning the CArG-box region (Figure 2A) were incubated with C2 myoblast or myotube nuclear extracts. Whereas with extracts from proliferative C2, the MyoD-wtCArG probe formed a major slow-migrating complex that was fully supershifted with anti-SRF (Figure 2B, complexes A and sA), in differentiated C2 extracts, an additional slower migrating complex occurred, complex B, that was not supershifted by anti-SRF antibody (marked by an asterisk). Because MyoD-CArG-box is characterized by a 3'-end divergence (AG instead of GG pair), we investigated whether complex B could be related to this divergence. This C-to-A divergence creates a stretch of 7 A/T that forms a motif close to a MEF2-binding site: MyoD-wtCArG is CCA(A/T)4TAG, whereas MEF2 consensus sequence is CTA(A/T)4TAG (Figure 2A).


Figure 2
View larger version (47K):
[in this window]
[in a new window]

 
Figure 2. The CArG element in MyoD gene DRR is an hybrid sequence composed of binding sites for both SRF and MEF2 factors. (A) Comparison of the classical CArG sequence to the divergent CArG elements present in MyoD-DRR and MLC1A promoters. (B) MyoD-wtCArG and MyoD-MLC1A sequence-containing oligonucleotides were radiolabeled and used as probes in EMSA with nuclear extracts from growing (Pro) and differentiated (Dif) C2 myoblasts. Rabbit polyclonal antibodies raised against SRF or MEF2 were added or not before the DNA binding reaction. Two complexes A and B, and anti-SRF or anti-MAF2 supershifted (complex sA and sB), are indicated by arrowheads. An asterisk marks the complex specifically formed with differentiated cell extracts and not supershifted by anti-SRF antibodies. (C) Single point mutations of the MyoDwt-CArG probes as shown were used in EMSA with nuclear extracts from differentiated C2 cells. Antibodies to SRF, MEF2, or both were added or not before DNA binding. The complexes formed are indicated with arrows in B.

 
Using specific anti-MEF2 antibodies and MyoD-wtCArG, we assayed for the presence of MEF2 in complex B. As shown Figure 2B, anti-MEF2 antibodies supershifted complex B to complex sB, demonstrating MEF2 factors are present in the complex.

Addition of both anti-SRF and anti-MEF2 antibodies supershifted all complexes from differentiated extracts, confirming that these two proteins are present in two different complexes, A and B, respectively (Figure 2C). Because the G-to-A 3'-end divergence in MyoD-CArG is similar to that reported previously in MLC1A-CArG-box, shown to be functional in binding SRF (Catala et al., 1995Go), we investigated whether MLC1A-CArG also binds MEF2 proteins during differentiation. Anti-MEF2 supershift experiments with MLC1A probe show that MLC1A-CArG only bound SRF but not MEF2 proteins (Figure 2B, right lanes). Therefore, the A in position 3 of the decapeptide is essential for MEF2 binding, confirming previous analyses of MEF2-binding consensus.

To further investigate the possible roles of SRF and MEF2 in MyoD-CArG activity during differentiation, we searched for mutations of this MyoD-DRR sequence that would allow either only SRF binding or only MEF2 binding. As shown in Figure 2C, a single nucleotide mutation to restore the consensus CArG GG pair (instead of AG) at the 3' end of this element (Figure 2C, SRFcs), results in both stronger SRF binding in complex A and no MEF2 binding as complex B. In contrast, when the MyoD-CArG motif was mutated at its 5' end from CC to CT (Figure 2A, MEF2cs), the binding of SRF as complex A was abolished, and only MEF2 wad bound as complex B all supershifted to sB by anti MEF2 antibodies.

These results identify a decanucleotide consensus sequence in MyoD-CArG required to generate a unique hybrid sequence that includes both SRF and MEF2 divergent binding sites: CCA(A/T)4TAG. This new hybrid element was named SMB for SRF and MEF2 Binding element.

Competitive Binding of SRF and MEF2 to MyoD-SMB Element in Differentiated C2 Cells
To investigate whether SRF and/or MEF2 proteins were bound to the SMB element in MyoD promoter in living cells, we performed chromatin immunoprecipitation by using nuclear extracts from proliferating or differentiated C2 myoblasts. Results in Figure 3A show a three- to fourfold higher recruitment of SRF to MyoD-SMB element in proliferating than in differentiated myoblasts. In contrast, the level of MEF2 proteins recruitment is the same as control nonimmune Ig level in proliferation and twice the level of SRF recruitment in differentiated cells. These data show that SRF is bound to MyoD-SMB in myoblasts, whereas either MEF2 or SRF can be bound in myotubes. It is known that differentiated myoblasts contains two populations of cells: "reserve" cells that become quiescent but do not differentiate (15–20% of total nuclei) and differentiated multinucleate myotubes. To examine whether the binding of SRF and MEF2 to Myod-SMB was different in these two subpopulations, we have analyzed their binding by chromatin immunoprecipitation performed on each subpopulation isolated from differentiated C2 myoblasts as described previously (Kitzmann et al., 1998Go). Figure 3B shows that whereas only little SRF and no MEF2 is found recruited on the MyoD-SMB in quiescent reserve cells, four- to fivefold more MEF2 than SRF is recruited to the MyoD-SMB element in differentiated myotubes.


Figure 3
View larger version (34K):
[in this window]
[in a new window]

 
Figure 3. Competitive Binding of SRF and MEF2 to MyoD-SMB element in differentiated C2 cells. (A) Chromatin immunoprecipitation assay of SRF and MEF2 binding to the MyoD-DRR SMB element in proliferating (empty bars) and differentiated (full bars) C2 cells. (B) Using C2 cells differentiated for 4 d, myotubes were separated from quiescent undifferentiated reserve cells by limited trypsinization (Kitzmann et al., 1998Go), and each population was analyzed by ChIP for binding of SRF and MEF2 to the SMB element. (C) Competition of endogenously formed SRF-containing complex by increasing amounts of His-tagged-MEF2: MyoD-wtCArG oligonucleotides were radiolabeled and used as probes in EMSA in presence of 2 µg of proliferating C2 nuclear extracts and increasing amounts of His-MEF2 protein (10–100 ng). SRF (A) and YY1 complexes, and MEF2 shift, are indicated by arrowheads. (D) Binding of SRF complex (A) and His-MEF2 protein was measured by quantification of each shift. Shown is the MEF2-competed down SRF complex.

 
MyoD-SMB element contains both SRF and MEF2 binding sequences that overlap, a situation that has not been previously described for these two factors. Because SRF interacts with DNA by point contacts with the helix minor groove and MEF2 with the major groove of DNA (Mueller and Nordheim, 1991Go; Wynne and Treisman, 1992Go), both factors could, in principle, occupy the SMB site simultaneously. However, interactions between the two members of the MADS-box family have not been described previously (our unpublished data; Shore and Sharrocks, 1995Go). The steric hindrance of high molecular weight (MW) complexes associated with either SRF (L'honore et al., 2003Go) or MEF2 (~600 kDa; our unpublished observation) suggests a mutually exclusive binding of SRF- and MEF2-containing complexes to SMB element. To test this hypothesis, we performed DNA binding competition studies between the two factors by using His-tagged MEF2 proteins. The experiment was performed using constant amounts of nuclear extract from proliferative C2 cells (where only SRF is present and bound as complex A), in the presence of labeled MyoD-wtCArG (SMB) probe and increasing quantities of His-MEF2 protein (0–100 ng). EMSA analysis in Figure 3, C and D, shows that adding MEF2 proteins displaced endogenous SRF-containing complexes bound to MyoD-SMB element. In addition, YY1-containing complexes, described previously with proliferative cell extracts (L'honore et al., 2003Go), were also reduced with increased MEF2 binding. A similar reduction of the YY1-containing complex was observed in differentiated extracts in comparison to proliferative extracts (Figure 2B). These data show SRF and MEF2 proteins compete for binding to the MyoD-CArG SMB element.

Endogenous MyoD Expression Is Rapidly Suppressed in Differentiated Myotubes Microinjected with MyoD-SMB– and MEF2-binding Oligonucleotides
To determine the functional importance of the SMB element, and particularly the contribution of an interaction with SRF and/or MEF2 to endogenous MyoD expression in growing myoblasts and in differentiated myotubes, we microinjected oligonucleotides that can bind and titrate out endogenous transcription factors, thereby preventing their binding to endogenous sequences (Lamb et al., 1996Go). MyoD-wtSMB (SRF and MEF2 binding), -mutCArG (binding none), -csCArG (SRF-binding only), and -csMEF2 (MEF2-binding only) oligonucleotides were injected in proliferative myoblasts or in differentiated myotubes, and cells were fixed for analysis of MyoD expression 2–3 h after injection of the oligonucleotides, a time sufficient to allow for the turnover of endogenous MyoD protein and RNA but not sufficient for any indirect effect on other potential targets of either SRF or MEF2 transcription factors. Results, shown for injections in myotubes Figure 4A, are summarized for both stages in Figure 4B. Microinjection of the injection marker alone (control) had little or no effect on MyoD gene expression with 55 and 92% MyoD-positive nuclei in microinjected myoblasts and myotubes, respectively. Microinjection of MyoD-wtSMB oligonucleotides (that can bind SRF or MEF2), induced a significant decrease of the number of MyoD-positive myonuclei, with only 40% of myonuclei expressing MyoD in microinjected myotubes. An even stronger reduction was observed when MyoD-csMEF2 oligonucleotides—that bind only MEF2 protein—were microinjected, with <5% MyoD-positive nuclei in injected myotubes. Interestingly, the same MEF2-cs oligonucleotides had no effect on MyoD expression when injected in proliferative myoblasts (Figure 4B, gray bars). In contrast, consensus MyoD-csCArG—that binds only SRF—did not affect MyoD expression in differentiated myotubes (Figure 4, A and B), whereas the same MyoD-csCArG oligonucleotides strongly reduced MyoD gene expression in myoblasts (Figure 4B, black bars). As a control, a mutated MyoD-CArG-SMB that no longer binds SRF nor MEF2 had no effect on MyoD expression in myoblasts or myotubes. These results show that although the endogenous expression of MyoD requires SRF in myoblasts, it no longer does in myotubes where MEF2 is involved.


Figure 4
View larger version (75K):
[in this window]
[in a new window]

 
Figure 4. MEF2-binding and not SRF-binding oligonucleotides inhibit MyoD expression when injected into differentiated myotubes. (A) Differentiated C2 myotubes were microinjected with oligonucleotides corresponding to MyoD-wtCArG, -csCArG, -csMEF2, and -mutCArG (SMB) sequences (see Figure 2) at 50 µg/ml. Cells were fixed 3 h after injection, and expression of MyoD was analyzed in microinjected cells by double immunofluorescence staining. (B) Percentage of MyoD-positive cells among injected cells in each experiment. Eighty to 100 cells were injected for each experimental condition. Control represents the percentage of MyoD-positive cells after microinjection of only inert marker IgG.

 
MyoD DRR Reporter Activity in C2 Cells during Transition from Proliferation to Differentiation by Using Wild-Type and Mutated SMB Sequences
To investigate whether MyoD-SMB element was required for specific activation of MyoD gene during differentiation, and the respective contributions of SRF and MEF2 binding to SMB in this process, we used a reporter construct 17.11wt described previously by Tapscott et al. (1992)Go, which is specifically expressed after chromatin integration in myoblast cell lines but not in 10T1/2 fibroblast cells. This construct containing the 720 base pairs of the DRR fused to the PRR and beta-Gal is specifically activated in muscle from transgenic mice during regeneration (Figure 1). Two mutations in the SMB sequence of the DRR of this construct were introduced to transform MyoD-wtSMB into either a consensus MyoD-csCArG that shows enhanced SRF binding and no MEF2 binding or into an MEF2 consensus site MyoD-csMEF2 with enhanced MEF2 binding and no SRF binding, as shown Figure 2C. Each construct, called 17.11wt, 17.11csCArG, and 17.11csMEF2, was stably transfected into C2 cells and enhancer activity was tested in growing myoblasts at confluence and at different times of differentiation (Figure 5A).


Figure 5
View larger version (52K):
[in this window]
[in a new window]

 
Figure 5. Point mutations in MyoD-SMB element modulate MyoD-PRR-DRR construct activity in the course of differentiation. C2 cells were stably transfected with constructs containing either wild-type CArG (SMB) (17.11wt), consensus CArG (17.11csCArG), consensus MEF2 site (17.11csMEF2), or mutated CArG (SMB) (17.11mut) as shown in Figures 1A and 2C. DRR enhancer activity was then examined by beta-Gal activity measurements in proliferative cells, at confluence or 1 and 2 d after switch in differentiation medium. Values represent the average calculated from at least two different experiments on stably transfected C2 cell lines for each point. (B–D) C2 cells were stably transfected with a transgene where beta-gal reporter was replaced with MyoD-EGFP fusion protein containing either the wild-type MyoD-SMB box (C), the SRF consensus mutated box (B), or the MEF2 consensus mutated box (D). Cells were fixed after 2 days of differentiation.

 
As shown previously (Tapscott et al., 1992Go), the MyoD-DRR construct (wtSMB) showed increased activity from proliferation to differentiation (Figure 5A, triangles). A mutation reverting MyoD-wtSMB to the consensus csCArG resulted in an increased enhancer activity in proliferation, likely related to increased SRF binding (Figure 2B). However, as C2 myoblasts reach confluence and stop proliferating, this activity decreased, and it became very weak after 2 d of differentiation into myotubes (Figure 5A, squares). These data confirm the microinjection data showing a lack of effect of SRF-binding oligonucleotides on endogenous MyoD expression in myotubes. In addition, the opposite mutation that created a MEF2 binding sequence that no longer binds SRF in MyoD-DRR showed weak enhancer activity in proliferating myoblasts, increasing at confluence and in differentiated myotubes to levels greater than DRR containing wt-SMB sequence (Figure 5A, circles). Together, these data show that although MyoD-DRR activity required SRF binding on its SMB-box in proliferative myoblasts, it needed MEF2 binding in differentiated myotubes. These results were qualitatively confirmed by in situ analysis of the expression of a similar transgene where the beta-galactosidase reporter was replaced with MyoD-EGFP fusion protein (see Materials and Methods) together with myosin heavy chain (MHC), in differentiated C2 cells stably transfected with either SRFcs- (Figure 5B), wt-SMB- (Figure 5C), or MEF2cs-containing constructs (Figure 5D). Whereas SRFcs-containing MyoD construct is only expressed in undifferentiated MHC-negative cells (Figure 5B, arrow), SMB- and MEF2cs-containing constructs are both expressed in differentiated MHC-positive myotubes (Figure 5, C and D), and the wt-SMB construct is also expressed in a MHC-negative myoblast (Figure 5C, arrow). Together, these data show that the hybrid SMB element in MyoD DRR is the site for a molecular relay from SRF-driven to MEF2-driven transcription of MyoD when progressing from proliferative myoblasts to differentiated myotubes.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously showed that MyoD-DRR enhancer contains a divergent SRE/CArG element that binds SRF with low affinity in proliferative myoblasts (L'honore et al., 2003Go). This element is functionally active and required during myoblasts growth and toxin-induced muscle regeneration (Figure 1). Examining the role of this divergent CArG during differentiation revealed that it represents a new hybrid element that can bind MEF2 in addition to SRF. This SMB element forms a new complex in differentiation by binding MEF2 proteins. ChIP experiments reveal that whereas only SRF is bound to this element in myoblasts, mostly MEF2 and with only little SRF are bound in myotubes and compete for the MyoD-SMB element during differentiation. Analyzing the short-term (within 2- to 3-h) direct effect of oligonucleotides microinjection on MyoD expression shows that it requires SRF in myoblasts and only MEF2 but not SRF in differentiated myotubes. Using SMB-mutated DRR-containing reporter constructs, we show that this new dual-specificity divergent CArG/SMB element in MyoD-DRR enables a relay from SRF-driven to MEF2-driven transcription of MyoD when progressing from proliferative to differentiating stages of myogenesis.

MyoD-SMB Element Is a Unique Hybrid Sequence Capable of Binding Either SRF or MEF2 Protein Complexes
We have identified that a single base divergence from G to A in the core sequence from CC(A/T)6GG to CC(A/T)6AG in MyoD-CArG element resulted in hybrid SRF/MEF2 binding sequence. Interestingly, a divergent CArG sequence in MLC1A gene, described as functional (Catala et al., 1995Go), contains the same 3' G-to-A divergence as the MyoD-SMB element. In addition, the decanucleotide core sequences are identical in both cases, with the exception of one nucleotide divergence (A to T) in the A/T tract of MLC1A CArG. However, the MLC1A-CArG does not bind MEF2-containing complexes from differentiated myotubes, showing that the first A in the A/T tract is critical for MEF2 binding. This identifies the following consensus decanucleotide for an SRF and MEF2-binding SMB sequence: CCA(A/T)4TAG. A Search for this consensus in other regulatory regions of MyoD, particularly in the core enhancer (–20 kb) (Goldhamer et al., 1992Go), revealed no other potential SMB elements.

ChIP analysis shows that in differentiated C2, SRF, or MEF2 can be bound to this new hybrid element. However, analysis of differentiated cultures after separating the population of undifferentiated reserve cells from differentiated myotubes reveals a much higher recruitment of MEF2 factors in the myotube fraction with only SRF being recruited to the SMB element in reserve cells. In addition several lines of evidence indicate that the two factors cannot bind to the SMB together. First, the two proteins have overlapping binding sequences in MyoD-SMB. Second, no interaction is possible between two different members of the MADS-box family (for review, see Shore and Sharrocks, 1995Go), and we found no evidence of interaction (by coimmunoprecipitation) in differentiated myotube extracts (our unpublished observations). Third, SRF and MEF2 proteins compete for binding to MyoD-SMB element (Figure 4A). This mutual exclusion of SRF and MEF2 on MyoD-DRR SMB and the appearance of MEF2-containing complex specifically in differentiation led us to hypothesize that SRF and MEF2 have distinct and independent roles on this element to regulate MyoD expression in proliferation and differentiation.

Requirement for SRF and MEF2 Proteins in MyoD-DRR Activity during Myoblast Growth and Differentiation
The initial requirement for SRF in the induction of MyoD expression in proliferating myoblasts (L'honore et al., 2003Go) fits with the classical function of SRF in the G0 to G1 induction of gene expression. Indeed, MyoD was shown to be induced within 4–6 h after entry of quiescent C2 myoblasts into the cell cycle (Kitzmann et al., 1998Go) and upon activation of satellite cells in vivo (Beauchamp et al., 2000Go) or reserve cells ex vivo (Rochat et al., 2004Go). The SMB element, being divergent from the consensus, binds SRF with a low affinity that is consistent with the low level of MyoD expression in proliferative myoblasts. During toxin-induced regeneration, SRF levels remain constant (see figure 6B in L'honore et al., 2003Go), whereas MEF2 protein induction and increase in transcriptional activity take place after 3 d (Akkila et al., 1997Go), a time that corresponds to the transition from activation-proliferation of satellite cells to differentiation. Analyzing beta-galactosidase and MyoD-GFP reporter activities of different SMB-mutated DRR constructs stably transfected in C2 myoblasts showed that whereas MyoD-DRR enhancer activity needs SRF binding to SMB to induce MyoD when cells proliferate, it needs MEF2 binding and no longer SRF when cells stop proliferating and enter differentiation, corresponding to increased levels of MyoD.

Recent reports examined the role of SRF in vivo during postnatal myogenesis by using conditional knockout of SRF. These studies inducing the cAMP response element recombinase from either the myogenin and MCK promoters (Li et al., 2005Go) or the skeletal a-actin promoter (Charvet et al., 2006Go) found either no effect on MyoD mRNA level (Li et al., 2005Go) or even increased MyoD expression (Charvet et al., 2006Go). The knockout of SRF was induced in both case in differentiating (myogenin promoter) or differentiated (skeletal actin) myofibers. Their results are thus consistent with our conclusion that SRF, although required for MyoD expression in dividing myoblasts, is no longer necessary for MyoD expression in differentiated myotubes. The increased expression observed in the second study is interesting in view of the competition for binding the MyoD-DRR SMB element we found between SRF and MEF2 in differentiation where the possible binding of SRF may reduce the level of MyoD activation by MEF2.

Cross-Regulation between MEF2 and Myogenic bHLH Expression
Several studies have revealed a role for MEF2 factors in the regulation of myogenic bHLH genes. The myogenin promoter, for example, contains a MEF2 site required for high level transcription ex vivo in cultured muscle cells (Edmondson et al., 1992Go; Buchberger et al., 1994Go) and in vivo in the limb buds and somites of transgenic mice (Cheng et al., 1993Go; Yee and Rigby, 1993Go). MEF2 is also crucial to MRF4 gene expression. Indeed, the MRF4 promoter contains an MEF2 binding site that positively regulates its activity, because mutations in this site reduce MRF4 promoter activity in both C2 myotubes and primary chicken muscle cultures (Naidu et al., 1995Go; Black et al., 1995Go). Alternatively, forced expression of myogenic bHLH proteins in nonmuscle cells is sufficient to up-regulate MEF2 expression (Cserjesi and Olson, 1991Go; Lassar et al., 1991Go). During developmental and postnatal muscle differentiation, MyoD and myogenin are expressed before, and are activators of, MEF2 transcription, suggesting a model in which MEF2 is induced by MRF transactivation, whereas amplification and maintenance are regulated by cooperative activation within MEF2 and MRFs families (Wang et al., 2001Go). During regeneration, MyoD induction also precedes MEF2 expression. Thus, MyoD expression during regeneration may involve an autoregulatory and amplification loop with MyoD gene induction by SRF during satellite cells activation into proliferation, MEF2 induction by MyoD and myogenin at the onset of cell cycle exit, and MEF2 requirement for increase and maintenance of MyoD expression during differentiation. MEF2 transcription factor family includes four genes, MEF2A to MEF2D known to be sequentially expressed during muscle development and in cultured myoblasts: MEF2B and MEF2D are already expressed in myoblasts (Breitbart et al., 1993Go; Molkentin et al., 1996Go), whereas MEF2A and MEF2C accumulate during differentiation with MEF2A occurring early in differentiation and MEF2C latter in myotubes and mature muscle fibers (Martin et al., 1993Go; McDermott et al., 1993Go). We found no recruitment of MEF2 to MyoD-SMB in myoblasts supporting that the isoforms of MEF2 assembled on the SMB element in differentiation could be either MEF2A or MEF2C or both. Because MEF2A is induced early during differentiation and antibodies specifically directed against the MEF2C isoform failed to immunoprecipitate any SMB-bound MEF2 (our unpublished observations), MEF2A is the likely isoform to be involved in the complex assembled on the SMB element during differentiation, consistent with an early role of MEF2 in a feedback loop to increase MyoD expression at the onset of differentiation.

Why would MyoD expression be under the control of such a switch between SRF and MEF2 compared with others MRFs? First, MyoD is the earliest MRF to be induced during regeneration and the only MRF to be expressed both in proliferating and differentiated myogenic cells. Second, whereas in proliferation, MyoD regulation is cell cycle dependent (Kitzmann et al., 1998Go; 2001Go), it increases and becomes constant during early differentiation. Therefore, signaling pathways regulating MyoD gene are different, depending on the stage (proliferative or differentiated) of the skeletal muscle cells. In this respect, it is likely that SRF and MEF2 binding to SMB may depend the activity of these signaling pathways. Although in quiescent myoblasts only SRF binds MyoD-SMB (cf. Figure 3B) as an inactive dimmer (as assessed by EMSA and gel filtration; L'honore and Fernandez, unpublished observation) during mitogenic activation promoted by insulin and insulin-like growth factor-1, Rho GTPase signaling is activated (Sordella et al., 2003Go), and as an upstream activator of actin dynamics and SRF (Kuwahara et al., 2005Go), this activates MyoD transcription at the DRR where SRF binds to MyoD-SMB element as high-MW complexes containing SRF coactivators (L'honore et al., 2003Go). In contrast, during differentiation, calcium signaling pathways are up-regulated (Delling et al., 2000Go; Friday et al., 2000Go, 2003Go; Olson and Williams, 2000aGo,bGo), and activation of the calcium-dependent phosphatase calcineurin may promote MEF2-dependent transcriptional activation at the MyoD-SMB element where we have identified the presence of MEF2-containing high-molecular-weight complexes (our unpublished observations). Our data show that the essential role of SRF in MyoD induction during activation and proliferation of satellite cells is relayed at the onset of differentiation by MEF2 proteins. Therefore, the dual binding specificity of MyoD-SMB element makes it a key molecular switch in the regulation of MyoD expression during postnatal myogenesis.

To our knowledge, these findings represent the first report of a regulatory DNA element with a dual binding activity that depends on proliferative or differentiated stage of the cells. Because SRF and MEF2 are expressed and involved in tissues other than skeletal muscle in particular cardiac, the identification of this element may shed new light on regulatory pathways controlling the balance between cell renewal and postmitotic differentiation. In this respect, it is interesting to note that the SRF-binding site recently described as conserved and essential in the upstream enhancer of the microRNAs miR-1-1 and miR-1-2 indeed corresponds to the SMB consensus (CCA(A/T)4TAG) (figure 2 in Zhao et al., 2005Go). miR-1-1 and -2 are specifically expressed in cardiac and skeletal muscle and have been shown by Zhao et al. (2005)Go to regulate Hand2, a transcription factor critically involved in the transition between proliferation and differentiation, because it promotes cardiomyocyte expansion.


    ACKNOWLEDGMENTS
 
We thank Andrew Lassar and Steve Tapscott for plasmids. This work was supported by grants from Association Française contre les Myopathies (to A.F.), Association pour la Recherche contre le Cancer (4459 to N.J.L.), a fellowship from the Fondation pour la Recherche Médicale (to A.L.), and from the Ligue Nationale Contre le Cancer, Comite de l'Herault (to V.R.).


    Footnotes
 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E06-09-0867) on March 21, 2007.

* These authors contributed equally to this work. Back

Address correspondence to: Anne Fernandez (af{at}acrux.igh.cnrs.fr).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Akkila, W. M., Chambers, R. L., Ornatsky, O. I., McDermott, J. C. (1997). Molecular cloning of up-regulated cytoskeletal genes from regenerating skeletal muscle: potential role of myocyte enhancer factor 2 proteins in the activation of muscle-regeneration-associated genes. Biochem. J 325, 87–93.[Medline]

Anderson, J. E. (1998). Studies of the dynamics of skeletal muscle regeneration: the mouse came back!. Biochem. Cell Biol 76, 13–26.[CrossRef][Medline]

Asakura, A., Lyons, G. E., Tapscott, S. J. (1995). The regulation of MyoDgene expression: conserved elements mediate expression in embryonic axial muscle. Dev. Biol 171, 386–398.[CrossRef][Medline]

Beauchamp, J. R., Heslop, L., Yu, D. S., Tajbakhsh, S., Kelly, R. G., Wernig, A., Buckingham, M. E., Partridge, T. A., Zammit, P. S. (2000). Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J. Cell Biol 151, 1221–1234.[Abstract/Free Full Text]

Bischoff, R. (1989). Analysis of muscle regeneration using single myofibers in culture. Med. Sci. Sports Exerc 21, S164–S172.

Bischoff, R. and Heintz, C. (1994). Enhancement of skeletal muscle regeneration. Dev. Dyn 201, 41–54.[Medline]

Black, B. L., Martin, J. F., Olson, E. N. (1995). The mouse MRF4 promoter is trans-activated directly and indirectly by muscle-specific transcription factors. J. Biol. Chem 270, 2889–2892.[Abstract/Free Full Text]

Breitbart, R. E., Liang, C. S., Smoot, L. B., Laheru, D. A., Mahdavi, V., Nadal-Ginard, B. (1993). A fourth human MEF2 transcription factor, hMEF2D, is an early marker of the myogenic lineage. Development 118, 1095–1106.[Abstract]

Buchberger, A., Ragge, K., Arnold, H. H. (1994). The myogenin gene is activated during myocyte differentiation by pre-existing, not newly synthesized transcription factor MEF-2. J. Biol. Chem 269, 17289–17296.[Abstract/Free Full Text]

Carnac, G., Primig, M., Kitzmann, M., Chafey, P., Tuil, D., Lamb, N., Fernandez, A. (1998). RhoA GTPase and serum response factor control selectively the expression of MyoD without affecting Myf5 in mouse myoblasts. Mol. Biol. Cell 9, 1891–1902.[Abstract/Free Full Text]

Catala, F., Wanner, R., Barton, P., Cohen, A., Wright, W., Buckingham, M. (1995). A skeletal muscle-specific enhancer regulated by factors binding to E and CArG boxes is present in the promoter of the mouse myosin light-chain 1A gene. Mol. Cell Biol 15, 4585–4596.[Abstract/Free Full Text]

Charvet, C, et al. (2006). A new role for serum response factor in postnatal skeletal muscle growth and regeneration via the IL-4 and IGF-1 pathways. Mol. Cell Biol 17, 6664–6674.

Chen, J. C. and Goldhamer, D. J. (1999). Transcriptional mechanisms regulating MyoD expression in the mouse. Cell Tissue Res 296, 213–219.[CrossRef][Medline]

Chen, J. C., Love, C. M., Goldhamer, D. J. (2001). Two upstream enhancers collaborate to regulate the spatial patterning and timing of MyoD transcription during mouse development. Dev. Dyn 221, 274–288.[CrossRef][Medline]

Chen, J. C., Ramachandran, R., Goldhamer, D. J. (2002). Essential and redundant functions of the MyoD distal regulatory region revealed by targeted mutagenesis. Dev. Biol 245, 213–223.[CrossRef][Medline]

Cheng, T. C., Wallace, M. C., Merlie, J. P., Olson, E. N. (1993). Separable regulatory elements governing myogenin transcription in mouse embryogenesis. Science 261, 215–218.[Abstract/Free Full Text]

Cornelison, D. D., Olwin, B. B., Rudnicki, M. A., Wold, B. J. (2000). MyoD(–/–) satellite cells in single-fiber culture are differentiation defective and MRF4 deficient. Dev. Biol 224, 122–137.[CrossRef][Medline]

Cserjesi, P. and Olson, E. N. (1991). Myogenin induces the myocyte-specific enhancer binding factor MEF-2 independently of other muscle-specific gene products. Mol. Cell Biol 11, 4854–4862.[Abstract/Free Full Text]

Delling, U., Tureckova, J., Lim, H. W., De Windt, L. J., Rotwein, P., Molkentin, J. D. (2000). A calcineurin-NFATc3-dependent pathway regulates skeletal muscle differentiation and slow myosin heavy-chain expression. Mol. Cell Biol 20, 6600–6611.[Abstract/Free Full Text]

Dignam, J. D., Lebovitz, R. M., Roeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11, 1475–1489.[Abstract/Free Full Text]

Edmondson, D. G., Cheng, T. C., Cserjesi, P., Chakraborty, T., Olson, E. N. (1992). Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Mol. Cell Biol 12, 3665–3677.[Abstract/Free Full Text]

Faerman, A., Goldhamer, D. J., Puzis, R., Emerson, C. P. Jr, Shani, M. (1995). The distal human myoD enhancer sequences direct unique muscle-specific patterns of lacZ expression during mouse development. Dev. Biol 171, 27–38.[CrossRef][Medline]

Friday, B. B., Horsley, V., Pavlath, G. K. (2000). Calcineurin activity is required for the initiation of skeletal muscle differentiation. J. Cell Biol 149, 657–666.[Abstract/Free Full Text]

Friday, B. B., Mitchell, P. O., Kegley, K. M., Pavlath, G. K. (2003). Calcineurin initiates skeletal muscle differentiation by activating MEF2 and MyoD. Differentiation 71, 217–227.[CrossRef][Medline]

Fütchbauer, E. M. and Westphal, H. (1992). MyoD. and myogenin are coexpressed in regenerating skeletal muscle of the mouse. Dev. Dyn 193, 34–39.[Medline]

Goldhamer, D. J., Brunk, B. P., Faerman, A., King, A., Shani, M., Emerson, C. P. Jr. (1995). Embryonic activation of the myoD gene is regulated by a highly conserved distal control element. Development 121, 637–649.[Abstract]

Goldhamer, D. J., Faerman, A., Shani, M., Emerson, C. P. Jr. (1992). Regulatory elements that control the lineage-specific expression of myoD. Science 256, 538–542.[Abstract/Free Full Text]

Grounds, M. D., Garrett, K. L., Lai, M. C., Wright, W. E., Beilharz, M. W. (1992). Identification of skeletal muscle precursor cells in vivo by use of MyoD1 and myogenin probes. Cell Tissue Res 267, 99–104.[CrossRef][Medline]

Grounds, M. D. and Yablonka-Reuveni, Z. (1993). Molecular and cell biology of skeletal muscle regeneration. Mol. Cell Biol. Hum. Dis. Ser 210, 56.

Gupta, M. P., Kogut, P., Gupta, M. (2000). Protein kinase-A dependent phosphorylation of transcription enhancer factor-1 represses its DNA-binding activity but enhances its gene activation ability. Nucleic Acids Res 28, 3168–3177.[Abstract/Free Full Text]

Janknecht, R., de Martynoff, G., Lou, J., Hipskind, R. A., Nordheim, A., Stunnenberg, H. G. (1991). Rapid and efficient purification of native histidine-tagged protein expressed by recombinant vaccinia virus. Proc. Natl. Acad. Sci. USA 88, 8972–8976.[Abstract/Free Full Text]

Kitzmann, M., Carnac, G., Vandromme, M., Primig, M., Lamb, N. J., Fernandez, A. (1998). The muscle regulatory factors MyoD and myf-5 undergo distinct cell cycle-specific expression in muscle cells. J. Cell Biol 142, 1447–1459.[Abstract/Free Full Text]

Kitzmann, M. and Fernandez, A. (2001). Crosstalk between cell cycle regulators and the myogenic factor MyoD in skeletal myoblasts. Cell Mol. Life Sci 58, 571–579.[CrossRef][Medline]

Koishi, K., Zhang, M., McLennan, I. S., Harris, A. J. (1995). MyoD protein accumulates in satellite cells and is neurally regulated in regenerating myotubes and skeletal muscle fibers. Dev. Dyn 202, 244–254.[Medline]

Kuwahara, K., Barrientos, T., Pipes, G. C., Li, S., Olson, E. N. (2005). Muscle-specific signaling mechanism that links actin dynamics to serum response factor. Mol. Cell Biol 25, 3173–3181.[Abstract/Free Full Text]

Lamb, N.J.C., Gauthier-Rouviere, C., Fernandez, A. (1996). Microinjection strategies for the study of mitogenic signaling in mammalian cells. Front. Biosci 1, d19–d29.[Medline]

Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C., Voronova, A., Baltimore, D., Weintraub, H. (1991). Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell 66, 305–315.[CrossRef][Medline]

L'honore, A., Lamb, N. J., Vandromme, M., Turowski, P., Carnac, G., Fernandez, A. (2003). MyoD distal regulatory region contains an SRF binding CArG element required for MyoD expression in skeletal myoblasts and during muscle regeneration. Mol. Biol. Cell 14, 2151–2162.[Abstract/Free Full Text]

Li, S., Czubryt, M. P., McAnally, J., Bassel-Duby, R., Richardson, J. A., Wiebel, F. F., Nordheim, A., Olson, E. N. (2005). Requirement for serum response factor for skeletal muscle growth and maturation revealed by tissue-specific gene deletion in mice. Proc. Natl. Acad. Sci. USA 102, 1082–1087.[Abstract/Free Full Text]

Martin, J. F., Schwarz, J. J., Olson, E. N. (1993). Myocyte enhancer factor (MEF) 2C: a tissue-restricted member of the MEF-2 family of transcription factors. Proc. Natl. Acad. Sci. USA 90, 5282–5286.[Abstract/Free Full Text]

Mauro, A. (1961). Satellite cells of skeletal muscle fibers. J. Biophys. Biochem. Cytol 9, 493–495.[Medline]

Muir, A. R., Kanji, A.H.M., Allbrook, D. B. (1965). The structure of satellite cells in skeletal muscle. J. Anat 99, 435–444.[Medline]

McDermott, J. C., Cardoso, M. C., Yu, Y. T., Andres, V., Leifer, D., Krainc, D., Lipton, S. A., Nadal-Ginard, B. (1993). hMEF2C gene encodes skeletal muscle- and brain-specific transcription factors. Mol. Cell Biol 13, 2564–2577.[Abstract/Free Full Text]

Megeney, L. A. and Rudnicki, M. A. (1995). Determination versus differentiation and the MyoD family of transcription factors. Biochem. Cell Biol 73, 723–732.[Medline]

Megeney, L. A., Kablar, B., Garrett, K., Anderson, J. E., Rudnicki, M. A. (1996). MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev 10, 1173–1183.[Abstract/Free Full Text]

Molkentin, J. D., Firulli, A. B., Black, B. L., Martin, J. F., Hustad, C. M., Copeland, N., Jenkins, N., Lyons, G., Olson, E. N. (1996). MEF2B is a potent transactivator expressed in early myogenic lineages. Mol. Cell Biol 16, 3814–3824.[Abstract/Free Full Text]

Mueller, C. G. and Nordheim, A. (1991). A protein domain conserved between yeast MCM1 and human SRF directs ternary complex formation. EMBO J 10, 4219–4229.[Medline]

Naidu, P. S., Ludolph, D. C., To, R. Q., Hinterberger, T. J., Konieczny, S. F. (1995). Myogenin and MEF2 function synergistically to activate the MRF4 promoter during myogenesis. Mol. Cell Biol 15, 2707–2718.[Abstract/Free Full Text]

Nelson, J. D., Denisenko, O., Sova, P., Bomsztyk, K. (2006). Fast chromatin immunoprecipitation assay. Nucleic Acids. Res 34, e2.[Abstract/Free Full Text]

Olson, E. N. and Williams, R. S. (2000a). Calcineurin signaling and muscle remodeling. Cell 101, 689–692.[CrossRef][Medline]

Olson, E. N. and Williams, R. S. (2000b). Remodeling muscles with calcineurin. Bioessays 22, 510–519.[CrossRef][Medline]

Pollock, R. and Treisman, R. (1990). A sensitive method for the determination of protein-DNA binding specificities. Nucleic Acids Res 18, 6197–6204.[Abstract/Free Full Text]

Pollock, R. and Treisman, R. (1991). Human SRF-related proteins: DNA-binding properties and potential regulatory targets. Genes Dev 5, 2327–2341.[Abstract/Free Full Text]

Ridgeway, A. G., Wilton, S., Skerjanc, I. S. (2000). Myocyte enhancer factor 2C and myogenin up-regulate each other's expression and induce the development of skeletal muscle in P19 cells. J. Biol. Chem 275, 41–46.[Abstract/Free Full Text]

Rochat, A., Fernandez, A., Vandromme, M., Molès, J.-P, Bouschet, T., Carnac, G., Lamb, N.J.C. (2004). Insulin and Wnt1 pathways cooperate to induce reserve cell activation in differentiation and myotube hypertrophy. Mol. Biol. Cell 15, 4544–4555.[Abstract/Free Full Text]

Rogerson, P. J., Jamali, M., Skerjanc, I. S. (2002). The C-terminus of myogenin, but not MyoD, targets upregulation of MEF2C expression. FEBS Lett 524, 134–138.[CrossRef][Medline]

Sabourin, L. A., Girgis-Gabardo, A., Seale, P., Asakura, A., Rudnicki, M. A. (1999). Reduced differentiation potential of primary MyoD–/– myogenic cells derived from adult skeletal muscle. J. Cell Biol 144, 631–643.[Abstract/Free Full Text]

Schultz, E., Gibson, M. C., Champion, T. (1978). Satellite cells are mitotically quiescent in mature mouse muscle: an EM and radioautographic study. J. Exp. Zool 206, 451–456.[CrossRef][Medline]

Schultz, E. and McCormick, K. M. (1994). Skeletal muscle satellite cells. Rev. Physiol. Biochem. Pharmacol 123, 213–257.[Medline]

Shore, P. and Sharrocks, A. D. (1995). The MADS-box family of transcription factors. Eur. J. Biochem 229, 1–13.[Medline]

Smith, C. K. 2nd, Janney, M. J., Allen, R. E. (1994). Temporal expression of myogenic regulatory genes during activation, proliferation, and differentiation of rat skeletal muscle satellite cells. J. Cell Physiol 159, 379–385.[CrossRef][Medline]

Sordella, R., Jiang, W., Chen, G. C., Curto, M., Settleman, J. (2003). Modulation of Rho GTPase signaling regulates a switch between adipogenesis and myogenesis. Cell 113, 147–158.[CrossRef][Medline]

Tapscott, S. J., Lassar, A. B., Weintraub, H. (1992). A novel myoblast enhancer element mediates MyoD transcription. Mol. Cell Biol 12, 4994–5003.[Abstract/Free Full Text]

Thomas, D. M., Carty, S. A., Piscopo, D. M., Lee, J. S., Wang, W. F., Forrester, W. C., Hinds, P. W. (2001). The retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation. Mol. Cell 8, 303–316.[CrossRef][Medline]

Wang, D. Z., Valdez, M. R., McAnally, J., Richardson, J., Olson, E. N. (2001). The Mef2c gene is a direct transcriptional target of myogenic bHLH and MEF2 proteins during skeletal muscle development. Development 128, 4623–4633.[Medline]

Wynne, J. and Treisman, R. (1992). SRF and MCM1 have related but distinct DNA binding specificities. Nucleic Acids Res 20, 3297–3303.[Abstract/Free Full Text]

Yablonka-Reuveni, Z. (1995). Development and postnatal regulation of adult myoblasts. Microsc. Res. Tech 30, 366–380.[CrossRef][Medline]

Yablonka-Reuveni, Z. and Rivera, A. J. (1994). Temporal expression of regulatory and structural muscle proteins during myogenesis of satellite cells on isolated adult rat fibers. Dev. Biol 164, 588–603.[CrossRef][Medline]

Yablonka-Reuveni, Z., Rudnicki, M. A., Rivera, A. J., Primig, M., Anderson, J. E., Natanson, P. (1999). The transition from proliferation to differentiation is delayed in satellite cells from mice lacking MyoD. Dev. Biol 210, 440–455.[CrossRef][Medline]

Yee, S. P. and Rigby, P. W. (1993). The regulation of myogenin gene expression during the embryonic development of the mouse. Genes Dev 7, 1277–1289.[Abstract/Free Full Text]

Zhao, Y., Samal, E., Srivastava, D. (2005). Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature 436, 214–220.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
D. Li, Z. Niu, W. Yu, Y. Qian, Q. Wang, Q. Li, Z. Yi, J. Luo, X. Wu, Y. Wang, et al.
SMYD1, the myogenic activator, is a direct target of serum response factor and myogenin
Nucleic Acids Res., November 1, 2009; 37(21): 7059 - 7071.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
Z. Yablonka-Reuveni, K. Day, A. Vine, and G. Shefer
Defining the transcriptional signature of skeletal muscle stem cells
J Anim Sci, April 1, 2008; 86(14_suppl): E207 - E216.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Camp, A. De Jaco, L. Zhang, M. Marquez, B. De La Torre, and P. Taylor
Acetylcholinesterase Expression in Muscle Is Specifically Controlled by a Promoter-Selective Enhancesome in the First Intron
J. Neurosci., March 5, 2008; 28(10): 2459 - 2470.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Angelelli, A. Magli, D. Ferrari, M. Ganassi, V. Matafora, F. Parise, G. Razzini, A. Bachi, S. Ferrari, and S. Molinari
Differentiation-dependent lysine 4 acetylation enhances MEF2C binding to DNA in skeletal muscle cells
Nucleic Acids Res., February 11, 2008; 36(3): 915 - 928.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Flanagin, J. D. Nelson, D. G. Castner, O. Denisenko, and K. Bomsztyk
Microplate-based chromatin immunoprecipitation method, Matrix ChIP: a platform to study signaling of complex genomic events
Nucleic Acids Res., February 11, 2008; 36(3): e17 - e17.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E06-09-0867v1
18/6/1992    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by L'honore, A.
Right arrow Articles by Fernandez, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by L'honore, A.
Right arrow Articles by Fernandez, A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2007 by The American Society for Cell Biology. Terms of copyright protection, warranties, and disclaimers.