![]() |
|
|
Vol. 18, Issue 6, 2081-2089, June 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




*Howard Hughes Medical Institute and Department of Cellular and Molecular Medicine, School of Medicine, University of California, San Diego, La Jolla, CA 92093-0683;
Department of Cell Biology, The Scripps Research Institute, La Jolla, CA 92037; and
Department of Physiology, University of Pennsylvania, Philadelphia, PA 19104
Submitted August 11, 2006;
Revised February 9, 2007;
Accepted March 2, 2007
Monitoring Editor: Yixian Zheng
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The actin-related protein Arp1 is the most abundant subunit of the dynactin multiprotein complex. This 45-kDa protein forms a filament composed of eight to 13 monomers, which is capped by the p37 and p32 capping proteins on one end (also known as CapZ) and the p62 subunit of dynactin on the other end. These proteins in addition to some smaller subunits, such as p25, p27, and Arp11 form a scaffold upon which p150Glued binds to the Arp1 filament through an interaction mediated by another protein called dynamitin (for review, see Schroer, 2004
). Dynein interacts with the dynactin complex via binding of the dynein IC to the p150Glued subunit of dynactin (Karki and Holzbaur, 1995
; Vaughan and Vallee, 1995
). Disruption of dynactin functions leads to phenotypes that closely mimic those observed in dynein heavy chain (DHC) and dynein light chain mutants and in antibody inhibition studies (Karki and Holzbaur, 1999
). These data suggest that dynein and dynactin work together to carry out dynein functions, although they leave unresolved the question of how dynactin function is required for dynein activity. To elucidate the function of dynactin and to test directly whether dynactin is required to attach dynein to membranes in vivo, we analyzed arp1 mutations and arp1 RNA interference in Drosophila.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunostaining
Larval segmental nerve immunostaining was performed as described previously (Hurd and Saxton, 1996
) and observed using a Bio-Rad MRC1024 confocal microscope (Gindhart et al., 1998
).
Antibodies
Anti-dynein heavy chain antibody (P1H4) (a generous gift from Tom Hays, Department of Genetics and Cell Biology, University of Minnesota, St. Paul, MN 55108), anti-p150Glued (a generous gift from Erika Holzbaur, School of Medicine, University of Pennsylvania, Philadelphia, PA 19104), anti-dynamitin (p50) (gift from Jason Duncan, Department of Cellular and Molecular Medicine, University of California, San Diego, 9500 Gilman Dr., LBR 411, La Jolla, CA 92093), anti-syntaxin (8C3) (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA), anti-kinesin heavy chain (KHC) (Cytoskeleton, Denver, CO), anti-Rab8 and cyt c (BD Biosciences Transduction Laboratories, Lexington, KY), anti-tubulin and anti-actin (Sigma-Aldrich, St. Louis, MO), anti-dynein intermediate chain (Chemicon International, Temecula, CA), and anti-d120 (Calbiochem, San Diego, CA) were used as described.
Arp1 Fusion Protein and Antibody Preparation
Seven Arp1 expressed sequence tag clones were found in the Berkeley Drosophila Genome Project database. Only one contained a complete Arp1 cDNA (clone GH17B). This clone was purchased from Research Genetics (Huntsville, AL), fully sequenced, and then subcloned into the pET-23b vector (Novagen, Madison, WI), which includes a 6x His tag at the C terminus. The expressed fusion protein was purified using nickel-nitrilotriacetic acid agarose resins (QIAGEN, Valencia, CA), electrophoretically isolated, and used to raise antisera in rabbits (Lampire Biological Laboratories, Pipersville, PA). The specificity of the Drosophila Arp1 antibody was confirmed by Western blotting: a 1:10,000 dilution of the serum detected 5 ng of the recombinant protein and also detected Arp1 in 10 µg of total protein from larval brain extracts. We concluded that the Arp1 antibody cross-reacts with actin, based on the observation that reduction of Arp1 reactivity after arp1 double-stranded RNA (dsRNA) treatment is not obvious in the high-speed supernatant where actin is abundant, whereas reduction of Arp1 in the high-speed pellet fraction where no actin can be detected is obvious (Figure 2A). In addition, sucrose density sedimentation analyses of high-speed supernatants showed a peak at
8S with sedimentation behavior that is identical to actin in both green fluorescent protein (GFP) dsRNA and arp1 dsRNA-treated S2 cells (Figure 2, C and D). This peak is not observed in the high-speed pellet fraction where no actin can be detected (Figure 2, E and F).
S2 Cell Culture
S2 cells were grown and maintained in Schneider's Drosophila medium (Invitrogen, Carlsbad, CA)/10% fetal bovine serum at room temperature. dsRNA was generated using the Megascript RNA interference (RNAi) kit (Ambion, Austin, TX) from a 500-base pair polymerase chain reaction (PCR) product by using primers that contain the T7 RNP sequence on the end (Eaton et al., 2002
). The dsRNA (25 µg) was added to 2 x 106 cells in a six-well plate in 1 ml of serum-free media. After 30 min, 3 ml of complete medium was added to each well. Cells were harvested for analysis after 5 d. For reverse transcriptase-quantitative PCR (RT-qPCR), total RNA from S2 cells was prepared using the RNeasy kit (QIAGEN). The RNA was subsequently treated with DNAse1 by using the DNA-free kit (Ambion). First-strand cDNA was generated using SuperScript First-Strand Synthesis system (Invitrogen) for RT-PCR and quantitative PCR was performed in an Mx3000P cycler (Stratagene, La Jolla, CA) by using Brilliant SYBR Green QPCR Master Mix. The percentage reduction of arp1 mRNA was determined by normalizing to a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control. Primers used for arp1 were forward, tccgaactgaagaaacactcg and reverse, ctgtccctcctcctcgtattc and for GAPDH were forward, aattaaggccaaggttcagga and reverse, accaagagatcagcttcacga.
Sucrose Density Gradient
For sucrose density gradient analysis of Drosophila larval brains, 250 arp11 larval brains and 80 wild-type brains were dissected and homogenized in PMEG buffer [0.1 M piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.9, 5 mM EGTA, 0.9M glycerol, 5 mM MgSO4, 0.1 mM EDTA, 0.5 mM dithiothreitol (DTT), and protease inhibitors] (Hays et al., 1994
). The high-speed supernatant was prepared by centrifugation at 50,000 rpm for 40 min in a TLA100.3 rotor (Beckman Coulter, Fullerton, CA), and then overlaid on a continuous 520% sucrose gradient and centrifuged at 35,000 rpm for 16 h in a SW41 rotor (Beckman Coulter). For sucrose density gradient analysis of S2 cells, arp1 dsRNA-treated cells and GFP dsRNA-treated cells were homogenized in buffer A (50 mM Tris, 150 mM NaCl, pH 7.4, and 0.5 mM EDTA) plus protease inhibitors, centrifuged sequentially 10 min at 1000 x g, 10 min at 10,000 x g, and 50 min at 100,000 x g. The high-speed supernatant (HSS) was collected and the high-speed pellet (HSP) was resuspended in buffer A + 1% Triton X-100. HSS and HSP were overlaid on a continuous 520% sucrose gradient prepared in buffer A and centrifuged at 35,000 rpm for 16 h in a SW41 rotor. Then, 0.5-ml fractions were collected, and total proteins were precipitated and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) and Western blot. Gradients loaded with the markers carbonic anhydrase, bovine serum albumin, alcohol dehydrogenase,
-amylase, catalase, apoferritin, and thyroglobulin were run in parallel as standards to determine 2.8S, 4.2S, 7.5S, 9S, 11S, 17S and 19S, respectively.
Membrane Flotation Assay
Third instars were individually hand dissected, and
250 brains were collected into dissection buffer (2X stock contains 128 mM NaCl, 4 mM CaCl2, 4 mM MgCl2, 2 mM KCl, 5 mM HEPES, and 36 mM sucrose, pH 7.2). The brains were homogenized in acetate buffer (10 mM HEPES, pH 7.4, 100 mM K-acetate, 150 mM sucrose, 5 mM EGTA, 3 mM Mg-acetate, 1 mM DTT, and protease inhibitors). Debris was removed by centrifugation at 1000 x g for 7 min, and the resulting postnuclear supernatant (PNS) was brought to 40% sucrose, bottom loaded, and overlaid with two cushions of 35 and 8% sucrose. The gradient was centrifuged at 50,000 rpm in a TLS55 rotor (Beckman Coulter, Fullerton, CA) for 1 h. Light membranous organelles and membrane-associated proteins floated to the 35/8 interface, whereas heavier membranes and mitochondria are found in the pellet. Equal amounts of protein from each fraction were analyzed by SDS-PAGE and Western blotting. For flotation analysis of S2 cells, arp1 dsRNA-treated cells and GFP dsRNA-treated cells were homogenized in homogenization buffer (HB; 8% sucrose and 3 mM imidazole, pH 7.4). A PNS was prepared and membrane fractionation was performed as described above. Fractions were collected, and equal amounts of proteins were analyzed by SDS-PAGE and Western blotting.
Real-Time Movies and Quantification
Amyloid precursor protein (APP) was C-terminally tagged with yellow fluorescent protein (YFP) and expressed under GAL4/UAS control using the P(Gal4)SG26.1 line (Kaether et al., 2000
; Gunawardena et al., 2003
). Crosses were made and female larvae with the genotype UAS-APP-YFP/+; P(Gal4)SG26.1/+; arp11/arp11 were filleted in a calcium free dissection buffer. Larvae were positioned with the ventral ganglion on the left and the segmental nerves projecting to the right. Movies were recorded using an Eclipse TE-2000-U inverted microscope (Nikon, Tokyo, Japan) at 100x magnification at 10 frames per second and a CoolSNAP HQ cooled charge-coupled device camera driven by a MetaMorph imaging system version 5.0 (Molecular Devices, Sunnyvale, CA). We recorded 150 frames for each movie at 10 frames/s and 2 x 2 binning. For mitochondria, the leader peptide plus two amino acids (23 amino acids in toto) of human cytochrome oxidase subunit 8 was fused to GFP and expressed under GAL4/UAS control using P(GawB)D42 line. Because many mitochondria are stationary, a zone of bleached fluorescence was generated, and mitochondrial movement into the bleached zone was assessed using an MRC600 confocal microscope to collect 300 frames at a rate of 1 frame/s. For APP-YFP, kymographs were generated from movies using MetaMorph software and analyzed using MetaMorph and MATLAB 7.0 (MathWorks, Natick, MA). We determined particle populations, velocities, pause frequencies, and reversal frequencies based on the coordinates of each track traced on a particular kymograph. Net velocity was defined as the net distance traveled divided by the time elapsed during an entire movie (15 s). Segment velocity was defined as the total distance traveled by a particle during a particular run, divided by the duration of the run. A run could be terminated by a pause, reversal, or the end of the movie, and a run was a minimum of 10 frames (1 s) in length. Although run lengths were used to calculate velocities and determine pause or reversal points, we do not report explicit run lengths (cf. Gross et al., 2002) because of significant inaccuracies resulting from runs already underway at the beginning of a movie, or observations that are prematurely terminated at the end of a movie. Instead, we assume that pauses reflect the dissociation of a motor from a microtubule after taking a number of discrete steps, and therefore, pause frequency per unit distance serves as an indirect measure of processivity. We defined pauses as an absence of directed movement (<0.1 µm/frame in either direction) for at least 1 s for all moving particles. We report pause frequency as the number of pauses per micrometer of distance traveled by a given particle. Reversals were defined as a sustained change in direction of motion for at least 1 s; brief changes in direction occurring at subsampling scales were not detectable by the analyses. Stationary particles were defined as particles moving a distance of <1.5 µm (0.1 µm/frame in either direction) over the course of the entire 15-s movie. Thirty-three movies of axons from mutant larvae were analyzed, of which 16 movies had no particle motion whatsoever (i.e., only contained accumulations). Quantitative motion analysis was performed on the remaining 17 movies that did contain some moving particles. Some of these movies (11 of 17) revealed both moving particles and dense accumulations containing a large number of nonmoving particles. In these movies, because the number of stationary particles was impossible to count accurately, we set the maximum number of stationary particles per movie arbitrarily to 20. This procedure led to a conservative underestimate of the actual number of stationary cargoes. Only three wild-type movies were analyzed because the total number of moving particles in these three movies (n = 107) exceeded the number of moving particles in the 17 mutant movies (n = 54).
Online Supplemental Material
Online supplemental material describes detailed genetics experiments on arp1 mutant and addresses whether dynactin is required for all dynein functions in Drosophila. Movies have been provided of APPYFP particle motion in wild-type (FigS3videoA.mov) and arp11 mutant (FigS3videoB.mov and FigS3videoC.mov) Drosophila segmental motor neuron axons. Kymographs in Figure 3, AC, correspond to these videos. Additionally, movies of mitochondrial motion in wild-type (FigS3videoD.mov) and arp11 mutant (FigS3videoE.mov) axons have been shown. Time-lapse panels from these movies are shown in Supplemental Figure 3, D and E. Imaging parameters are as described in Materials and Methods, with frames collected every 100 ms for 15 s for APP-YFP and every second for 300 s for mitochondria.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
18S, indicating that they exist as a complex (Paschal et al., 1993
17S-, as expected. In the arp11 mutant, however, there is a significant shift such that the dynactin subunit p50 occurs in a peak at
4S8S, suggesting that the arp11 mutants cause complete disruption of the dynactin complex. The arp11 mutation leads to the disappearance of the Arp1 peak at 17S-, whereas a peak at
8S due to cross-reaction of our antibody with actin is still visible (Figures 1F and 2, C and D; see Materials and Methods).
To confirm and extend these observations, we used a Drosophila S2 cell culture system. S2 cells were grown in the presence of arp1 dsRNA or a GFP dsRNA as a negative control. Soluble (HSS) and membrane (HSP) fractions were analyzed by Western blotting. As observed in brains of arp11 mutant larvae, reduction of Arp1 mRNA (Figure 2B) and protein levels (Figure 2A) induces substantial reductions in the protein levels of both p150Glued and p50, whereas the levels of DHC and KHC remain unchanged. We then performed sucrose density gradient analyses. To detect p50 and p150Glued in the arp1 dsRNA-treated samples, longer exposure times were required. In both the soluble and membrane fractions, arp1 dsRNA treatment caused p50 and p150Glued subunits to shift from
17S to
8S, whereas DHC and KHC remained unchanged, peaking at 17S and 8S, respectively, in both conditions (Figure 2, CF). In the control, GFP dsRNA sample, the soluble dynactin subunits did not completely overlap in one single peak, whereas the membrane associated dynactin subunits displayed partial cofractionation such that ARP1 primarily cofractionated with DHC, and p150Glued primarily cofractionated with p50. Why the two sets of proteins have slightly different sedimentation profiles is unclear and might be caused by the stringency of the experimental conditions used or by a previously unsuspected instability of the soluble dynactin pool in S2 cells. Importantly, however, loss of Arp1 causes a clear disruption of the dynactin complex, such that the fractions that do contain DHC do not overlap with fractions containing dynactin subunits. Thus, similar to dynamitin overexpression (Echeverri et al., 1996
) (Eckley et al., 1999
), our results show that Arp1 mutation or deletion leads to disruption of the dynactin complex, in addition to reduction in the levels of both p150Glued and p50. Our results also suggest that the membrane-associated dynactin complex is more stable than the soluble dynactin complex in S2 cells.
|
|
The moving particles in the arp11 mutant animals had a much slower segment velocities than in wild type and traveled shorter distances (i.e., displayed slower net velocities) (Figure 3, EG). Processivity was also affected in both directions, because there was an increased number of pauses per micrometer traveled in arp1 axons compared with wild type (Figure 3H). Estimating run lengths revealed that only 5% of anterograde runs in the arp11 mutant animals were longer than 13 µm, whereas fully 40% of anterograde runs in wild-type were longer than 13 µm and 18% were 25 µm or greater. Retrograde runs had similar behavior; only 3% of retrograde runs in the arp11 mutant animals were longer than 13 µm, whereas fully 40% of retrograde runs in wild-type were longer than 13 µm and 5% were 25 µm or greater. No retrograde runs in the arp11 mutant animals were longer than 19 µm, whereas 11% of retrograde runs in wild-type were longer than 19 µm. These quantitative analyses suggest that the slower net velocities in both anterograde and retrograde particle pools are a result of both slower segment velocities as well as increased pause frequency. (Figure 3, B, C, D, and H). Our analysis of a limited number of particle reversals indicates a trend toward increased reversal from anterograde to retrograde movement in arp11 mutant axons, suggesting an additional role of dynactin in coordinating the activity of opposing motors on the same particle (Figure 3I).
Anterograde and retrograde mitochondrial movement was also reduced in the arp11 mutant compared with wild type (Supplemental Figure 3, D and E). This is in contrast with the recent observation that a dominant negative allele of p150Glued showed an increase in anterograde and retrograde movement of mitochondria (Pilling et al., 2006
). Thus, although our biochemical analyses demonstrate that arp11 mutations lead to disruption of the dynactin complex, heterozygous expression of a dominant-negative allele of p150Glued must retain sufficient function for mitochondrial transport (McGrail et al., 1995
).
A trivial cause of the lack of particle movement within the axons of arp11 mutant larvae could be that arp11 mutant neurons or animals are sick or dying. Two observations argue, however, that the motility defects observed are specifically caused by loss of dynactin function on vesicles or organelles. First, in previous work we found that intentionally inducing neuronal cell death did not cause defects in vesicle transport (Gunawardena et al., 2003
). Second, we observed that arp11 mutant siblings that were not dissected for live imaging survived at least another 48 h. Thus, although we cannot fully exclude the possibility of transport defects secondary to global neuronal toxicity, it seems likely that the loss of a functional dynactin complex has a direct effect on organelle processivity and motility.
To test directly whether dynactin is required to link dynein to membranous organelles, we examined the amount of membrane-bound dynein in arp11 mutant animals and in arp1 dsRNA-treated S2 cells. We performed subcellular fractionation of larval brains or S2 cell extracts by membrane flotation on sucrose step gradients (Figure 4A). We observed no significant difference in the amount of dynein that was associated with the membranes enriched in the 35/8 sucrose interface in wild-type compared with the arp11 mutant brains (Figure 4B). Membrane-associated proteins such as syntaxin were mainly present in the membrane fraction and not in the soluble pool, as expected. To confirm and extend these observations, we also analyzed membrane fractions prepared from arp1 dsRNA-treated S2 cells. As reported in Figure 2A, and similar to what we saw with larval brains, we found that the levels of both p50 and p150Glued are substantially reduced in membrane fractions in the 35/8 sucrose interface from the arp1 dsRNA-treated S2 cells (Figure 4C). Although the overall levels of membrane associated DHC are lower in S2 cells than in larval brains, we consistently found that in both control and arp1 dsRNA-treated cells, equivalent amounts of DHC are associated with membrane fractions enriched in Golgi and mitochondria. This result confirms the observation that in arp1 dsRNA-treated S2 cells, the amount of dynein associated with a membrane fraction prepared by high-speed centrifugation is not altered (Figure 2A). Our results thus suggest that recruitment of dynein to membranous organelles, including Golgi and mitochondria enriched fractions, is independent of an intact dynactin complex. It is possible, however, that smaller amounts of a disrupted dynactin complex on membranous compartment is sufficient to recruit DHC. In this regard, it is worth noting that the membrane-associated pool of p50 partially cofractionates with DHC in the absence of p150Glued and Arp1 (Figure 2F). Although DHC might be recruited onto membranes by binding to a p50 subcomplex, this binding might not be efficient as suggested by our analyses of moving vesicles and organelles.
|
Our observation that the arp11 mutant also disrupts anterograde movement of APP-containing vesicles and mitochondria does not easily fit the proposal that the regulatory function of dynactin is restricted to the processivity of dynein. Interestingly, depletion of Arp1 may have reduced the levels of KHC on membranes (Figure 4C). Although the degree of reduction is small, it may suggest how dynactin functions in anterograde movement. Whether dynactin in fact plays a direct role in kinesin recruitment to membranes will require further investigation. Nonetheless, our data are consistent with an additional role for dynactin in regulating anterograde motors such as kinesin, or as recently proposed, a role in coordinating plus and minus-enddirected transport (Gross et al., 2000
, 2002a
,b
). In particular, a dominant mutation in p150Glued severely impaired "anterograde" motion of lipid droplets in Drosophila embryos. Similarly, disruption of dynactin by overexpressing dynamitin inhibited movement of endosomes in both directions (Valetti et al., 1999
). Finally, biochemical support for a role of dynactin in coordinating plus- and minus-enddirected movements comes from the finding that a subunit of kinesin II can interact with p150Glued (Deacon et al., 2003
) and that dynein interacts directly with kinesin light chain (Ligon et al., 2004
). Thus, our data, combined with earlier work, suggests that the in vivo function of dynactin is to regulate and/or coordinate bidirectional motility, but that dynactin may not be required to link dynein to membranes.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
![]()
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
These authors contributed equally to this work. ![]()
Address correspondence to: Lawrence S.B. Goldstein (lgoldstein{at}ucsd.edu).
Abbreviations used: Arp1, actin-related protein 1; DHC, dynein heavy chain; KHC, kinesin heavy chain; p50, dynamitin; PNS, postnuclear supernatant; HSP, high-speed pellet; HSS, high-speed supernatant.
| REFERENCES |
|---|
|
|
|---|
Bowman, A. B., Kamal, A., Ritchings, B. W., Philp, A. V., McGrail, M., Gindhart, J. G., Goldstein, L. S. (2000). Kinesin-dependent axonal transport is mediated by the Sunday driver (SYD) protein. Cell 103, 583594.[CrossRef][Medline]
Bowman, A. B., Patel-King, R. S., Benashski, S. E., McCaffery, J. M., Goldstein, L. S., King, S. M. (1999). Drosophila roadblock and Chlamydomonas LC 7, a conserved family of dynein-associated proteins involved in axonal transport, flagellar motility, and mitosis. J. Cell Biol. 146, 165180.
Clark, S. W. and Meyer, D. I. (1994). ACT 3, a putative centractin homologue in S. cerevisiae is required for proper orientation of the mitotic spindle. J. Cell Biol. 127, 129138.
Deacon, S. W., Serpinskaya, A. S., Vaughan, P. S., Lopez Fanarraga, M., Vernos, I., Vaughan, K. T., Gelfand, V. I. (2003). Dynactin is required for bidirectional organelle transport. J. Cell Biol. 160, 297301.
Eaton, B. A., Fetter, R. D., Davis, G. W. (2002). Dynactin is necessary for synapse stabilization. Neuron 34, 729741.[CrossRef][Medline]
Echeverri, C. J., Paschal, B. M., Vaughan, K. T., Vallee, R. B. (1996). Molecular characterization of the 50-kD subunit of dynactin reveals function for the complex in chromosome alignment and spindle organization during mitosis. J. Cell Biol. 132, 617633.
Eckley, D. M., Gill, S. R., Melkonian, K. A., Bingham, J. B., Goodson, H. V., Heuser, J. E., Schroer, T. A. (1999). Analysis of dynactin subcomplexes reveals a novel actin-related protein associated with the arp1 minifilament pointed end. J. Cell Biol. 147, 307320.
Gindhart, J. G. Jr, Desai, C. J., Beushausen, S., Zinn, K., Goldstein, L. S. (1998). Kinesin light chains are essential for axonal transport in Drosophila. J. Cell Biol. 141, 443454.
Gross, S. P., Tuma, M. C., Deacon, S. W., Serpinskaya, A. S., Reilein, A. R., Gelfand, V. I. (2002a). Interactions and regulation of molecular motors in Xenopus melanophores. J. Cell Biol. 156, 855865.
Gross, S. P., Welte, M. A., Block, S. M., Wieschaus, E. F. (2000). Dynein-mediated cargo transport in vivo. A switch controls travel distance. J. Cell Biol. 148, 945956.
Gross, S. P., Welte, M. A., Block, S. M., Wieschaus, E. F. (2002b). Coordination of opposite-polarity microtubule motors. J. Cell Biol. 156, 715724.
Gunawardena, S., Her, L. S., Brusch, R. G., Laymon, R. A., Niesman, I. R., Gordesky-Gold, B., Sintasath, L., Bonini, N. M., Goldstein, L. S. (2003). Disruption of axonal transport by loss of huntingtin or expression of pathogenic polyQ proteins in Drosophila. Neuron 40, 2540.[CrossRef][Medline]
Hafezparast, M., et al. (2003). Mutations in dynein link motor neuron degeneration to defects in retrograde transport. Science 300, 808812.
Hays, T. S., Porter, M. E., McGrail, M., Grissom, P., Gosch, P., Fuller, M. T., McIntosh, J. R. (1994). A cytoplasmic dynein motor in Drosophila: identification and localization during embryogenesis. J. Cell Sci. 107, 15571569.[Abstract]
Horiuchi, D., Barkus, R. V., Pilling, A. D., Gassman, A., Saxton, W. M. (2005). APLIP1, a kinesin binding JIP-1/JNK scaffold protein, influences the axonal transport of both vesicles and mitochondria in Drosophila. Curr. Biol. 15, 21372141.[CrossRef][Medline]
Hurd, D. D. and Saxton, W. M. (1996). Kinesin mutations cause motor neuron disease phenotypes by disrupting fast axonal transport in Drosophila. Genetics 144, 10751085.[Abstract]
Kaether, W. M., Skehel, C. P., Dotti, C. G. (2000). Axonal membrane proteins are transported in distinct carriers: a two-color video microscopy study in cultured hippocampal neurons. Mol. Biol. Cell 11, 12131224.
Karki, S. and Holzbaur, E. L. (1995). Affinity chromatography demonstrates a direct binding between cytoplasmic dynein and the dynactin complex. J. Biol. Chem. 270, 2880628811.
Karki, S. and Holzbaur, E. L. (1999). Cytoplasmic dynein and dynactin in cell division and intracellular transport. Curr. Opin. Cell Biol. 11, 4553.[CrossRef][Medline]
King, S. J. and Schroer, T. A. (2000). Dynactin increases the processivity of the cytoplasmic dynein motor. Nat. Cell Biol. 2, 2024.[CrossRef][Medline]
Ligon, L. A., Tokito, M., Finklestein, J. M., Grossman, F. E., Holzbaur, E. L. (2004). A direct interaction between cytoplasmic dynein and kinesin I may coordinate motor activity. J. Biol. Chem. 279, 1920119208.
Mallik, R. and Gross, S. P. (2004). Molecular motors: strategies to get along. Curr. Biol. 14, R971R982.[CrossRef][Medline]
Martin, M., Iyadurai, S. J., Gassman, A., Gindhart, J. G. Jr, Hays, T. S., Saxton, W. M. (1999). Cytoplasmic dynein, the dynactin complex, and kinesin are interdependent and essential for fast axonal transport. Mol. Biol. Cell 10, 37173728.
McGrail, M., Gepner, J., Silvanovich, A., Ludmann, S., Serr, M., Hays, T. S. (1995). Regulation of cytoplasmic dynein function in vivo by the Drosophila Glued complex. J. Cell Biol. 131, 411425.
Muresan, V., Stankewich, M. C., Steffen, W., Morrow, J. S., Holzbaur, E. L., Schnapp, B. J. (2001). Dynactin-dependent, dynein-driven vesicle transport in the absence of membrane proteins: a role for spectrin and acidic phospholipids. Mol. Cell 7, 173183.[CrossRef][Medline]
Paschal, B. M., Holzbaur, E. L., Pfister, K. K., Clark, S, Meyer, D. I, Vallee, R. B. (1993). Characterization of a 50-kDa polypeptide in cytoplasmic dynein preparations reveals a complex with p150GLUED and a novel actin. J. Biol. Chem. 268, 1531815323.
Pilling, A. D., Horiuchi, D., Lively, C. M., Saxton, W. M. (2006). Kinesin-1 and dynein are the primary motors for fast transport of mitochondria in Drosophila motor axons. Mol. Biol. Cell 17, 20572068.
Puls, I., et al. (2003). Mutant dynactin in motor neuron disease. Nat. Genet. 33, 455456.[CrossRef][Medline]
Schroer, T. A. (2004). Dynactin. Annu. Rev. Cell Dev. Biol. 20, 759779.[CrossRef][Medline]
Tai, A. W., Chuang, J. Z., Bode, C., Wolfrum, U., Sung, C. H. (1999). Rhodopsin's carboxy-terminal cytoplasmic tail acts as a membrane receptor for cytoplasmic dynein by binding to the dynein light chain Tctex-1. Cell 97, 877887.[CrossRef][Medline]
Tynan, S. H., Purohit, A., Doxsey, S. J., Vallee, R. B. (2000). Light intermediate chain 1 defines a functional subfraction of cytoplasmic dynein which binds to pericentrin. J. Biol. Chem. 275, 3276332768.
Valetti, C., Wetzel, D. M., Schrader, M., Hasbani, M. J., Gill, S. R., Kreis, T. E., Schroer, T. A. (1999). Role of dynactin in endocytic traffic: effects of dynamitin overexpression and colocalization with CLIP-170. Mol. Biol. Cell 10, 41074120.
Vaughan, K. T. and Vallee, R. B. (1995). Cytoplasmic dynein binds dynactin through a direct interaction between the intermediate chains and p150Glued. J. Cell Biol. 131, 15071516.
Waterman-Storer, C. M., Karki, S. B., Kuznetsov, S. A., Tabb, J. S., Weiss, D. G., Langford, G. M., Holzbaur, E. L. (1997). The interaction between cytoplasmic dynein and dynactin is required for fast axonal transport. Proc. Natl. Acad. Sci. USA 94, 1218012185.
Yano, H., Lee, F. S., Kong, H., Chuang, J., Arevalo, J., Perez, P., Sung, C., Chao, M. V. (2001). Association of Trk neurotrophin receptors with components of the cytoplasmic dynein motor. J. Neurosci. 21, RC125.
This article has been cited by other articles:
![]() |
K. J. Palmer, H. Hughes, and D. J. Stephens Specificity of Cytoplasmic Dynein Subunits in Discrete Membrane-trafficking Steps Mol. Biol. Cell, June 15, 2009; 20(12): 2885 - 2899. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Kardon, S. L. Reck-Peterson, and R. D. Vale Regulation of the processivity and intracellular localization of Saccharomyces cerevisiae dynein by dynactin PNAS, April 7, 2009; 106(14): 5669 - 5674. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Lien, V. I. Gelfand, and V. Vasioukhin {alpha}-E-catenin binds to dynamitin and regulates dynactin-mediated intracellular traffic J. Cell Biol., December 15, 2008; 183(6): 989 - 997. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. P. Iyadurai, J. T. Robinson, L. Ma, Y. He, S. Mische, M.-g. Li, W. Brown, A. Guichard, E. Bier, and T. S. Hays Dynein and Star interact in EGFR signaling and ligand trafficking J. Cell Sci., August 15, 2008; 121(16): 2643 - 2651. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Shim, B. A. Samuels, J. Wang, G. Neumayer, C. Belzil, R. Ayala, Y. Shi, Y. Shi, L.-H. Tsai, and M. D. Nguyen Ndel1 Controls the Dynein-mediated Transport of Vimentin during Neurite Outgrowth J. Biol. Chem., May 2, 2008; 283(18): 12232 - 12240. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Laird, M. H. Farah, S. Ackerley, A. Hoke, N. Maragakis, J. D. Rothstein, J. Griffin, D. L. Price, L. J. Martin, and P. C. Wong Motor Neuron Disease Occurring in a Mutant Dynactin Mouse Model Is Characterized by Defects in Vesicular Trafficking J. Neurosci., February 27, 2008; 28(9): 1997 - 2005. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||