![]() |
|
|
Vol. 18, Issue 9, 3545-3555, September 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







*Cell Biology Laboratory, Department of Biochemistry, BioSciences Institute, National University of Ireland, Cork, Ireland;
Department of Pharmaco-Biology, Laboratory of Biochemistry and Molecular Biology, University of Bari, and Consiglio Nazionale delle Ricerche Institute of Biomembranes and Bioenergetics, 70125 Bari, Italy;
Institute of Pathology, University Hospital Mannheim, University of Heidelberg, D68135 Mannheim, Germany; and
Medical Research Council, Dunn Human Nutrition Unit, Cambridge CB2 2XY, United Kingdom
Submitted December 15, 2006;
Revised June 11, 2007;
Accepted June 14, 2007
Monitoring Editor: Carl-Henrik Heldin
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The role of IGF-I signaling and Akt in regulating energy metabolism and glycolysis in tumor cells is receiving renewed attention. Tumor cells have long been recognized to have the ability to metabolize glucose and produce ATP rapidly through enhanced rates of glycolysis. This phenotype associated with increased production of lactic acid was described by Warburg in the 1920s (Warburg, 1924
, 1930
), and it can be detected using positron emission tomography (PET). Enhanced glycolysis is thought to confer cancer cells with a distinct competitive edge over normal cells by providing adequate ATP for rapid proliferation under hypoxic conditions and has also been proposed to protect cells from oxidative stress (Brand and Hermfisse, 1997
). One of the ways in which the PI3-K and Akt pathway promotes cell survival and tumor growth is to stimulate glucose metabolism. Activated Akt increases levels of cell surface transporters for glucose (Plas et al., 2001
; Edinger and Thompson, 2002
; Plas and Thompson, 2005
) and also regulates the expression and location of mitochondrial hexokinases, which catalyze the first step of glycolysis (Majewski et al., 2004
). A direct role for mTOR signaling in enhancing mitochondrial oxidative phosphorylation has also recently been described (Schieke et al., 2006
) as well as a role for mTOR in regulating the production of mitochondrial-derived reactive oxygen species (ROS) that are thought to be causative in ageing (Schieke and Finkel, 2006
).
Although much evidence points to altered mitochondrial physiology in cancer cells, the interactions between growth factor signaling and mitochondrial function in regulating cell survival and proliferation remain to be fully elucidated. For this reason we sought to investigate the function of a previously uncharacterized mitochondrial carrier protein that was identified in a screen for genes whose expression is increased in cells transformed by overexpressing the IGF-IR (R+ cells). These cells were generated from a fibroblast cell line derived from the IGF-IR knockout mouse (R– cells) by re-expressing the IGF-IR (Sell et al., 1994
). The differential screen of genes expressed in R+ and R– cells identified a group of genes generally associated with cancer cell metabolism and migration (Loughran et al., 2005a
,b
) and a group of genes of unknown function, which included the mitochondrial carrier protein.
Mitochondrial carrier proteins link metabolic pathways in mitochondria and the cytosol by transporting nucleotides, metabolites, and cofactors through the otherwise impermeable inner mitochondrial membrane. They are required for the generation of energy; amino acid synthesis and degradation; intramitochondrial DNA, RNA, and protein synthesis; and other fundamental cellular functions (Kaplan, 2001
; Kunji, 2004
; Palmieri, 2004
).
The mitochondrial carrier is located on chromosome 1 and shares significant identity with the essential yeast mitochondrial carrier Rim2p (YBR192W; Van Dyck et al., 1995
; Marobbio et al., 2006
). Its expression is dependant on activation of the PI-3 kinase and mTOR pathways and is enhanced in transformed cell lines and primary tumors compared with normal cells and tissues. Like Rim2p (Marobbio et al., 2006
), the carrier transports pyrimidine nucleotides and was designated PNC1 (pyrimidine nucleotide carrier 1). Overexpression of PNC1 in MCF-7 cells caused an increase in cell size and suppression of PNC1 expression caused a decrease in cell size in several cell lines, as well as decreased cell cycle progression and proliferation of MCF-7 cells. Mitochondrial UTP levels were significantly reduced when PNC1 expression was suppressed. These observations suggest that the IGF-I-PI3-K-mTOR signaling pathway controls mitochondrial function directly and that PNC1 is important for mitochondrial activity in regulating cell growth (cell size) and proliferation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The promoter sequence of the pnc1 gene encompassing a region of 3 kbp upstream of the transcription start site (+1) was extracted from the Ensembl database (Gene ID: ENSG00000171612). Putative transcription factor binding sites were identified in this sequence by analysis using the TFSEARCH version 1.3 program (http://www.cbrc.jp/research/db/TFSEARCH.html), which compared the sequence with a database of identified transcription factor binding sites (TRANSFAC databank (Heinemeyer et al., 1998
).
Cell Culture, IGF-I/Insulin Stimulation, and Transfection
MCF-7 breast carcinoma cells, R– cells, R+ cells, and DU145 and HeLa cells were all maintained in DMEM supplemented with 10% (vol/vol) fetal bovine serum (FBS), 10 mM L-glutamine, and antibiotic (all from Biowhittaker, Verviers, Belgium), which was designated complete medium (CM). HeLa cells were transiently transfected with pcDNA3 encoding Ha-PNC1 or empty pcDNA3 vector (4 µg of DNA) using LipofectAMINE 2000 (Invitrogen, Paisley, United Kingdom). To generate stable transfectants, MCF-7 cells were cultured in medium containing G418 (Calbiochem, Nottingham, United Kingdom; 1 mg/ml), and individual clones were selected and screened for expression of Ha-PNC1 by Western blotting. To analyze signaling response cells were starved from FBS before stimulation with IGF-I (100 ng/ml, PeproTech, Rocky Hill, NJ). To analyze pnc1 mRNA expression, cells were grown to a confluence of
70%, serum-starved (for 4 h for R+ cells and for 12 h for MCF-7 and R– cells), and then stimulated with either IGF-I or insulin. To inhibit signaling pathways cells were incubated with 30 µm PD98059 (MAP kinase inhibitor), 20 µm LY294002 (PI-3 kinase inhibitor), or 100 nM rapamycin (mTOR inhibitor) for 30 min before stimulation with IGF-I. All inhibitors were from Calbiochem.
Northern Blot Analysis
Total RNA was isolated from R– and R+ cells using Trizol Reagent (Invitrogen) according to the manufacturer's instructions, separated on 1.5% (wt/vol) denaturing formaldehyde gels, and transferred to nylon membranes (Hybond-N, Amersham, Buckinghamshire, United Kingdom). A murine multiple tissue Northern blot was obtained from Clontech.
-32P-labeled pnc1 probes (1 x 106 cpm/ml) were generated by the random oligonucleotide primer method (NEBlot: New England Biolabs, Hertfordshire, United Kingdom). Prehybridization and hybridization were carried out at 42°C in 50% formamide, 5x SSC, 4x Denhardt's solution, 0.1% SDS, and salmon sperm DNA (100 µl/ml, Sigma, Dublin, Ireland) for 2 and 1 5 h, respectively. Filters were washed twice at 42°C using 2x SSC, 0.1% SDS for 5 min, and then twice at 42°C using 0.5x SSC and 0.1% SDS for 15 min, before being scanned for signal using a phosphorimager.
Immunofluorescence and Flow Cytometry Assays
For immunofluorescence, cells on cover slips were washed with phosphate-buffered saline (PBS) and placed in serum-free DMEM with 25 nM mitoTracker dye (Molecular Probes, Hamburg, Germany) for 30 min. Cells were fixed in 3.7% formaldehyde in PHEM buffer (60 mM Pipes, 25 mM HEPES, 10 mM EGTA, 2 mM MgCl2, pH 6.9) for 10 min and permeabilized with 0.1% Triton X-100 in PHEM for 5 min. For staining with the anti-Ha antibodies, cells were first preblocked with 2.5% normal goat serum in PHEM for 30 min and then incubated with primary antibody, washed with PHEM, and incubated with Cy2-conjugated secondary antibody (Jackson ImmunoResearch Laboratories, Newmarket, United Kingdom). Cells were examined using a Nikon fluorescent microscope (Kingston upon Thames, United Kingdom).
Mitochondria mass was assessed by first fixing cells in PBS containing 2% formaldehyde and 2% glutaraldehyde for 30 min at 37°C, followed by incubation in PBS containing 25 nM MitoTracker dye (Molecular Probes) for 30 min. Cells were washed and analyzed by flow cytometry. Cellular ROS were assessed by incubating cells in PBS containing 10 µM H2DCF-DA fluorescent probe (Molecular Probes) for 15 min in the dark at 20°C.
For cell cycle analysis, cells were trypsinized, resuspended in cold PBS containing 200 µg/ml RNAse A (Sigma), and kept on ice. Before analysis by flow cytometry, NP-40 and propidium iodide (Sigma) were added at a final concentration of 0.1% and 50 µg/ml, respectively. DNA content was measured in the FL2 channel of a flow cytometer using the CellQuest software (Becton Dickinson, Oxford, United Kingdom).
Assays for Cell Proliferation and Cell Size
Cells were cultured in CM at 3 x 104 cells per well in a 24-well plate. To monitor cell growth, cells were removed at the indicated times to Eppendorf tubes using trypsin-EDTA and centrifuged at 1000 x g for 3 min. The cell pellets were then resuspended in 100 µl of medium and counted using trypan blue exclusion.
To determine relative cell size, cells in six-well plates were transfected with pnc1-specific siRNA. After incubation for 24 h cells were trypsinized and reseeded into 60-mm plates at
30% confluence in CM. Rapamycin (Calbiochem; 100 nM) was added to some cultures 24 h after reseeding. At the indicated times, cells were removed from the plates using trypsin and resuspended for fluorescence-activated cell sorting (FACS) analysis. In each sample 10,000 cells were analyzed by flow cytometry using CellQuest software to obtain the mean forward scatter height (FSC-H).
Cellular Protein Extracts and Western Blotting
Cellular protein extracts were prepared by lysing in lysis buffer (Tris-HCl, pH 7.4, 150 mM NaCl, 1% Nonidet P-40) plus the tyrosine phosphatase inhibitor Na3VO4 (1 mM) and the protease inhibitors phenylmethylsulfonyl fluoride (1 mM), pepstatin (1 µm), and aprotinin (1.5 µg/ml). After incubation at 4°C for 20 min, nuclear and cellular debris were removed by microcentrifugation at 20,000 x g for 15 min at 4°C. For Western blot analysis proteins were resolved by SDS-PAGE on 4–15% gradient gels and transferred to nitrocellulose membranes. Blots were incubated for 1 h at room temperature in tris-buffered saline (TBS) containing 0.05% Tween 20 (TBS-T) and either 5% milk (wt/vol) or 2% bovine serum albumin (BSA). This was followed by primary antibody incubations overnight at 4°C. The anti-phospho p70 S6 Kinase Thr 389 and anti-phospho p70 S6 Kinase Thr 421/Ser 424, anti-p70 S6 Kinase, anti-phospho-4E-BP1, anti-phospho-Akt, anti-Akt and anti-phospho-p42/44 MAP kinase antibodies were all from Cell Signaling Technology (Beverly, MA). Anti-mitogen-activated protein kinase 2 (MAPK2) and anti-paxillin were from Upstate Biotechnology (Lake Placid, NY). The anti-Ha antibody 12CA5 was from Roche Molecular Biochemicals (East Sussex, United Kingdom) and anti-VDAC antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-actin mAb was from Sigma. Secondary antibodies conjugated with horseradish peroxidase (Dako, High Wycombe, United Kingdom) were used for detection with enhanced chemiluminescence (ECL, Amersham Biosciences, Little Chalfont, United Kingdom).
Small Interfering RNA Oligonucleotides and Transfection
Small interfering RNAs (siRNAs; Elbashir et al., 2001
) oligonucleotides were obtained from MWG (Ebersberg, Germany). An oligonucleotide complementary to both the human and mouse sequence of the pnc1 gene (aatttggttggagttgcacca; corresponding to nucleotides 311–332 in the human gene and nucleotides 304–325 in the mouse gene after the start codon) was used. Two other predesigned oligonucleotides specific for the human gene were obtained from Ambion (Huntingdon, United Kingdom; siRNA1 ID no. 123672 and siRNA3 ID no. 123673). A negative control siRNA (negative control no. 1) was also from Ambion. Transfection was carried out using OligofectAMINE transfection reagent (Invitrogen) with concentrations of oligonucleotide ranging from 10 to 200 nM. All concentrations tested showed similar specific effects on suppressing protein expression and decreasing cell size. For most experiments 50 nM of oligonucleotide was used. Expression of the transfected Ha-PNC1 protein was assessed by Western blotting using the anti-Ha antibody. RNA levels were assessed using semiquantitative or quantitative RT-PCR 48–96 h after transfection.
Semiquantitative and Quantitative RT-PCR
Tissue extracts from prostate carcinomas and macrodissected adjacent normal prostate were isolated from radical prostatectomy specimens directly after surgery. All samples were used after informed consent of the patient and approval by the local Ethics Committee of the University of Würzburg, Germany. Total RNA was isolated using the Trizol method and cDNA synthesis was carried out by reverse transcription with equal amounts of RNA (2 µg) using a cDNA synthesis kit (Roche Molecular Biochemicals or Invitrogen). Equal amounts of cDNA were amplified and the quantity of reverse transcription reaction used for amplification was nonsaturating for the PCR product after the selected number of amplification cycles.
Quantitative PCR was carried out using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA; or in the case of prostate tissues by the LightCycler instrument; Roche Molecular Biochemicals) with QuantiTect SYBR Green technology (Qiagen, Crawley, West Sussex, United Kingdom). Primers used were as follows: pnc1: 5'-GCTCTGCAGCTTTTATCACAAATTC-3' and, 5'-AACGTAACGAGCACACTGGAGTG-3'; gapdh: 5'-CCCATGTTCGTCATGGGTGTGA-3' and 5'-TGGTCATGAGTCCTTCCACGATACC-3';
-actin: 5'-ATTGCCGACAGGATGCAGAA-3' and 5'-GCTGATCCACATCTGCTGGAA-3'. Plates were heated for 15 min at 95°C, and 40 PCR cycles consisting of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C were applied. Samples were subsequently heated to 95°C. Results were expressed as DeltaDelta CT [(CT PNC1 – CTGAPDH)siRNA – (CTPNC1 – CTGAPDH)neg] and as relative amounts to negative control.
Purification of PNC1 from Escherichia coli
hPNC1 was expressed in inclusion bodies in E. coli BL21(DE3) cells using procedures previously described for the bovine oxoglutarate carrier (Fiermonte et al., 1993
) and several other mitochondrial carriers (Palmieri et al., 2000
). Control cultures containing the empty pRUN vector were processed in parallel. Inclusion bodies were purified on a sucrose density gradient (Fiermonte et al., 1993
) and washed at 4°C first with buffer A (10 mM Tris-HCl, pH 7.0/0.1 mM EDTA); twice with 3% (wt/vol) Triton X-114, 1 mM EDTA, and 10 mM Pipes/NaOH, pH 7.0; and finally with buffer A. The proteins were solubilized in 1.8% (wt/vol) N-dodecanoylsarcosine (sarkosyl). Small residues were removed by centrifugation.
Reconstitution into Liposomes and Transport Measurements
The recombinant hPNC1 protein in sarkosyl was reconstituted into liposomes in both the presence and the absence of substrates, as described previously (Palmieri et al., 1995
). The external substrate was removed from proteoliposomes on Sephadex G-75 columns pre-equilibrated with 50 mM NaCl and 10 mM PIPES, pH 7.0. Transport at 25°C was started by adding the indicated labeled substrate and was stopped after 90 min by adding a mixture of 20 mM pyridoxal 5'-phosphate and 20 mM bathophenanthroline. In control samples the inhibitors were added at time zero according to the inhibitor stop method (Palmieri et al., 1995
), the external radioactivity was removed, and the radioactivity in the liposomes was measured. The experimental values were corrected by subtracting the respective controls.
Mitochondrial Isolation
Cells were removed from plates by trypsinization followed by washing with PBS and centrifugation at 1000 x g to generate a pellet. A volume of mitochondrial extraction buffer (10 mM Tris-Cl, pH 7.5, 210 mM sucrose, 70 mM sorbitol, 10 mM NaCl, 1 mM EDTA, 1.5 mM MgCl2) equivalent to three times the volume of the pellet was added. Cells were homogenized by fine needle (26-gauge) aspiration 10 times and the homogenates centrifuged at 1000 x g for 15 min at 4°C. The supernatants were removed to fresh tubes and recentrifuged at 1000 x g to remove any residual cellular contaminants. The supernatants were again removed and centrifuged at 7000 x g for 15 min at 4°C. The pellet obtained represents the mitochondrial fraction. This was then washed three times with PBS to remove any remaining cytosolic fraction contaminants.
Extraction and Analysis of Nucleotides
The cell or mitochondrial pellet was gently resuspended in an ice-cold 6% solution of trichloroacetic acid to precipitate protein. Samples were incubated on ice for 10 min and centrifuged at 20,800 x g for 10 min at 4°C. The protein pellet was discarded, and, to remove the acid, an equal volume of 7.0% trioctylamine in Freon (1,1,2 trichlorotrifluoroethane) was added to the retained supernatant. The mixture was shaken vigorously and then centrifuged at 20,800 x g for 5 min at 4°C. The nucleotides were recovered in the upper aqueous phase.
Chromatographic separation of the nucleotide pools was achieved using reverse phase, ion-pairing HPLC on a Vydac C18 column (250 x 4.6 mm, 5-µm particle size) fitted with a C18 guard column. The mobile phase consisted of buffer A (4.0 mM tetrabutylammonium bisulphate, 100 mM KH2PO4, pH 6.0) and buffer B, which was prepared by adding 30% methanol to buffer A. Buffers were filtered and degassed before use. Separation was achieved at 1 ml/min using the following gradient: 0–20% buffer B over 8 min, 20–70% B over 12 min, and then a decrease to 0% B over 5 min. Nucleotide standard solutions, prepared using a 5'-nucleotide and nucleoside kit from Sigma, were used to validate peak positions.
| RESULTS |
|---|
|
|
|---|
|
-helical bundle with pseudothreefold symmetry as exemplified by the structure of the bovine ADP/ATP carrier (Pebay-Peyroula et al., 2003
-electrons of the aromatic residues form a negatively charged face, which can interact electrostatically with positively charged residues (Dougherty, 1996
pnc1 Expression Is Enhanced in Transformed Cells and Is Induced by IGF-I or Insulin
pnc1 mRNA is overexpressed in R+ cells compared with R– cells, so this suggested that its expression level and related transport activity are important determinants of its contribution to metabolism in R+ cells and other transformed cells.
To investigate this, we asked if pnc1 expression was associated with cellular transformation in cells other than fibroblasts. pnc1 mRNA was detected in the breast carcinoma cell line MCF-7, but not in the nontumorigenic breast myoepithelial cell line MCF10A (Figure 2A). Similarly pnc1 mRNA was detected in the Jurkat T lymphocytic leukemia cell line, but not in primary T lymphocytes (Figure 2A). pnc1 mRNA expression was then investigated in a panel of 11 primary prostate carcinomas compared with normal prostate tissue. Significantly higher pnc1 expression was observed in the prostate tumors compared with normal tissues (Figure 2B).
|
Induction of pnc1 mRNA by IGF-I in MCF-7 cells was found to be dependent on the activity of the PI-3 kinase and mTOR pathways, but it was repressed by the Erk MAPK pathway. This was determined by pharmacological inhibition of each of these three pathways with LY29004 (PI3 kinase inhibitor), rapamycin (mTOR inhibitor), and PD98059 (Mek inhibitor) before IGF-I stimulation (Figure 2D). Examination of the PNC1 promoter region revealed that in addition to the classical promoter components such as the TATA box, CBP/p300, and S8 ribosome unit binding sites a large number of putative binding sites for transcription factors responsive to the PI-3K, mTOR, MAPK, and PKA pathways were evident (Supplementary Figure S1).
Taken together these data indicate that pnc1 expression is enhanced in transformed cell lines and primary tumors and is rapidly responsive to either insulin or IGF-I signaling through the PI-3 kinase/mTOR pathway.
Overexpressed PNC1 Causes an Increase in Cell Size
To investigate if overexpression of the PNC1 protein could be used to determine its contribution to IGF-I and insulin signaling in tumor cells, plasmids encoding PNC1 as either a GFP- or Ha-fusion protein were transiently transfected into MCF-7 or HeLa cells. Confocal microscopy showed that GFP-PNC1 colocalized with mitoTracker, which specifically labels mitochondria (Figure 3A). HeLa cells transiently expressing Ha-PNC1 were costained with an anti-Ha antibody and a human anti-mito antibody, which labels mitochondrial membranes. This demonstrated that Ha-PNC1 became localized to mitochondrial membranes. Overexpression of PNC1 had no discernible effect on mitochondrial membrane polarization as assessed with the JC1 fluorescent probe (data not shown), which indicates that it does not alter the integrity of the mitochondrial membrane.
|
Suppression of PNC1 by siRNA Causes Decreased Cell Size and Decreased Proliferation
Because mitochondrial carrier proteins have low turnover rates and are present in the mitochondrial membrane at low levels (Palmieri, 1994
), we hypothesized that suppression of PNC1 expression could have a greater impact on cells than overexpression of the protein. This hypothesis is supported by the observation that Rim2p yeast mutants exhibit a petite phenotype in complete medium (Van Dyck et al., 1995
).
Several siRNA oligonucleotides directed against pnc1 were used to suppress its expression in MCF-7, MCF-7/ Ha-PNC1, DU145 prostate carcinoma, or HeLa cervical carcinoma cell lines. We could not generate rabbit antisera with sufficiently high affinity to detect endogenous PNC1 protein, so the Ha antibody was used to detect overexpressed PNC1 protein and RT-PCR was used to detect endogenous pnc1 mRNA. Ha-PNC1 protein expression was reduced at 2, 3, and 4 d in MCF-7/HaPNC1 cells transfected with pnc1-specific siRNA compared with control (Figure 4A). RT-PCR analysis demonstrated that endogenous pnc1 mRNA was reduced in siRNA-treated MCF-7/Neo cells, but mRNAs for the folate and dicarboxylate mitochondrial carriers (Fiermonte et al., 1998
; Titus and Moran, 2000
) were not altered (shown in Figure 4B at 72 h after transfection).
|
Proliferation of MCF-7 cell cultures transfected with pnc1-specific siRNA was greatly decreased over 96 h compared with control siRNA-transfected cells (Figure 4D). Analysis of cell cycle progression in MCF-7 cells demonstrated that cells with PNC1 suppressed had more cells in the G1 phase of the cell cycle and fewer cells in the G2/M phases than control cells (Figure 4E). This indicates that the cell cycle is delayed in the G1 phase in cell cultures with reduced PNC1 expression, which may explain the reduced growth (size) and proliferation of these cells. Overall, these data demonstrate that reduced PNC1 expression causes retarded cell growth and proliferation.
IGF-I–mediated Activation of mTOR Is Not Affected by PNC1 Expression
Our data demonstrate that suppression of PNC1 reduces cell growth and proliferation. The effect on cell growth in MCF-7 cells was similar to the effects of the mTORC1 inhibitor rapamycin. Because both growth factors and nutrients are necessary for activation of the mTORC1 pathway, we hypothesized that PNC1 may contribute to a mitochondria-dependent signal required for mTOR activation. Therefore, we investigated the status of the mTOR pathway in cells with enhanced or suppressed PNC1 expression. As can be seen in Figure 5IGF-I-mediated phosphorylation of Akt and the mTORC1 target proteins S6K1 and 4EBP1 was not altered in MCF-7 cells overexpressing PNC1. Moreover, suppression of PNC1 expression in MCF-7 or HeLa had no effect on IGF-I–mediated phosphorylation of these proteins (data not shown). Altogether these results indicate that the effect of PNC1 on cell size and proliferation is not due to altered IGF-I–mediated activation of the mTORC1 pathway.
|
|
|
Overall, the data indicate that suppression of PNC1 expression causes decreased accumulation of UTP in mitochondria. This suggests that the effects of PNC1 suppression on cell growth are due to its function as a UTP carrier and that mitochondrial UTP levels may regulate cell growth.
PNC1 Expression Regulates Cellular ROS Levels
We next asked if suppressed PNC1 expression may elicit a mitochondrial retrograde or stress signaling response, which is associated with increased cellular ROS and has been proposed as an important mechanism of communication between mitochondria and nucleus in response to physiological and pathological stimuli (Biswas et al., 1999
; Amuthan et al., 2002
; Butow and Avadhani, 2004
). To do this, cellular ROS levels were measured in cells with either increased or decreased PNC1 expression. As can be seen in Figure 8A, MCF-7 cells overexpressing PNC1 had decreased basal cellular levels of ROS compared with Vector controls in normal culture conditions. MCF-7 cells with suppressed PNC1 had increased cellular ROS compared with controls (Figure 8B). HeLa cells with stably suppressed PNC1 expression also had increased ROS levels (data not shown). These data indicate that cellular ROS levels are strongly influenced by PNC1 expression and suggest that PNC1 has a function in regulating mitochondrial retrograde signaling.
|
| DISCUSSION |
|---|
|
|
|---|
PNC1 expression is rapidly induced by both IGF-I and insulin, and this induction could be suppressed by inhibiting either PI-3 kinase or mTORC1 activity. The pnc1 promoter contains several response elements that are known targets of the PI-3 kinase and mTOR pathway (Heinemeyer et al., 1998
). Several putative binding sites for transcription factors known to control the expression of genes encoding mitochondrial proteins (Sp1, NRF-2, and CREB; Scarpulla, 2002
) were also observed in the promoter. Interestingly most of these are present in a small region near the transcription start site, which may indicate the presence of a proximal promoter. All of this suggests that PNC1 is a transcriptional target of the PI-3 kinase signaling pathway important for regulation of mitochondrial activity. Our data on enhanced expression of PNC1 in all transformed cell lines tested compared with nontransformed cells and in a panel of prostate carcinomas compared with normal prostate tissue suggest that PNC1 may be up-regulated to provide a growth advantage to cancer cells. This is in agreement with recent studies suggesting a central role for the mTORC1 signaling complex in oncongenesis. By using a series of murine models that are deficient in specific Akt isoforms, it was demonstrated that the requirement for Akt signaling to promote oncogenesis and cell proliferation is exclusively dependent on the activity of the mTORC1 (mTOR-Raptor) complex (Skeen et al., 2006
). Interestingly, we also observed increased PNC1 expression in tumor tissues of different origin and in prostate tissues exhibiting hyperplasia (data not shown). These observations suggest that increased expression of PNC1 may generally be associated with proliferating cells or may contribute to the early stages of malignant transformation.
Overexpression of PNC1 increased cell growth and suppression of PNC1 expression caused decreased cell growth. In MCF-7 cells this was accompanied by a decrease in the rate of progression through the cell cycle and overall decreased cell proliferation. The decreased cell growth may be a consequence of the retarded progression through the G1 phase of the cell cycle. However, although suppression of PNC1 caused decreased accumulation of UTP in the mitochondria, this was not accompanied by changes in the cellular ATP/ADP ratio or ATP levels. This suggests that the retarded cell cycle progression is not solely caused by altered cellular energy levels that could result from deceased ATP production by mitochondria and the consequent alterations in ADP and AMP levels.
The decreased size of cells with suppressed PNC1 expression prompted us to investigate the mTOR pathway as a target of the putative signal from mitochondria to the cell cycle. S6K1 and 4EBP1 have previously been shown to be dephosphorylated in response to disruption of mitochondrial function (Kim et al., 2002
) and the mTOR-raptor complex to be regulated in a redox-sensitive manner (Sarbassov and Sabatini, 2005
). However, in agreement with our observations on unchanged ATP levels and mitochondrial mass, we did not observe any significant effect on phosphorylation of S6K1 or 4EBP1 in cells with suppressed PNC1. It has been proposed that a homeostatic regulatory loop exists between mTORC1 and mitochondria (Schieke and Finkel, 2006
). In addition to mTORC1 activity being regulated by mitochondrial signals, the activation and stability of the mTORC1 complex has been correlated with increased oxidative phosphorylation and oxidative capacity (Schieke et al., 2006
). Overall, our data demonstrating induction of PNC1 in a mTORC1-dependent manner and the lack of effects of suppression of PNC1 on S6K1 and 4EBP1 phosphorylation support a role for mTORC1 as an upstream regulator of mitochondrial function.
Because there was no obvious effect on mitochondrial membrane potential or oxidative phosphorylation in cells with suppressed PNC1, we conclude that there was no gross mitochondrial dysfunction in these cells. However the effects of PNC1 suppression on cell cycle progression and cell size suggest that reduced PNC1 results in an inhibitory signal from mitochondria for cell growth and cell cycle progression. This signal may be a component of a mitochondrial retrograde signaling (mitochondrial stress signaling) response, which is thought to be an important mechanism of communication between mitochondria and nucleus in response to physiological and pathological stimuli (Biswas et al., 1999
; Amuthan et al., 2002
; Butow and Avadhani, 2004
). Mitochondrial signaling has been associated with regulation of cell cycle progression (Boonstra and Post, 2004
), with altered cytoplasmic calcium levels, production of ROS, altered stress kinase pathway activation, and altered nuclear gene transcription (Butow and Avadhani, 2004
). Our data demonstrating decreased basal cellular ROS levels when PNC1 is overexpressed and increased ROS levels when PNC1 is suppressed suggest that PNC1 can regulate mitochondrial retrograde signaling. Increased cellular ROS levels have previously been shown to enhance or suppress cell cycle progression and signaling responses in cells (Boonstra and Post, 2004
). In conditions where there is cell cycle arrest in G1, this may be associated with protection from oxidative damage and cell death (Rancourt et al., 2002
). The precise mechanism of the effects of PNC1-regulated ROS levels on cell growth remain to be determined as do the consequences of this for transformed cells. However, it is apparently not dependent on p53 function because similar effects were observed in HeLa cells, which do not express functional p53, and in MCF-7 cells.
Mitochondria may propagate retrograde signals as a mechanism of promoting adaptations to physiological changes that are sensed in cells. This possibility is receiving significant attention as a causative factor in ageing and lifespan regulation in simple organisms (Biswas et al., 2005
; Schieke and Finkel, 2006
). Mitochondrial signals may also have a role in pathological adaptations such as in cancer progression. For example, in lung carcinoma cells mitochondrial retrograde signaling has been associated with induction of genes required for acquisition of an aggressive invasive phenotype (Biswas et al., 2005
).
PNC1 is the first mammalian mitochondrial carrier identified to have selectivity for pyrimidine nucleotides. It displays a distinct preference for UTP over TTP and CTP unlike the closely related yeast carrier Rim2p, which transports UTP, CTP, and TTP (Marobbio et al., 2006
). This suggests a more specialized function in mammalian cells than in yeast cells. However, it is likely that PNC1 is not solely responsible for transporting pyrimidine nucleotides into mitochondria, and there is compensatory activity by related isoforms or a carrier that can transport all purine and pyrimidine nucleotides without selectivity (Palmieri, 2004
). This might also explain the lack of gross mitochondrial dysfunction in cells when PNC1 was suppressed.
In summary, we have demonstrated that PNC1 is a target of the IGF-I and insulin signaling pathway that functions in integration of growth factor signaling and mitochondria function with cell growth and proliferation. Increased expression of PNC1 in transformed cells suggests that PNC1 is important for the activity of mitochondria in the proliferation of cancer cells.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: Rosemary O'Connor (r.oconnor{at}ucc.ie).
| REFERENCES |
|---|
|
|
|---|
Amuthan, G., Biswas, G., Ananadatheerthavarada, H. K., Vijayasarathy, C., Shephard, H. M., and Avadhani, N. G. (2002). Mitochondrial stress-induced calcium signaling, phenotypic changes and invasive behavior in human lung carcinoma A549 cells. Oncogene 21, 7839–7849.[CrossRef][Medline]
Biswas, G., Adebanjo, O. A., Freedman, B. D., Anandatheerthavarada, H. K., Vijayasarathy, C., Zaidi, M., Kotlikoff, M., and Avadhani, N. G. (1999). Retrograde Ca2+ signaling in C2C12 skeletal myocytes in response to mitochondrial genetic and metabolic stress: a novel mode of inter-organelle crosstalk. EMBO J 18, 522–533.[CrossRef][Medline]
Biswas, G., Guha, M., and Avadhani, N. G. (2005). Mitochondria-to-nucleus stress signaling in mammalian cells: nature of nuclear gene targets, transcription regulation, and induced resistance to apoptosis. Gene 354, 132–139.[CrossRef][Medline]
Boonstra, J., and Post, J. A. (2004). Molecular events associated with reactive oxygen species and cell cycle progression in mammalian cells. Gene 337, 1–13.[CrossRef][Medline]
Brand, K. A., and Hermfisse, U. (1997). Aerobic glycolysis by proliferating cells: a protective strategy against reactive oxygen species. FASEB J 11, 388–395.[Abstract]
Butow, R. A., and Avadhani, N. G. (2004). Mitochondrial signaling: the retrograde response. Mol. Cell 14, 1–15.[CrossRef][Medline]
Cully, M., You, H., Levine, A. J., and Mak, T. W. (2006). Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat. Rev. Cancer 6, 184–192.[CrossRef][Medline]
Dougherty, D. A. (1996). Cation-pi interactions in chemistry and biology: a new view of benzene, Phe, Tyr, and Trp. Science 271, 163–168.[Abstract]
Edinger, A. L., and Thompson, C. B. (2002). Akt maintains cell size and survival by increasing mTOR-dependent nutrient uptake. Mol. Biol. Cell 13, 2276–2288.
Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494–498.[CrossRef][Medline]
Fiermonte, G., Palmieri, L., Dolce, V., Lasorsa, F. M., Palmieri, F., Runswick, M. J., and Walker, J. E. (1998). The sequence, bacterial expression, and functional reconstitution of the rat mitochondrial dicarboxylate transporter cloned via distant homologs in yeast and Caenorhabditis elegans. J. Biol. Chem 273, 24754–24759.
Fiermonte, G., Walker, J. E., and Palmieri, F. (1993). Abundant bacterial expression and reconstitution of an intrinsic membrane-transport protein from bovine mitochondria. Biochem. J 294, (Pt 1), 293–299.[Medline]
Heinemeyer, T. et al. (1998). Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26, 362–367.
Hofmann, F., and Garcia-Echeverria, C. (2005). Blocking the insulin-like growth factor-I receptor as a strategy for targeting cancer. Drug Discov. Today 10, 1041–1047.[CrossRef][Medline]
Kaplan, R. S. (2001). Structure and function of mitochondrial anion transport proteins. J. Membr. Biol 179, 165–183.[CrossRef][Medline]
Kim, D. H., Sarbassov, D. D., Ali, S. M., King, J. E., Latek, R. R., Erdjument-Bromage, H., Tempst, P., and Sabatini, D. M. (2002). mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell 110, 163–175.[CrossRef][Medline]
Kunji, E. R. (2004). The role and structure of mitochondrial carriers. FEBS Lett 564, 239–244.[CrossRef][Medline]
LeRoith, D., and Roberts, C. T., Jr. (2003). The insulin-like growth factor system and cancer. Cancer Lett 195, 127–137.[Medline]
Lopez, T., and Hanahan, D. (2002). Elevated levels of IGF-1 receptor convey invasive and metastatic capability in a mouse model of pancreatic islet tumorigenesis. Cancer Cell 1, 339–353.[CrossRef][Medline]
Loughran, G., Healy, N. C., Kiely, P. A., Huigsloot, M., Kedersha, N. L., and O'Connor, R. (2005a). Mystique is a new insulin-like growth factor-I-regulated PDZ-LIM domain protein that promotes cell attachment and migration and suppresses anchorage-independent growth. Mol. Biol. Cell 16, 1811–1822.
Loughran, G., Huigsloot, M., Kiely, P. A., Smith, L. M., Floyd, S., Ayllon, V., and O'Connor, R. (2005b). Gene expression profiles in cells transformed by overexpression of the IGF-I receptor. Oncogene 24, 6185–6193.[CrossRef][Medline]
Majewski, N., Nogueira, V., Bhaskar, P., Coy, P. E., Skeen, J. E., Gottlob, K., Chandel, N. S., Thompson, C. B., Robey, R. B., and Hay, N. (2004). Hexokinase-mitochondria interaction mediated by Akt is required to inhibit apoptosis in the presence or absence of Bax and Bak. Mol. Cell 16, 819–830.[CrossRef][Medline]
Marobbio, C. M., Di Noia, M. A., and Palmieri, F. (2006). Identification of a mitochondrial transporter for pyrimidine nucleotides in Saccharomyces cerevisiae: bacterial expression, reconstitution and functional characterization. Biochem. J 393, 441–446.[CrossRef][Medline]
Palmieri, F. (1994). Mitochondrial carrier proteins. FEBS Lett 346, 48–54.[CrossRef][Medline]
Palmieri, F. (2004). The mitochondrial transporter family (SLC25): physiological and pathological implications. Pfluegers Arch 447, 689–709.[CrossRef][Medline]
Palmieri, F., Indiveri, C., Bisaccia, F., and Iacobazzi, V. (1995). Mitochondrial metabolite carrier proteins: purification, reconstitution, and transport studies. Methods Enzymol 260, 349–369.[Medline]
Palmieri, L., Runswick, M. J., Fiermonte, G., Walker, J. E., and Palmieri, F. (2000). Yeast mitochondrial carriers: bacterial expression, biochemical identification and metabolic significance. J. Bioenerg. Biomembr 32, 67–77.[CrossRef][Medline]
Pebay-Peyroula, E., Dahout-Gonzalez, C., Kahn, R., Trezeguet, V., Lauquin, G. J., and Brandolin, G. (2003). Structure of mitochondrial ADP/ATP carrier in complex with carboxyatractyloside. Nature 426, 39–44.[CrossRef][Medline]
Plas, D. R., Talapatra, S., Edinger, A. L., Rathmell, J. C., and Thompson, C. B. (2001). Akt and Bcl-xL promote growth factor-independent survival through distinct effects on mitochondrial physiology. J. Biol. Chem 276, 12041–12048.
Plas, D. R., and Thompson, C. B. (2005). Akt-dependent transformation: there is more to growth than just surviving. Oncogene 24, 7435–7442.[CrossRef][Medline]
Rancourt, R. C., Hayes, D. D., Chess, P. R., Keng, P. C., and O'Reilly, M. A. (2002). Growth arrest in G1 protects against oxygen-induced DNA damage and cell death. J. Cell. Physiol 193, 26–36.[CrossRef][Medline]
Samuels, Y., and Ericson, K. (2006). Oncogenic PI3K and its role in cancer. Curr. Opin. Oncol 18, 77–82.[Medline]
Sarbassov, D. D., and Sabatini, D. M. (2005). Redox regulation of the nutrient-sensitive raptor-mTOR pathway and complex. J. Biol. Chem 280, 39505–39509.
Scarpulla, R. C. (2002). Transcriptional activators and coactivators in the nuclear control of mitochondrial function in mammalian cells. Gene 286, 81–89.[CrossRef][Medline]
Schieke, S. M., and Finkel, T. (2006). Mitochondrial signaling, TOR, and life span. Biol. Chem 387, 1357–1361.[CrossRef][Medline]
Schieke, S. M., Phillips, D., McCoy, J. P., Jr, Aponte, A. M., Shen, R. F., Balaban, R. S., and Finkel, T. (2006). The mammalian target of rapamycin (mTOR) pathway regulates mitochondrial oxygen consumption and oxidative capacity. J. Biol. Chem 281, 27643–27652.
Schmelzle, T., and Hall, M. N. (2000). TOR, a central controller of cell growth. Cell 103, 253–262.[CrossRef][Medline]
Sell, C., Dumenil, G., Deveaud, C., Miura, M., Coppola, D., DeAngelis, T., Rubin, R., Efstratiadis, A., and Baserga, R. (1994). Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. Mol. Cell. Biol 14, 3604–3612.
Skeen, J. E., Bhaskar, P. T., Chen, C. C., Chen, W. S., Peng, X. D., Nogueira, V., Hahn-Windgassen, A., Kiyokawa, H., and Hay, N. (2006). Akt deficiency impairs normal cell proliferation and suppresses oncogenesis in a p53-independent and mTORC1-dependent manner. Cancer Cell 10, 269–280.[CrossRef][Medline]
Titus, S. A., and Moran, R. G. (2000). Retrovirally mediated complementation of the glyB phenotype. Cloning of a human gene encoding the carrier for entry of folates into mitochondria. J. Biol. Chem 275, 36811–36817.
Todisco, S., Agrimi, G., Castegna, A., and Palmieri, F. (2006). Identification of the mitochondrial NAD+ transporter in Saccharomyces cerevisiae. J. Biol. Chem 281, 1524–1531.
Van Dyck, E., Jank, B., Ragnini, A., Schweyen, R. J., Duyckaerts, C., Sluse, F., and Foury, F. (1995). Overexpression of a novel member of the mitochondrial carrier family rescues defects in both DNA and RNA metabolism in yeast mitochondria. Mol. Gen. Genet 246, 426–436.[CrossRef][Medline]
Wang, B., Li, N., Sui, L., Wu, Y., Wang, X., Wang, Q., Xia, D., Wan, T., and Cao, X. (2004). HuBMSC-MCP, a novel member of mitochondrial carrier superfamily, enhances dendritic cell endocytosis. Biochem. Biophys. Res. Commun 314, 292–300.[CrossRef][Medline]
Warburg, O. (1924). Uber den Stoffwechsel der Carcinomzelle. Biochem. Z 152, 309–344.
Warburg, O., Posener, K., and Negelein, E. (1930). The Metabolism of Tumours, London: Arnold Constable.
This article has been cited by other articles:
![]() |
P. Boesch, N. Ibrahim, A. Dietrich, and R. N. Lightowlers Membrane association of mitochondrial DNA facilitates base excision repair in mammalian mitochondria Nucleic Acids Res., December 10, 2009; (2009) gkp1143v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Casimir, F. M. Lasorsa, B. Rubi, D. Caille, F. Palmieri, P. Meda, and P. Maechler Mitochondrial Glutamate Carrier GC1 as a Newly Identified Player in the Control of Glucose-stimulated Insulin Secretion J. Biol. Chem., September 11, 2009; 284(37): 25004 - 25014. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fiermonte, E. Paradies, S. Todisco, C. M. T. Marobbio, and F. Palmieri A Novel Member of Solute Carrier Family 25 (SLC25A42) Is a Transporter of Coenzyme A and Adenosine 3',5'-Diphosphate in Human Mitochondria J. Biol. Chem., July 3, 2009; 284(27): 18152 - 18159. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu, M. Johansson, and A. Karlsson Human UMP-CMP Kinase 2, a Novel Nucleoside Monophosphate Kinase Localized in Mitochondria J. Biol. Chem., January 18, 2008; 283(3): 1563 - 1571. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||