![]() |
|
|
Vol. 18, Issue 9, 3486-3501, September 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


,
,
*Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892;
Sansom Institute, University of South Australia, Adelaide, SA 5001, Australia; and
Lysosomal Diseases Research Unit, Department of Genetic Medicine, Children Youth and Women's Health Service, North Adelaide, SA 5006, Australia
Submitted March 1, 2007;
Revised June 11, 2007;
Accepted June 18, 2007
Monitoring Editor: Sandra Schmid
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Among these are the transmembrane, cation-dependent (CD) and cation-independent (CI) mannose 6-phosphate receptors (MPRs) that sort newly synthesized lysosomal hydrolase precursors from the trans-Golgi network (TGN) to the endosomal-lysosomal system in mammals (Kornfeld, 1992
; Ghosh et al., 2003a
). This sorting begins with the binding of the hydrolase precursors, via mannose 6-phosphate groups on their N-linked oligosaccharide chains, to the luminal domains of the MPRs. The cytosolic tails of the MPRs, in turn, interact with two types of clathrin adaptor, the monomeric GGA proteins (Puertollano et al., 2001
; Takatsu et al., 2001
; Zhu et al., 2001
) and the heterotetrameric AP1 complex (Höning et al., 1997
; Doray et al., 2002
; Ghosh and Kornfeld, 2004
), leading to the concentration of the hydrolase-precursor–MPR complexes within clathrin-coated areas of the TGN (Klumperman et al., 1993
; Le Borgne and Hoflack, 1997
). Clathrin-coated vesicles (CCVs) or pleiomorphic transport carriers (TCs) then form and deliver the hydrolase-precursor–MPR complexes to endosomes (Waguri et al., 2002
; Puertollano et al., 2003
; Polishchuck et al., 2006
). The hydrolase precursors subsequently dissociate from the MPRs and the former are carried to lysosomes with the fluid phase, where they become proteolytically processed to mature, active hydrolases. The unoccupied MPRs, on the other hand, return to the TGN to mediate further cycles of hydrolase precursor sorting.
The GGA proteins (i.e., GGA1, GGA2, and GGA3 in humans; Bonifacino, 2004
; Ghosh and Kornfeld, 2004
) are single-chain polypeptides comprising folded VHS, GAT, and GAE domains that are linked by largely unstructured segments. The link connecting the GAT and GAE domains is quite long and is referred to as "hinge." AP1 (Robinson, 2004
; Owen et al., 2004
), on the other hand, is an oligomer, comprising four subunits named
1,
1, µ1, and
1, the latter three of which occur as two or three isoforms. The N-terminal portions of
1 and
1, plus the entire µ1 and
1 subunits, assemble into a folded "core" domain, whereas the C-terminal portions of
1 and
1 constitute largely unstructured "hinge" segments that end in globular "ear" domains. Despite their different quaternary structures, the GGAs and AP1 share some common structural and functional features. The VHS-GAT domains of the GGAs and the core domain of AP1, for example, participate in membrane recruitment and cargo recognition. The hinge domains of both types of adaptor bind clathrin. Finally the GAE domains of the GGAs and the ear domain of the
1-adaptin subunit of AP1 (herein commonly referred to as GAE for gamma-adaptin ear) are structurally related and bind a common set of accessory proteins.
The GAE domains consist of an eight-stranded immunoglobulin-like
-sandwich (Nogi et al., 2002
; Collins et al., 2003
; Miller et al., 2003
). The surface of these domains share two shallow hydrophobic depressions that bind sequences conforming to the
G[PDE][
LM] motif (
is an aromatic residue; pattern denoted according to PROSITE syntax; Mattera et al., 2004
) or related motifs (Kent et al., 2002
; Nogi et al., 2002
; Collins et al., 2003
; Miller et al., 2003
; Mattera et al., 2003
) on the accessory proteins. Among the proteins that are known to bind GAE domains through such motifs are rabaptin-5 (Hirst et al., 2000
; Doray and Kornfeld, 2001
; Shiba et al., 2002
; Mattera et al., 2003
),
-synergin (Page et al., 1999
; Hirst et al., 2000
; Takatsu et al., 2000
), NECAP1 and NECAP2 (Ritter et al., 2003
; Mattera et al., 2004
), aftiphilin (Mattera et al., 2004
),
-BAR (Neubrand et al., 2005
), a protein known as Clint, enthoprotin, or epsinR (Kalthoff et al., 2002
; Wasiak et al., 2002
; Hirst et al., 2003
; Mills et al., 2003
), and p56 (Collins et al., 2003
; Lui et al., 2003
). The functions of these accessory proteins vis-à-vis their interactions with the GGAs and AP1 remain poorly understood.
Gene ablation and RNA interference (RNAi) approaches have been used to assess the requirement of the MPRs, the GGAs, AP1, and clathrin for the sorting of acid hydrolase precursors. Studies of MPR-deficient mice showed that both MPRs play partially redundant roles in this process (Koster et al., 1993
; Ludwig et al., 1993
; Ludwig et al., 1996
). The GGAs, however, appear to be nonredundant, because concurrent expression of all three human proteins is required for the sorting of cathepsin D to lysosomes, as shown by RNAi in HeLa cells (Ghosh et al., 2003b
). This nonredundancy has been attributed to the destabilization of the two remaining GGAs when any one of them is missing. Both gene deletion in mice and RNAi in cultured human cells have shown that AP1 is also required for acid hydrolase sorting (Meyer et al., 2000
; Hirst et al., 2005
). Paradoxically, ablation of the clathrin heavy-chain gene in chicken DT40 cells was shown not to affect acid hydrolase sorting (Wettey et al., 2002
), suggesting that clathrin might be dispensable for lysosomal sorting. This conclusion, however, conflicts with observations made using an antisense RNAi approach (Iversen et al., 2003
). The requirement of most GGA- and AP1-accessory proteins in acid hydrolase sorting remains to be assessed.
In this study, we have investigated the involvement of the accessory protein, p56, in lysosomal sorting. Extending previous studies (Lui et al., 2003
), we show that p56 colocalizes and interacts preferentially with the GGAs in vivo. p56 is, thus, the only TGN accessory protein described so far that displays specificity for the GGAs relative to AP1. Surprisingly, we find that depletion of any one GGA using synthetic siRNAs does not affect the levels or TGN localization of the other two GGAs. However, depletion of the GGAs does decrease the levels and TGN localization of p56. Depletion of p56, the GGAs or clathrin causes various degrees of missorting of the precursor form of the acid hydrolase, cathepsin D. In the case of p56 depletion, this missorting correlates with decreased mobility of GGA-containing TCs. Transfection with an RNAi-resistant p56 construct but not with a p56 construct lacking the GAE-interacting motif restores the mobility of the TCs. We conclude that p56 tightly cooperates with the GGAs and clathrin in the sorting of cathepsin D to lysosomes, probably by enabling the movement of GGA-containing TCs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
1-adaptin, 9E10 to the Myc epitope, and clone 23 to the clathrin heavy chain (CHC; BD Biosciences, San Diego, CA); AC-40 to actin (Sigma-Aldrich, St. Louis, MO). The mouse monoclonal antibodies 6A1 to the VHS domain of human GGA1 and 4D2.5 to the hinge domain of human GGA2 were generated as previously described (Zola and Brooks, 1981
Recombinant DNA Procedures
For all p56 constructs, a cDNA encoding full-length isoform 1 of human p56 (GenBank/EMBL/DDBJ accession number NM_018318; Origene, Rockville, MD) was used as a template. Full-length p56 was obtained by PCR amplification and cloned in frame into the XhoI and SmaI sites of the pEYFP-C1 and pECFP-C1 (Cerulean variant) vectors (BD Biosciences Clontech, Palo Alto, CA; Rizzo et al., 2004
). Myc epitope-tagging at the N-terminus of p56 was performed through PCR amplification of the full-length p56 cDNA and cloning of this product in frame into the EcoRI and XbaI sites of the mammalian expression vector pCI-Myc3 (Martina et al., 2003
). A construct lacking the N-terminal, GGA-interacting segment of p56 was cloned in frame into the EcoRI and XbaI sites of the pCI-Myc3 vector (Myc-
N-p56; residues 125–441) using the same approach. The cloning of the Myc-epitope–tagged GGA1, Myc-epitope–tagged GGA3, and untagged GGA1 into pEYFP-C1 vector was described previously (Dell'Angelica et al., 2000
; Puertollano et al., 2003
). The nucleotide sequences of all these recombinant constructs were confirmed by dideoxy sequencing. To generate the cyan (Cerulean variant) fluorescent protein (CFP)-tagged GGA1 and AP1-
1, untagged human GGA1 and
1-adaptin subunit of AP1 (excised from an AP1-
1-GFP construct provided by Lois Greene (National Heart, Lung, and Blood Institute, National Institutes of Health [NIH]; Wu et al., 2003
) were cloned in frame into the EcoRI and SalI, and XhoI and BamHI of pECFP-C2 and pECFP-N1 (BD Biosciences Clontech; Rizzo et al., 2004
), respectively.
Cell Culture and Transfections
HeLa (human epithelial), Jurkat (human T lymphoblast), SK-N-SH (human neuroblastoma), SK-N-MC (human neuroepithelioma), H4 (human neuroglioma), COS-7 (green monkey kidney fibroblast), and NRK (rat kidney fibroblast) cells were obtained from the American Type Culture Collection (Manassas, VA). Human fibroblasts in primary culture were kindly provided by C. L. Cadilla (Department of Biochemistry, University of Puerto Rico). M1 (human fibroblast), HEK-293 (human epithelial), and MNT-1 (human melanoma) cells were kindly provided by E. O. Long (National Institute of Allergy and Infectious Diseases, NIH), T. A. Rouault (National Institute of Child Health and Human Development, NIH), and M. S. Marks (School of Medicine, University of Pennsylvania), respectively. HeLa, SK-N-SH, SK-N-MC, H4, COS-7, NRK, human fibroblasts in primary culture, M1, HEK-293, and MNT-1 cells were maintained in DMEM (Invitrogen, Carlsbad, CA). Jurkat cells were maintained in RPMI 1640 medium (Invitrogen). For all cell lines the media were supplemented with 2 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% (vol/vol) fetal bovine serum (FBS; Invitrogen), except for MNT-1 for which it was supplemented with 20% (vol/vol) FBS (Hyclone, Logan, UT) and 10% AIM-V medium (Invitrogen). Human fibroblasts in primary culture, SK-N-SH, SK-N-MC and MNT-1 media were also supplemented with 0.1 mM nonessential amino acids (Invitrogen). Transfections were carried out using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. The cells were analyzed 16–24 h after transfection, with the exception of cells transfected with AP1-
1-CFP, which were analyzed after 48 h of expression.
Immunofluorescence Microscopy, Quantitative Analysis, and Förster Resonance Energy Transfer Imaging
Indirect immunofluorescence staining of fixed, permeabilized cells was performed as described previously (Mardones et al., 2006
). Images of either fixed or live transfected cells were acquired with an Olympus FluoView FV1000 scanning unit fitted on an inverted Olympus IX81 microscope, used with a PlanApo 60x oil immersion objective (NA 1.40; Olympus, Melville, NY). Analysis of colocalization by immunofluorescence microscopy was performed after correction for noise, cross-talk, and background signals on each set of images. For each pairwise comparison we obtained three values, M1, M2, and r, according to Manders et al. (1992)
. M1 is defined as the ratio: (summed intensities of pixels from channel-A for which the intensity in channel-B is above zero):(total intensity in channel-A), and M2 is the converse ratio. M1 and M2 vary from 0 to 1, corresponding to no colocalization and complete colocalization, respectively. To evaluate quantitatively the level of colocalization, the Pearson's correlation coefficient, r (Manders et al., 1992
) was also calculated, with one indicating complete positive correlation and zero indicating no correlation. All values were obtained with the plug-in JACoP (Bolte and Cordelières, 2006
; http://rsb.info.nih.gov/ij/plugins/track/jacop.html), developed for the image analysis software ImageJ 1.36b (Rasband, 1997, 2007
). Each pairwise comparison was done on five sets of images acquired with the same optical settings, and the mean and SD of each parameter are presented in Supplementary Table 1. For Förster resonance energy transfer (FRET) imaging, NRK cells grown in 35-mm glass-bottom culture dishes (MatTek, Ashland, MA) were maintained in phenol red–free buffered medium and held at 37°C with an ASI 400 Air Stream stage Incubator (Nevtek, Burnsville, VA). Sensitized emission FRET analysis was quantified with the three built-in filter settings for the CFP, yellow fluorescent protein (YFP), and CFP/YFP/FRET channels. The excitation light sources were a 30-mW multiline Argon laser (457, 488, and 515 nm), a 25-mW 405-nm laser diode, and a 5.3-mW 440-nm laser diode, each at 2.0% intensity. Image capture and data acquisition were performed using Olympus FV1000 application software (FV10-ASW). The images were acquired at 250 dpi. Background subtraction was made before the FRET calculations. For correction of cross-talk between CFP and YFP channels, constructs encoding CFP- or YFP-fusion proteins were expressed separately, and for each fluorophore the emission from the FRET channel was divided by the emission measured in either the CFP or YFP channels. Corrected FRET was calculated on a pixel-by-pixel basis as described (Gordon et al., 1998
), and the FRET-corrected images were displayed in pseudocolor mode.
RNAi
RNAi was performed using siRNAs (Dharmacon, Lafayette, CO) designed to the following human target sequences: AAUGCUCAGCAUCAGAGGCUC for the coding sequence of p56, AAGAAUGGAUUGAUGAU for the 5' untranslated region of p56 (p56-5'), CAUCGUGUUCCAGUCAGCU for GGA1, UACACCUCUGGCUCAAGUG for GGA2, CAGUUUGUCCUCCGUGUUGG for GGA3, and UCCAAUUCGAAGACCAAUU for CHC. For the design of the siRNAs to the GGAs, an alignment of the cDNAs of the human sequences (Accession numbers: NM_013365 for GGA1; NM_015044 for GGA2; and NM_014001 for GGA3), using the multiple sequence alignment algorithm ClustalW (Thompson et al., 1994
), was performed. We selected 18–20-base oligonucleotides directed to regions in the aligned coding sequences with the lowest degree of identity among the GGAs. Oligonucleotides with the ability to produce a knockdown of
90%, as assessed by immunoblot analysis, were chosen for further experiments. RNAi for human
1-adaptin was performed with siGENOME Smart Pool siRNAs (Dharmacon). RNAi for GAPDH was performed with a siControl duplex siRNA (Dharmacon). Cells were transfected with the siRNAs using Oligofectamine (Invitrogen) according to the manufacturer's protocol. For knockdown of the GGAs, cells were transfected twice at 72-h intervals and analyzed 72 h after the second round of transfection. For knockdown of GAPDH, p56,
1-adaptin, and CHC cells were transfected twice at 24-h intervals and analyzed 48 h after the second round of transfection.
Electrophoresis and Immunoblotting
SDS-PAGE analysis and electroblotting onto nitrocellulose membranes were performed using the NuPAGE Bis-Tris Gel system (Invitrogen), according to the manufacturer's instructions. Incubations of the nitrocellulose membranes with primary and secondary antibodies were performed as previously described (Burgos et al., 2004
). Horseradish peroxidase–labeled antibodies were detected using electrochemiluminescence (ECL) Western Blotting Substrate from Pierce (Rockford, IL).
Metabolic Labeling and Immunoprecipitation
Metabolic labeling of cells was carried out as described (Kametaka et al., 2007
). Briefly, cells grown on six-well plates were pulse-labeled for 2 h at 20°C using 0.1 mCi/ml [35S]methionine-cysteine (Express Protein Label; Perkin Elmer-Cetus Life and Analytical Sciences, Boston, MA) and chased for 1–5 h at 37°C in regular culture medium in the presence of 5 mM mannose 6-phosphate, 0.06 mg/ml methionine and 0.1 mg/ml cysteine. After chase, cells were rinsed twice with PBS and subjected to lysis in 50 mM Tris, pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM EDTA, 1% (vol/vol) Triton X-100, and a complete protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN). The extracts were immunoprecipitated and analyzed by SDS-PAGE and fluorography. Quantification was performed on a Typhoon 9200 PhosphorImager (Amersham Biosciences) using ImageQuant analysis software.
Time-Lapse Microscopy and Image Analysis
Mock- or p56-depleted, live H4 cells were transfected with YFP-GGA1, plated on 35-mm glass-bottom culture dishes (MatTek), and maintained in phenol red–free buffered medium at 37°C by using an ASI 400 Air Stream stage Incubator (Nevtek, Burnsville, VA). Time-lapse fluorescence images were acquired with an Ultraview Confocal Scanner (Perkin Elmer-Cetus, Norwalk, CT) in a Nikon Eclipse TE2000-S inverted microscope (Nikon, Melville, NY) equipped with a PlanApo 100x oil immersion objective (NA 1.40; Nikon), and a 12-bit charge-coupled device (CCD) camera, ORCA (Hamamatsu, Bridgewater, NJ). Image capture and data acquisition were performed using Ultraview LCI software (Perkin Elmer-Cetus). Images were acquired in binning 2 x 2 modes to increase the signal to noise ratio, at
0.25-s intervals, during 110–120 s. Sequence images were exported as single TIFF files, and processed with MetaMorph (Molecular Devices, Sunnyvale, CA), and ImageJ 1.36b (Rasband, 1997, 2007
; http://rsb.info.nih.gov/ij/). Vesicles were counted and movement was tracked manually with an especially developed plug-in for ImageJ (http://rsb.info.nih.gov/ij/plugins/track/track.html, Fabrice P. Cordelières, Institut Curie, France). The distance reached by vesicles was determined by measuring the movement between successive frames. Each experiment was repeated at least 15 times under identical conditions, and the mean and SD for each parameter were calculated. To prepare figures, single frames were processed with Adobe Photoshop 7 (Adobe Systems, Mountain View, CA). QuickTime movies were produced using ImageJ 1.36b.
| RESULTS |
|---|
|
|
|---|
|
0.90; Figure 2, A and B, and Supplementary Table 1). Using a similar procedure, we observed that the
1-adaptin subunit of AP1 localized to a largely distinct set of puncta that did not stain for GGA1 (
9% colocalization, r =
0.12; Figure 2C and Supplementary Table 1) or the other GGAs (data not shown). Finally, we found that p56 also localized to TGN puncta that coincided more with GGA3 (>70% colocalization, r =
0.84; Figure 3A and Supplementary Table 1) and the other GGAs (data not shown) than with AP1-
1 (
11% colocalization, r =
0.19; Figure 3B and Supplementary Table 1). We also observed considerable colocalization of p56 with clathrin (
50% of p56, r =
0.43; Figure 3C and Supplementary Table 1). These observations point to the existence of at least two types of clathrin-coated structure in association with the TGN, which are defined by the presence of GGA/p56 and AP1, respectively. These two types could correspond to functionally distinct populations of clathrin-coated structures or to different stages of maturation of the same population, as predicted by the GGA-to-AP1 transfer model of MPR sorting at the TGN (Doray et al., 2002
|
|
1-CFP and YFP-p56 exhibited TGN localization, they showed no significant FRET (n = 8; Figure 4A), thus verifying the specificity of the other FRET signals. From these experiments, we concluded that GGA1 and GGA3, but not AP1-
1, interact with p56 dimers at the TGN in vivo.
|
To further investigate this interdependence, we used synthetic, small interfering RNAs (siRNAs) to deplete the GGAs and p56, as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Mock),
1-adaptin, or CHC, in HeLa cells. The siRNAs targeting each GGA were designed to maximize the number of mismatches relative to the other two GGAs (see Materials and Methods), thus decreasing the probability of "cross-depletion." The levels of all the target proteins could be reduced greater than 90% by this procedure, as detected by immunoblot analysis (Figure 5). We observed that individual depletion of each GGA had no effect on the levels of the other two GGAs (Figure 5; the decreased level of GGA1 in the GGA2-depleted cells seen in Figure 5 was not reproducible; see an example of another experiment in Supplementary Figure 1). In addition, we could achieve good, albeit less complete, depletion of combinations of GGA1+GGA2 or GGA1+GGA3 without affecting the levels of the remaining GGA (Figure 5). Similar observations were made by immunofluorescence microscopy, in which depletion of each GGA did not affect the intensity of TGN staining of the other two (Figure 6). Thus, each GGA behaves as a biogenetically independent species, such that the absence of one does not alter the level or localization of the others.
|
|
1-adaptin and CHC had no effect on p56 levels (Figure 5) and TGN localization (Figure 7 and data not shown). Biochemical analyses showed that, although decreasing the total levels of p56, GGA depletion did not affect the ratio of membrane-bound to cytosolic p56 (data not shown). The decrease in the level of p56 associated to the TGN could be reverted by moderate overexpression of any one GGA, as exemplified in Figure 8 for GGA2-depleted cells expressing Myc-epitope–tagged GGA3. From these experiments we concluded that p56 depends on the total levels of GGAs, but not AP1, for its stability and localization to the TGN.
|
|
1-adaptin, or CHC, increased the steady-state levels of the cathepsin D precursor by
4- to
6-fold (Figure 9, A and B). Depletion of GGA2 and
1-adaptin also resulted in increased levels of the intermediate form (Figure 9A). The higher levels of immature cathepsin D forms in cells depleted of any of the above proteins were indicative of impaired transport of the enzyme to lysosomes.
|
35% and the mature form
40% of the total labeled cathepsin D. At 5 h these values were
15% for the precursor form and
65% for the mature form. Depletion of p56 caused a significant delay in the processing of cathepsin D, such that at 3 h of chase
65% corresponded to the precursor form and
12% to the mature form (Figure 9, C and D). The delay was also manifest at 5 h of chase, when
35% remained as the precursor form and only
40% was processed to the mature form. These numbers were indicative of a
2-h delay in the overall kinetics of processing. Depletion of each of the GGAs,
1-adaptin, or CHC all delayed cathepsin D maturation, albeit to different extents, with GGA3 depletion having a relatively minor effect and CHC depletion the strongest effect (Figure 9, C and D). Taken together, these experiments demonstrated that, like the GGAs, AP1, and clathrin, p56 is involved in the sorting of cathepsin D to lysosomes.
Depletion of p56 Decreases the Mobility of GGA-containing Carriers
To determine whether the slower kinetics of cathepsin D processing in p56-depleted cells were due to alteration of the localization of other components of the lysosomal sorting machinery, we performed immunofluorescence microscopy. We found that depletion of p56 did not cause any obvious change in the steady-state distribution of the GGAs (shown for GGA1 in Figure 10A), AP1, clathrin, CI-MPR, and CD-MPR (data not shown). Likewise, we did not see any effect of p56 depletion on the overall appearance of the Golgi complex, as detected by staining for the TGN marker, TGN46 (Figure 10A), and the cis-Golgi marker, GM130 (data not shown).
|
30% of control levels (Figure 10, E and F). These results indicated that p56 controls the dynamics of GGA-containing TCs.
The Ability of p56 To Interact with the GGAs Is Required for its Role in Transport Carrier Dynamics
To determine whether the role of p56 in the regulation of TC mobility depends on its ability to interact with the GGAs, we performed an RNAi rescue assay in live H4 cells. p56 was depleted using an siRNA directed to the 5' untranslated region of p56. This siRNA was found to be as effective as the siRNA that targeted the coding sequence (Figure 10B). siRNA-treated cells were then rescued with plasmids encoding either a Myc-epitope–tagged, full-length p56 (Myc-p56), or a Myc-epitope–tagged construct lacking the N-terminal, GGA-interacting segment of p56 (Myc-
N-p56; residues 125–441; Collins et al., 2003
; Lui et al., 2003
). Immunofluorescence microscopy showed that Myc-p56 was correctly targeted to the TGN, where it colocalized with endogenous GGA1, GGA2, and GGA3 (Figure 11A and data not shown). In contrast, Myc-
N-p56 was not targeted to the TGN, exhibiting a diffuse cytosolic localization (Figure 11A). Immunoblot analysis showed that expression of Myc-p56 and Myc-
N-p56 was indeed resistant to the RNAi treatment (Figure 11B). Expression of Myc-p56 in p56-depleted cells restored the movement of YFP-GGA1–containing TCs in both directions (i.e., from the TGN to the periphery and vice versa; Figure 11, C–E, and Supplementary Video 3), to an extent similar to that observed in mock-treated cells (Figure 10D). Expression of Myc-
N-p56 in p56-depleted cells, however, failed to restore TC mobility (Figure 11, C–E, and Supplementary Video 3). These results demonstrated that interaction of p56 with the GGAs is required for its role in the regulation of TC dynamics.
|
| DISCUSSION |
|---|
|
|
|---|
Tight Physical and Biogenetic Relationship of p56 with the GGAs
Some clathrin adaptors and their cognate accessory proteins are expressed in all cells (e.g., AP1A, AP2, AP3A, GAK; Kimura et al., 1997
; Boehm and Bonifacino, 2001
), whereas others are tissue- or cell-type specific (e.g., AP1B in polarized epithelia, AP3B in the brain, auxilin in the brain; Ahle and Ungewickell, 1990
; Boehm and Bonifacino, 2001
). The availability of a complete panel of antibodies sensitive enough to detect the endogenous proteins have now allowed us to demonstrate that the three GGAs and p56 belong to the former group, in that they are coexpressed in all cell lines examined (Figure 1). In addition, they all largely colocalize to the TGN and peripheral foci that probably correspond to TCs and endosomes (Figures 2 and 3). Moreover, they physically interact within cells, as demonstrated by FRET (Figure 4A). Finally, overexpression of the GGAs enhances the association of p56 with the TGN (Figure 4B), and RNAi-mediated depletion of any of the GGAs decreases p56 staining at the TGN (Figure 7). Surprisingly, this latter effect is not solely due to decreased recruitment from the cytosol, but to decreased total levels of p56 in the GGA-depleted cells as well (Figure 5). Loss of p56 caused by depletion of one GGA can be suppressed by overexpression of another GGA (Figure 8). These observations indicate that the total levels of the GGAs determine the stability of p56. The relationship between these proteins is thus specific and tight, involving even a biogenetic dependence of p56 on the GGAs. The understanding of this relationship is helpful for the interpretation of the effects of RNAi-mediated depletion of the GGAs, which also decreases levels of p56. The cellular effects of GGA depletion could, therefore, be partly due to decreased p56 levels.
Another interesting finding in our study was that depletion of one GGA did not alter the localization or levels of the other two. The GGAs, therefore, behave as biogenetically independent entities. This finding contrasts with that of a previous study (Ghosh et al., 2003b
), in which the depletion of any one GGA decreased the levels of the other two. This was not due to off-target effects of the RNAi, because the levels of the two indirectly affected GGAs could be restored by treatment with proteasomal inhibitors or by transfection with RNAi-resistant cDNA encoding the target GGA (Ghosh et al., 2003b
). We do not know the reason for these differences, especially as both studies were carried out with HeLa cells. A possible explanation is the different RNAi methodologies that were used to knock down GGA expression: stable transfection of vectors encoding siRNAs in the previous study (Ghosh et al., 2003b
) and transient transfection of synthetic siRNAs in the present study. Our observations indicate that, over a span of 3–5 d of siRNA treatment, the levels of the three GGAs are not interdependent. The three GGAs are not entirely redundant, however, because depletion of any single GGA causes partial reduction of p56 levels (Figure 5) and cathepsin D missorting (Figure 9; Ghosh et al., 2003b
). We attribute this to a dosage effect and not to an effect of depleting one GGA on the levels of the other two.
Requirement of p56 for Sorting of Procathepsin D to Lysosomes
The ability to deplete cells of p56 without altering the levels of the GGAs (Figure 5) allowed us to test the involvement of p56 in the sorting of procathepsin D to lysosomes. We found that depletion of p56 impaired proteolytic processing of procathepsin D to the intermediate and mature forms, as detected by both immunoblotting (Figure 9, A and B) and pulse-chase and immunoprecipitation analyses (Figure 9, C and D). Because procathepsin D processing occurs upon transport to lysosomes, these observations indicate that p56 is involved in protein sorting to lysosomes. In agreement with previous studies (Ghosh et al., 2003b
), we also found that depletion of single GGAs caused partial missorting of procathepsin D (Figure 9), but this could be in part due to the decreased levels of p56 caused by GGA depletion (Figure 5). Also of interest is the observation that depletion of clathrin causes a profound inhibition of procathepsin D sorting to lysosomes (Figure 9). This agrees with a previous observation made through the use of antisense RNA targeting the clathrin heavy chain (Iversen et al., 2003
) and is in line with the requirement of clathrin adaptors (i.e., GGAs and AP1) for procathepsin D sorting (Figure 9; Meyer et al., 2000
; Ghosh et al., 2003b
; Hirst et al., 2005
). It contrasts, however, with observations made in the chicken B lymphocyte cell line, DT40, in which the accumulation of another acid hydrolase,
-glucuronidase, and the integral membrane protein, LEP100, within lysosomes was unaffected by elimination of the clathrin heavy chain (Wettey et al., 2002
). The results from this latter study could stem from the use of a mutant cell line that adapted to the lack of clathrin expression, because all other evidence (Iversen et al., 2003
; Janvier and Bonifacino, 2005
) points to a critical role for clathrin and some of its adaptors in the sorting of both luminal and transmembrane components of lysosomes.
p56 Regulates the Mobility of GGA-containing Transport Carriers
Despite the impairment of procathepsin D sorting, we did not observe any obvious changes in the distribution of the CI-MPR by immunofluorescence microscopy in p56-depleted cells (data not shown). This could simply reflect the low resolution of this technique to distinguish different juxtanuclear, TGN, or endosomal compartments. Alternatively, p56 depletion could alter the dynamics of transport between the TGN and endosomes, without causing noticeable changes in the overall appearance of CI-MPR–containing structures. This seems, in fact, to be the case as depletion of p56 decreased the mobility of GGA-containing TCs (Figure 10). Previous studies documented the existence of pleiomorphic TCs that contain GGA, AP1, clathrin, CI-MPR, and CD-MPR and move from the TGN toward the peripheral cytoplasm (Huang et al., 2001
; Waguri et al., 2002
; Puertollano et al., 2003
; Polishchuk et al., 2006
). These carriers were proposed to mediate the long-range distribution of a pool of MPRs and their cargo hydrolase precursors between the TGN and peripheral endosomes. Improved time resolution allowed us to observe another population of GGA-containing TCs that move from the periphery to the center of the cell. At present we do not know the function of such centripetal TCs. One possibility is that the GGAs have an additional role in retrograde transport, as recently proposed (He et al., 2005
). Alternatively, the GGAs may not play any role in retrograde transport but just remain passively associated with retrograde TCs after their forward sorting function is fulfilled. In any event, p56 depletion inhibits the movement of both forward and retrograde TCs (Figure 10), perhaps explaining the unchanged steady-state distribution of MPRs. Because the movement of the forward TCs is dependent on microtubules (Waguri et al., 2002
; Puertollano et al., 2003
), it is tempting to speculate that p56 could participate in linking GGA-containing carriers to microtubule motors. Precedent for the coupling of a clathrin adaptor with a microtubule motor is the demonstration of an interaction of the
1 subunit of AP1 with the kinesin, KIF13A, which enables movement of CI-MPR–containing vesicles from the TGN to the plasma membrane (Nakagawa et al., 2000
). These findings support the notion that the roles of clathrin coats extend beyond cargo selection and vesicle budding.
The Canonical Interaction of p56 with GGAs Is Required for Transport Carrier Mobility
Expression of RNAi-resistant, full-length p56 restored the dynamics of TC movement in p56-depleted cells, thus demonstrating the specificity of the phenotype. However, expression of a p56 variant lacking the N-terminal, GGA-interacting segment failed to restore movement (Figure 11). This demonstrated that this function of p56 is dependent on its interaction with the GGAs. The N-terminal segment of p56 comprises the sequence, FGGF, which binds to the ear domain of the GGAs (Collins et al., 2003
). This sequence belongs to a group of sequences shared by GGA- and AP1-accessory proteins that fit certain canonical motifs (Page et al., 1999
; Kent et al., 2002
; Collins et al., 2003
; Duncan et al., 2003
; Mattera et al., 2003
, 2004
; Miller et al., 2003
; Mills et al., 2003
). These canonical ear-motif interactions have been extensively characterized, both biochemically and structurally. However, their requirement for the function of TGN accessory proteins is poorly understood. Our findings now demonstrate that a canonical interaction between a TGN/endosomal clathrin adaptor and an accessory protein is indeed required for function.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
![]()
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
These authors contributed equally to this work. ![]()
Address correspondence to: Juan S. Bonifacino (juan{at}helix.nih.gov).
| REFERENCES |
|---|
|
|
|---|
Boehm, M., and Bonifacino, J. S. (2001). Adaptins: the final recount. Mol. Biol. Cell 12, 2907–2920.
Bolte, S., and Cordelières, F. P. (2006). A guided tour into subcellular colocalization analysis in light microscopy. J. Microsc 224, 213–232.[Medline]
Boman, A. L., Zhang, C. J., Zhu, X., and Kahn, R. A. (2000). A family of ADP-ribosylation factor effectors that can alter membrane transport through the trans-Golgi. Mol. Biol. Cell 11, 1241–1255.
Bonifacino, J. S. (2004). The GGA proteins: adaptors on the move. Nat. Rev. Mol. Cell Biol 5, 23–32.[CrossRef][Medline]
Bowers, K., and Stevens, T. H. (2005). Protein transport from the late Golgi to the vacuole in the yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta 1744, 438–454.[Medline]
Burgos, P. V., Klattenhoff, C., de la Fuente, E., Rigotti, A., and González, A. (2004). Cholesterol depletion induces PKA-mediated basolateral-to-apical transcytosis of the scavenger receptor class B type I in MDCK cells. Proc. Natl. Acad. Sci. USA 101, 3845–3850.
Collins, B. M., Praefcke, G. J., Robinson, M. S., and Owen, D. J. (2003). Structural basis for binding of accessory proteins by the appendage domain of GGAs. Nat. Struct. Biol 10, 607–613.[CrossRef][Medline]
Dell'Angelica, E. C., Puertollano, R., Mullins, C., Aguilar, R. C., Vargas, J. D., Hartnell, L. M., and Bonifacino, J. S. (2000). GGAs: a family of ADP ribosylation factor-binding proteins related to adaptors and associated with the Golgi complex. J. Cell Biol 149, 81–94.
Doray, B., Ghosh, P., Griffith, J., Geuze, H. J., and Kornfeld, S. (2002). Cooperation of GGAs and AP-1 in packaging MPRs at the trans-Golgi network. Science 297, 1700–1703.
Doray, B., and Kornfeld, S. (2001). Gamma subunit of the AP-1 adaptor complex binds clathrin: implications for cooperative binding in coated vesicle assembly. Mol. Biol. Cell 12, 1925–1935.
Duncan, M. C., Costaguta, G., and Payne, G. S. (2003). Yeast epsin-related proteins required for Golgi-endosome traffic define a gamma-adaptin ear-binding motif. Nat. Cell Biol 5, 77–81.[CrossRef][Medline]
Galperin, E., and Sorkin, A. (2003). Visualization of Rab5 activity in living cells by FRET microscopy and influence of plasma-membrane-targeted Rab5 on clathrin-dependent endocytosis. J. Cell Sci 116, 4799–4810.
Ghosh, P., Dahms, N. M., and Kornfeld, S. (2003a). Mannose 6-phosphate receptors: new twists in the tale. Nat. Rev. Mol. Cell Biol 4, 202–212.[CrossRef][Medline]
Ghosh, P., Griffith, J., Geuze, H. J., and Kornfeld, S. (2003b). Mammalian GGAs act together to sort mannose 6-phosphate receptors. J. Cell Biol 163, 755–766.
Ghosh, P., and Kornfeld, S. (2004). The GGA proteins: key players in protein sorting at the trans-Golgi network. Eur. J. Cell Biol 83, 257–262.[CrossRef][Medline]
Gordon, G. W., Berry, G., Liang, X. H., Levine, B., and Herman, B. (1998). Quantitative fluorescence resonance energy transfer measurements using fluorescence microscopy. Biophys. J 74, 2702–2713.[Medline]
He, X., Li, F., Chang, W. P., and Tang, J. (2005). GGA proteins mediate the recycling pathway of memapsin 2 (BACE). J. Biol. Chem 280, 11696–11703.
Hirst, J., Borner, G. H., Harbour, M., and Robinson, M. S. (2005). The aftiphilin/p200/gamma-synergin complex. Mol. Biol. Cell 16, 2554–2565.
Hirst, J., Lui, W. W., Bright, N. A., Totty, N., Seaman, M. N., and Robinson, M. S. (2000). A family of proteins with gamma-adaptin and VHS domains that facilitate trafficking between the trans-Golgi network and the vacuole/lysosome. J. Cell Biol 149, 67–80.
Hirst, J., Motley, A., Harasaki, K., Peak Chew, S. Y., and Robinson, M. S. (2003). EpsinR: an ENTH domain-containing Protein that Interacts with AP-1. Mol. Biol. Cell 14, 625–641.
Höning, S., Sosa, M., Hille-Rehfeld, A., and von Figura, K. (1997). The 46-kDa mannose 6-phosphate receptor contains multiple binding sites for clathrin adaptors. J. Biol. Chem 272, 19884–19890.
Huang, F., Nesterov, A., Carter, R. E., and Sorkin, A. (2001). Trafficking of yellow-fluorescent-protein-tagged mu1 subunit of clathrin adaptor AP-1 complex in living cells. Traffic 2, 345–357.[CrossRef][Medline]
Iversen, T. G., Skretting, G., van Deurs, B., and Sandvig, K. (2003). Clathrin-coated pits with long, dynamin-wrapped necks upon expression of a clathrin antisense RNA. Proc. Natl. Acad. Sci. USA 100, 5175–5180.
Janvier, K., and Bonifacino, J. S. (2005). Role of the endocytic machinery in the sorting of lysosome-associated membrane proteins. Mol. Biol. Cell 16, 4231–4242.
Kametaka, S., Moriyama, K., Burgos, P. V., Eisenberg, E., Greene, L. E., Mattera, R., and Bonifacino, J. S. (2007). Canonical interaction of cyclin G-associated kinase with adaptor protein 1 regulates lysosomal enzyme sorting. Mol. Biol. Cell 18, 2991–3001.
Kalthoff, C., Groos, S., Kohl, R., Mahrhold, S., and Ungewickell, E. J. (2002). Clint: a novel clathrin-binding ENTH-domain protein at the Golgi. Mol. Biol. Cell 13, 4060–4073.
Kent, H. M., McMahon, H. T., Evans, P. R., Benmerah, A., and Owen, D. J. (2002). Gamma-adaptin appendage domain: structure and binding site for Eps15 and gamma-synergin. Structure (Camb.) 10, 1139–1148.[Medline]
Kornfeld, S. (1992). Structure and function of the mannose 6-phosphate/insulinlike growth factor II receptors. Annu. Rev. Biochem 61, 307–330.[CrossRef][Medline]
Koster, A., Saftig, P., Matzner, U., von Figura, K., Peters, C., and Pohlmann, R. (1993). Targeted disruption of the M(r) 46,000 mannose 6-phosphate receptor gene in mice results in misrouting of lysosomal proteins. EMBO J 12, 5219–5223.[Medline]
Kimura, S. H., Tsuruga, H., Yabuta, N., Endo, Y., and Nojima, H. (1997). Structure, expression, and chromosomal localization of human GAK. Genomics 44, 179–187.[CrossRef][Medline]
Klumperman, J., Hille, A., Veenendaal, T., Oorschot, V., Stoorvogel, W., von Figura, K., and Geuze, H. J. (1993). Differences in the endosomal distributions of the two mannose 6-phosphate receptors. J. Cell Biol 121, 997–1010.
Le Borgne, R., and Hoflack, B. (1997). Mannose 6-phosphate receptors regulate the formation of clathrin-coated vesicles in the TGN. J. Cell Biol 137, 335–345.
Ludwig, T., Ovitt, C. E., Bauer, U., Hollinshead, M., Remmler, J., Lobel, P., Ruther, U., and Hoflack, B. (1993). Targeted disruption of the mouse cation-dependent mannose 6-phosphate receptor results in partial missorting of multiple lysosomal enzymes. EMBO J 12, 5225–5235.[Medline]
Ludwig, T., Eggenschwiler, J., Fisher, P., D'Ercole, A. J., Davenport, M. L., and Efstratiadis, A. (1996). Mouse mutants lacking the type 2 IGF receptor (IGF2R) are rescued from perinatal lethality in Igf2 and Igf1r null backgrounds. Dev. Biol 177, 517–535.[CrossRef][Medline]
Lui, W. W., Collins, B. M., Hirst, J., Motley, A., Millar, C., Schu, P., Owen, D. J., and Robinson, M. S. (2003). Binding partners for the COOH-terminal appendage domains of the GGAs and
-adaptin. Mol. Biol. Cell 14, 2385–2398.
Manders, E., Stap, J., Brakenhoff, G., van Driel, R., and Aten, J. (1992). Dynamics of three-dimensional replication patterns during the S-phase, analysed by double labelling of DNA and confocal microscopy. J. Cell Sci 103, 857–862.[Abstract]
Mardones, G. A., Snyder, C. M., and Howell, K. E. (2006). cis-Golgi matrix proteins move directly to endoplasmic reticulum exit sites by association with tubules. Mol. Biol. Cell 17, 525–538.
Martina, J. A., Moriyama, K., and Bonifacino, J. S. (2003). BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4. J. Biol. Chem 278, 29376–29384.
Mattera, R., Arighi, C. N., Lodge, R., Zerial, M., and Bonifacino, J. S. (2003). Divalent interaction of the GGAs with the Rabaptin-5-Rabex-5 complex. EMBO J 22, 78–88.[CrossRef][Medline]
Mattera, R., Ritter, B., Sidhu, S. S., McPherson, P. S., and Bonifacino, J. S. (2004). Definition of the consensus motif recognized by gamma-adaptin ear domains. J. Biol. Chem 279, 8018–8028.
Meyer, C., Zizioli, D., Lausmann, S., Eskelinen, E. L., Hamann, J., Saftig, P., von Figura, K., and Schu, P. (2000). mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. EMBO J 19, 2193–2203.[CrossRef][Medline]
Miller, G. J., Mattera, R., Bonifacino, J. S., and Hurley, J. H. (2003). Recognition of accessory protein motifs by the gamma-adaptin ear domain of GGA3. Nat. Struct. Biol 10, 599–606.[CrossRef][Medline]
Mills, I. G., Praefcke, G. J., Vallis, Y., Peter, B. J., Olesen, L. E., Gallop, J. L., Butler, P. J., Evans, P. R., and McMahon, H. T. (2003). EpsinR: an AP1/clathrin interacting protein involved in vesicle trafficking. J. Cell Biol 160, 213–222.
Mullins, C., and Bonifacino, J. S. (2001). The molecular machinery for lysosome biogenesis. Bioessays 23, 333–343.[CrossRef][Medline]
Nakagawa, T., Setou, M., Seog, D., Ogasawara, K., Dohmae, N., Takio, K., and Hirokawa, N. (2000). A novel motor, KIF13A, transports mannose-6-phosphate receptor to plasma membrane through direct interaction with AP-1 complex. Cell 103, 569–581.[CrossRef][Medline]
Neubrand, V. E., Will, R. D., Mobius, W., Poustka, A., Wiemann, S., Schu, P., Dotti, C. G., Pepperkok, R., and Simpson, J. C. (2005). Gamma-BAR, a novel AP-1-interacting protein involved in post-Golgi trafficking. EMBO J 24, 1122–1133.[CrossRef][Medline]
Nogi, T. et al. (2002). Structural basis for the accessory protein recruitment by the gamma-adaptin ear domain. Nat. Struct. Biol 9, 527–531.[Medline]
Owen, D. J., Collins, B. M., and Evans, P. R. (2004). Adaptors for clathrin coats: structure and function. Annu. Rev. Cell Dev. Biol 20, 153–191.[CrossRef][Medline]
Page, L. J., Sowerby, P. J., Lui, W. W., and Robinson, M. S. (1999). Gamma-synergin: an EH domain-containing protein that interacts with gamma-adaptin. J. Cell Biol 146, 993–1004.
Polishchuk, R. S., San Pietro, E., Di Pentima, A., Tete, S., and Bonifacino, J. S. (2006). Ultrastructure of long-range transport carriers moving from the trans Golgi network to peripheral endosomes. Traffic 7, 1092–1103.[CrossRef][Medline]
Poussu, A., Lohi, O., and Lehto, V. P. (2000). Vear, a novel Golgi-associated protein with VHS and gamma-adaptin "ear" domains. J. Biol. Chem 275, 7176–7183.
Puertollano, R., Aguilar, R. C., Gorshkova, I., Crouch, R. J., and Bonifacino, J. S. (2001). Sorting of mannose 6-phosphate receptors mediated by the GGAs. Science 292, 1712–1716.
Puertollano, R., and Bonifacino, J. S. (2004). Interactions of GGA3 with the ubiquitin sorting machinery. Nat. Cell Biol 6, 244–251.[Medline]
Puertollano, R., van der Wel, N. N., Greene, L. E., Eisenberg, E., Peters, P. J., and Bonifacino, J. S. (2003). Morphology and dynamics of clathrin/GGA1-coated carriers budding from the trans-Golgi network. Mol. Biol. Cell 14, 1545–1557.
Rasband, W. S. ImageJ. 1997–2007.
Ritter, B., Philie, J., Girard, M., Tung, E. C., Blondeau, F., and McPherson, P. S. (2003). Identification of a family of endocytic proteins that define a new alpha-adaptin ear-binding motif. EMBO Rep 4, 1089–1095.[CrossRef][Medline]
Rizzo, M. A., Springer, G. H., Granada, B., and Piston, D. W. (2004). An improved cyan fluorescent protein variant useful for FRET. Nat. Biotechnol 22, 445–449.[CrossRef][Medline]
Robinson, M. S. (2004). Adaptable adaptors for coated vesicles. Trends Cell Biol 14, 167–174.[CrossRef][Medline]
Shiba, Y., Takatsu, H., Shin, H. W., and Nakayama, K. (2002). Gamma-adaptin interacts directly with Rabaptin-5 through its ear domain. J. Biochem. (Tokyo) 131, 327–336.
Takatsu, H., Katoh, Y., Shiba, Y., and Nakayama, K. (2001). Golgi-localizing, gamma-adaptin ear homology domain, ADP-ribosylation factor-binding (GGA) proteins interact with acidic dileucine sequences within the cytoplasmic domains of sorting receptors through their Vps27p/Hrs/STAM (VHS) domains. J. Biol. Chem 276, 28541–28545.
Takatsu, H., Yoshino, K., and Nakayama, K. (2000). Adaptor gamma ear homology domain conserved in gamma-adaptin and GGA proteins that interact with gamma-synergin. Biochem. Biophys. Res. Commun 271, 719–725.[CrossRef][Medline]
Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.
Traub, L. M. (2005). Common principles in clathrin-mediated sorting at the Golgi and the plasma membrane. Biochim. Biophys. Acta 1744, 415–437.[Medline]
Waguri, S., Dewitte, F., Le Borgne, R., Rouillé, Y., Uchiyama, Y., Dubremetz, J. F., and Hoflack, B. (2002). Visualization of TGN to endosomes trafficking through fluorescently labeled MPR and AP-1 in living cells. Mol. Biol. Cell 14, 142–155.[CrossRef]
Wahle, T., Prager, K., Raffler, N., Haass, C., Famulok, M., and Walter, J. (2005). GGA proteins regulate retrograde transport of BACE1 from endosomes to the trans-Golgi network. Mol. Cell. Neurosci 29, 453–461.[CrossRef][Medline]
Wasiak, S., Legendre-Guillemin, V., Puertollano, R., Blondeau, F., Girard, M., de Heuvel, E., Boismenu, D., Bell, A. W., Bonifacino, J. S., and McPherson, P. S. (2002). Enthoprotin: a novel clathrin-associated protein identified through subcellular proteomics. J. Cell Biol 158, 855–862.
Wettey, F. R., Hawkins, S. F., Stewart, A., Luzio, J. P., Howard, J. C., and Jackson, A. P. (2002). Controlled elimination of clathrin heavy-chain expression in DT40 lymphocytes. Science 297, 1521–1525.
Wu, X., Zhao, X., Puertollano, R., Bonifacino, J. S., Eisenberg, E., and Greene, L. E. (2003). Adaptor and clathrin exchange at the plasma membrane and trans-Golgi network. Mol. Biol. Cell 14, 516–528.
Zhu, Y., Doray, B., Poussu, A., Lehto, V. P., and Kornfeld, S. (2001). Binding of GGA2 to the lysosomal enzyme sorting motif of the mannose 6- phosphate receptor. Science 292, 1716–1718.
Zola, H., and Brooks, D. A. (1981). Techniques for production and characterization of monoclonal hybridoma antibodies. In: Monoclonal Hybridoma Antibodies: Techniques and Applications, J.G.R. Hurrell, Boca Raton, FL: CRC Press, 1–57.
This article has been cited by other articles:
![]() |
L. L. P. daSilva, R. Sougrat, P. V. Burgos, K. Janvier, R. Mattera, and J. S. Bonifacino Human Immunodeficiency Virus Type 1 Nef Protein Targets CD4 to the Multivesicular Body Pathway J. Virol., July 1, 2009; 83(13): 6578 - 6590. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rojas, T. van Vlijmen, G. A. Mardones, Y. Prabhu, A. L. Rojas, S. Mohammed, A. J.R. Heck, G. Raposo, P. van der Sluijs, and J. S. Bonifacino Regulation of retromer recruitment to endosomes by sequential action of Rab5 and Rab7 J. Cell Biol., November 3, 2008; 183(3): 513 - 526. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Peretti, N. Dahan, E. Shimoni, K. Hirschberg, and S. Lev Coordinated Lipid Transfer between the Endoplasmic Reticulum and the Golgi Complex Requires the VAP Proteins and Is Essential for Golgi-mediated Transport Mol. Biol. Cell, September 1, 2008; 19(9): 3871 - 3884. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Perez-Victoria, G. A. Mardones, and J. S. Bonifacino Requirement of the Human GARP Complex for Mannose 6-phosphate-receptor-dependent Sorting of Cathepsin D to Lysosomes Mol. Biol. Cell, June 1, 2008; 19(6): 2350 - 2362. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||