|
|
|
|
Vol. 18, Issue 9, 3656-3666, September 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cellular and Molecular Medicine, University of Copenhagen, The Panum Institute, DK-2200 Copenhagen N, Denmark
Submitted January 12, 2007;
Revised June 6, 2007;
Accepted June 29, 2007
Monitoring Editor: Robert Parton
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
6
1 integrin (Shimizu et al., 2003
It has remained elusive whether endocytosis and C-terminal cleavage of ErbB2 are independent or correlated events. If positively correlated, C-terminal cleavage of ErbB2 could promote endocytosis by releasing ErbB2 from a retention mechanism that normally sequesters the receptor at the plasma membrane (Sorkin et al., 1993
; Hommelgaard et al., 2004
; Lerdrup et al., 2006
) or by exposure of an unknown cryptic motif stimulating endocytosis. In support of this, Tikhomirov and Carpenter (2003)
observed that a C-terminally truncated mutant, ErbB2
C990, was destabilized. Alternatively, cleavage could occur as a consequence of endocytosis, e.g., in order to attenuate signaling from endosomes, as in insulin receptor signaling (Wiley and Burke, 2001
). A similar mechanism was previously demonstrated for the Notch receptor that requires endocytosis for its intracellular cleavage (Gupta-Rossi et al., 2004
).
In the present study we have therefore asked whether C-terminal cleavage of ErbB2 stimulates endocytic down-regulation of ErbB2 or vice versa. We here report that a fluorescent ErbB2 fusion protein lacking the C-terminal tail similarly to ErbB2
C990 readily becomes internalized and degraded in lysosomes in unstimulated cells. Furthermore, Western blots of internalized ErbB2 and imaging of a full-length ErbB2 doubly tagged with fluorescent proteins confirmed that a larger relative amount of cleaved ErbB2 was present in the endocytic pathway than on the plasma membrane of GA-stimulated cells. Importantly, this ErbB2 cleavage took place already at the plasma membrane and depended on proteasomal activity. In GA-stimulated cells cleaved ErbB2 was degraded in lysosomes
20-fold more efficiently than full-length ErbB2 because of increased internalization and reduced recycling. Altogether, this suggests that ErbB2 is normally retained from the endocytic machinery by its C-terminal tail and that C-terminal cleavage of ErbB2 releases it from this retention.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Subcloning of Fluorescent ErbB2 Constructs
The YFP-ErbB2-CFP (YEC) was constructed using an ErbB2-CFP construct (Lerdrup et al., 2006
) and pEYFP-C1 (Clontech, Palo Alto, CA). Between ErbB2's signal sequence (amino acids: MIIME LAAWC RWGFL LALLP PGIA) and actual protein, we inserted the restriction sites ScaI and SalI in order to insert YFP. YFP-ErbB2 and YFP-ErbB2
C994 were PCR amplified from YEC using the primers GCTGGTTTAGTGAACCGTCAGATCC and GGTACCTCATACAGGTACATCCAGGCC or AAGCTTCTAGATGACCACAAAACGCTGGGGG, gel purified, and Topo-ligated into pcDNA3.1D/V5-His-TOPO. All constructs were sequenced to avoid unwanted mutations.
Biotin Internalization Assay
Cells were washed with ice-cold phosphate-buffered saline (PBS) and incubated twice with 0.5 mg/ml Sulfo-NHS-SS-Biotin (Pierce, Rockford, IL) for 20 min at 4°C. Next, cells were washed with ice-cold DMEM-HEPES plus 1% bovine serum albumin (BSA) for 10 min at 4°C, followed by incubation with DMEM-HEPES plus 0.2% BSA and 2 mM glutamine with 0.3, 1, 3, 10, or 30 µM GA (Sigma-Aldrich, St. Louis, MO) and when indicated also 500 nM bafilomycin A1 (Sigma-Aldrich), 10 µM monensin (Sigma-Aldrich), or 10 µM lactacystin (Sigma-Aldrich) for 2 h at 37°C. Control cells were incubated with DMEM-HEPES plus 0.2% BSA and 2 mM glutamine with 0.2 or 2% DMSO for 2 h at 4 or 37°C. Cells were transferred back onto ice and washed. Biotin on the plasma membrane was cleaved off using a reducing solution (50 mM 2-sodium-2-mercaptoethane-sulfonate (Sigma-Aldrich), 100 mM NaCl, 50 mM Tris-HCl, pH 8.7, 2.5 mM CaCl2) for 20 min at 4°C three times. Cells were washed with ice-cold PBS, scraped off in lysis buffer (20 mM MOPS, 1 mM EDTA, pH 8, 150 mM NaCl, 3.5 mM SDS, 1% NP-40, 25 mM sodium deoxycholate (DOC), and phosphatase inhibitor cocktail 1:100; Sigma-Aldrich), sonicated, and centrifuged for 10 min at 16,000 x g at 4°C. Protein levels were determined and the samples were standardized. streptavidin-coated beads (Sigma-Aldrich) were added, and samples incubated overnight at 4°C. Samples were centrifuged for 1 min at 800 x g at 4°C, and the pellet washed in lysis buffer three times. The pellet was dissolved in lysis buffer with Laemmli buffer, 50 mM dithiothreitol was added, and the sample was subjected to Western blot analysis.
Western Blotting
The samples were subjected to SDS-PAGE using 6 or 8% acrylamide gels and transferred to a polyvinylidene fluoride (PVDF) membrane (Amersham Biosciences, Piscataway, NJ). Membranes were blocked with 5% milk powder (Bio-Rad, Richmond, CA) in PBS-0.1% Tween 20 followed by incubation with anti-ErbB2 (R&D Systems, Minneapolis, MN, AF1129) and afterward HRP-conjugated secondary antibodies (DAKO, Carpinteria, CA). Imaging and quantification of bands was done using ECL (Amersham Biosciences) and an AutoChemi system darkroom (UVP, San Gabriel, CA).
Microscopy
Cells plated on eight-well normal or coverslip chamber slices (Lab-Tek, Naperville, IL) were allowed to grow for 24 h and transfected (Fugene6, Roche, Indianapolis, IN) with ErbB2 constructs and/or TfR-GFP (Burack et al., 2000
), Rab7-GFP (Bucci et al., 2000
), Lamp1-GFP or CD63-GFP (kind gifts from Frederik Vilhardt, University of Copenhagen, Denmark) where indicated. Forty-eight hours after transfections (or plating for untransfected cells) cells were incubated with 3 µM GA, 10 µM lactacystin (Sigma-Aldrich), 500 nM bafilomycin A1 (Sigma-Aldrich), 10 µM monensin (Sigma-Aldrich), and/or 250 µM ALLN (calpain inhibitor I; Sigma-Aldrich) in culture medium for the indicated time at 37°C before fixation in 2% paraformaldehyde (PFA) or live cell imaging. Fixed cells were permeabilized and blocked in blocking buffer (5% goat serum with 0.2% saponin) for 20 min at room temperature (RT) and washed in PBS. Where indicated, cells were incubated with primary antibodies (mouse monoclonal Sc08 raised against the extracellular part of ErbB2, Santa Cruz Biotechnology, Santa Cruz, CA; rabbit polyclonal Ab-1 raised against aa. 1243–1255 of ErbB2, Neomarkers, Fremont, CA) in blocking buffer for 1 h at RT, washed, incubated with secondary antibody (Alexa-568– or Alexa-633–conjugated goat anti-mouse, Alexa-488 goat anti-rabbit, Invitrogen) in blocking buffer for 30 min at RT, washed, and mounted with Flouromount G (Southern Biotechnology Associates, Birmingham, AL).
For live cell imaging the medium was substituted with 37°C HEPES buffer (20 mM HEPES, pH 7.5, 140 mM NaCl, 2 mM CaCl2, 10 mM KCl, 1 mg/ml glucose), and the cells were studied at 37°C using a heated microscope stage. All slides were examined with an LSM 510-Meta confocal microscope (Carl Zeiss, Thornwood, NY) equipped with 40x and 63x apochromat objectives. Cyan fluorescent protein (CFP), green fluorescent protein (GFP), and yellow fluorescent protein (YFP) were excited using a 458- or 488-nm Argon laser line, and their emissions were separated using hyperspectral imaging and linear unmixing with separately acquired reference spectra including a background spectrum. Alexa fluorophores were excited in multitrack-mode with the 488-nm Argon laser line, a 543-nm NeHe laser, or a 633-nm NeHe laser, and their emission was separated using conventional emission filtering. Images were processed (linear contrast enhancements and mild Gaussian blur to minimize noise) and quantitated using the LSM software v. 3.2 (Carl Zeiss) and WCIF compilation (http://www.uhnresearch.ca/facilities/wcif/imagej/) of ImageJ v1.37a (http://rsb.info.nih.gov/ij/).
Ratiometry Imaging and Color Coding of CFP and YFP Signals from YEC
The hyperspectral imaging and linear unmixing allowed us to simultaneously detect the overlapping CFP and YFP emissions with a fixed relative efficiency, allowing comparisons of YFP-CFP ratios between different samples with great reliability and without any influence from cell movements. Ratiometry images or movies were calculated and colored using a plugin we created for ImageJ, and the source code is available as Supplementary Videos, Textfile 1. Basically the software functioned on a pixel per pixel base by dividing the YFP channel with the CFP channel, applying a rainbow pseudocoloring (as seen in the color-coded bar in the figures), depending on the YFP-CFP ratio, and multiplying the intensity of this rainbow color with the average intensity of the CFP and YFP channels. The basic settings of the plugin were used for all ratiometry.
Pre-embedding Immunogold Labeling Electron Microscopy
SK-BR-3 cells were fixed in 0.1% glutaraldehyde and 2% formaldehyde in 0.1 M phosphate buffer at RT for 30 min. After a wash the cells were incubated with a rabbit polyclonal anti-GFP antibody (Molecular Probes, Eugene, OR; A11122
[GenBank]
) followed by protein A-gold (10 nm; Dr. G. Posthuma, University Medical Center, Utrecht). Then the cells were briefly fixed and incubated with free protein A, followed by unspecific rabbit IgG, and fixed again. After a wash the cells were next incubated with mouse monoclonal Sc08 (Santa Cruz Biotechnology) against the extracellular (N-terminal) part of ErbB2, followed by 5-nm gold–labeled goat anti-mouse antibody (Amersham Biosciences). After a brief fixation and a wash the cells were scraped off and further processed for Epon embedding and electron microscopy (pre-embedding immunogold labeling electron microscopy) as previously described (Hommelgaard et al., 2004
).
| RESULTS |
|---|
|
|
|---|
C990 described by Tikhomirov and Carpenter (2003)
C994 (position 994 of rat ErbB2 corresponds to 990 of human ErbB2) and endogenous ErbB2 labeled with an antibody specific for human ErbB2. To ensure correct localization to the endoplasmic reticulum during translation and correct insertion into the membrane, YFP was added between the predicted signal sequence cleavage site of ErbB2 and the actual ErbB2 protein (Bendtsen et al., 2004
C994, a relatively large fraction of this protein was localized in cytoplasmic vesicles (Figure 1B), and in cells treated with bafilomycin for 2 h an even larger fraction was localized in cytoplasmic vesicles, suggesting that YFP-ErbB2
C994 is readily internalized and degraded in lysosomes (Figure 1D).
|
C994 actually were parts of the endosomal/lysosomal pathway, we coexpressed YFP-ErbB2
C994 with various markers of endocytic compartments fused to GFP. Indeed in bafilomycin-treated cells, YFP-ErbB2
C994 did accumulate in compartments positive for TfR-GFP, Rab7-GFP, CD63-GFP, or Lamp1-GFP (Figure 1, E and F, and data not shown). Immunostaining of endogenous ErbB2 confirmed that YFP-ErbB2, in contrast to YFP-ErbB2
C994, primarily colocalized with endogenous ErbB2 on the plasma membrane (Figure 1, G and H). The same was observed when colocalization was quantitated from a large number of cells (Supplementary Figure 1). To confirm that intracellular YFP-ErbB2
C994 did origin from the plasma membrane, we studied cells that have been pretreated with the protein synthesis inhibitor cycloheximide (CHX). After bafilomycin stimulation of these cells, a markedly higher accumulation of YFP-ErbB2
C994 than YFP-ErbB2 could be observed. When the fluorescence in the interior of cells treated this way was removed using photobleaching, subsequent time-lapse microscopy demonstrated a significant recovery of intracellular YFP-ErbB2
C994 fluorescence within 25 min. Given that these cells had their protein synthesis inhibited, this intracellular fluorescence has to originate from the surface (Supplementary Figure 1). Thus, the C-terminal truncation (
C994) of ErbB2, previously reported to destabilize ErbB2 (Tikhomirov and Carpenter, 2003
Endocytosis Correlates Positively to Cleavage of ErbB2
To further investigate if C-terminal cleavage of ErbB2 and endocytosis are positively correlated, we stimulated SK-BR-3 cells with GA and used a biotin internalization assay to compare the size of internalized ErbB2 to that of ErbB2 in total cell lysates (Figure 2A). Using an antibody against the extracellular part of ErbB2, we observed both the full-length 185-kDa ErbB2 and cleaved 135-kDa ErbB2 lacking its C-terminal, cytoplasmic tail in total cell lysates (Figure 2A, top). A range of GA concentrations stimulated both internalization and cleavage of ErbB2 as previously described (Figure 2, A and B; Mimnaugh et al., 1996
; Tikhomirov and Carpenter, 2000
, 2001
, 2003
; Austin et al., 2004
; Lerdrup et al., 2006
). Whereas virtually no ErbB2 was cleaved in control cells (Figure 2A, top), 25–70% of ErbB2 was cleaved in GA-stimulated cells (Figure 2A, top), and a very large fraction of the internalized ErbB2 (80–95% depending on GA concentration) was cleaved (Figure 2, A and B, bottom). Importantly, the ratio of cleaved to full-length ErbB2 was markedly higher in the internalized fraction compared with whole cell lysates at all GA concentrations (Figure 2A). This demonstrates a positive correlation between endocytosis and cleavage of ErbB2, but not whether cleavage promotes endocytosis or vice versa. To confirm the difference in cleavage between endocytosed and plasma membrane ErbB2 in GA stimulated cells by an independent method, we performed immunofluorescence and confocal microscopy of GA-stimulated cells. In concordance with the biotin internalization assay, when compared with the plasma membrane, vesicular structures had a stronger labeling of the extracellular part of ErbB2 relative to the intracellular part (Figure 2C, arrowheads). However, we could also observe vesicular structures with a strong labeling of the intracellular part of ErbB2 relative to the extracellular part (Figure 2C, arrows).
|
|
Endocytosed ErbB2 Is Cleaved
To confirm the positive correlation between cleaved and endocytosed ErbB2 seen with the biotin internalization assay, we used confocal microscopy to track YEC localization and cleavage in SK-BR-3 cells after GA stimulation. In fixed and permeabilized cells cleavage of the intracellular part of ErbB2 was visible both at the plasma membrane and in vesicular structures after GA stimulation (Figure 4A, seen as an increase in YFP-CFP ratio). Importantly, most vesicles had a higher YFP-CFP ratio than the plasma membrane (Figure 4A, arrowheads), but we could also observe vesicles with a markedly lower YFP-CFP ratio (Figure 4A, arrows). Similar results were found with BT474 breast cancer cells and with SK-BR-3 cells expressing a variant of YEC that was based on human ErbB2 (data not shown). Quantification of the YFP-CFP ratio in vesicles and at the plasma membrane of individual SK-BR-3 cells demonstrated that in most cells, the average YFP-CFP ratio was higher in vesicles compared with the plasma membrane (Figure 4B).
|
GA-induced Cleavage of ErbB2 at the Plasma Membrane Increases Its Lysosomal Degradation
In agreement with ErbB2 being cleaved before internalization, many cells had increased YFP-CFP ratios at the plasma membrane after GA stimulation (examples in Figure 5A). To strengthen this finding, we measured plasma membrane YFP-CFP ratios of a large number of cells with and without GA stimulation. The majority of unstimulated cells had a plasma membrane YFP-CFP ratio of approximately 0.25, and a few unstimulated cells had a YFP-CFP ratio larger than 1.0. Cells stimulated with GA for 2 h had more heterogeneous and significantly higher YFP-CFP ratios at the plasma membrane than unstimulated cells (p << 0.001, Mann-Whitney two-tailed U test; Figure 5B), suggesting that cleavage of the intracellular part of ErbB2 occurs before its internalization. This increased cleavage of plasma membrane ErbB2 was not due to apoptosis (Supplementary Figures 3 and 4). The increase in the YFP-CFP ratio of plasma membrane YEC after GA stimulation could be due to ErbB2 cleavage in the endocytic pathway and recycling of cleaved ErbB2 to the plasma membrane. However this can be ruled out, because inhibition of recycling with monensin did not reduce the cleavage of YEC at the plasma membrane significantly (p = 0.38, Mann-Whitney two-tailed U test), demonstrating that cleavage of the intracellular part of ErbB2 actually does take place at the plasma membrane (Figure 5, D and E). Disruption of the actin cytoskeleton with latrunculin reduced endocytosis of YEC, and most intracellular YEC was in the biosynthetic pathway. However, YEC was still efficiently cleaved at the plasma membrane in latrunculin-treated cells having little endocytosis, confirming that ErbB2 is cleaved at the plasma membrane (Figure 5F).
|
|
C994 and ErbB2-CFP with lactacystin and compared them to unstimulated cells. YFP-ErbB2
C994 was readily internalized in both unstimulated and lactacystin-stimulated cells (Figure 7D), showing that internalization of truncated ErbB2 occurred independently of proteasomal activity. Altogether this suggests that proteasomal activity is an upstream regulator of ErbB2 cleavage after GA stimulation and that proteasomal activity is not needed for the internalization of ErbB2 once it is cleaved.
|
| DISCUSSION |
|---|
|
|
|---|
C994, was internalized and degraded in lysosomes far more efficiently than full-length ErbB2 in unstimulated cells. Using biochemical methods, advanced microscopy, and the doubly fluorescent fusion protein YEC, we demonstrated a clear link between cleavage and endocytosis of ErbB2 in GA-stimulated cells. We furthermore showed that cleavage happens at the plasma membrane in a proteasome-dependent manner before the induced internalization and subsequent lysosomal degradation of ErbB2. After GA stimulation, cleaved ErbB2 recycled to a smaller degree and was degraded in lysosomes as much as 20-fold more efficiently than full-length ErbB2.
Several central conclusions of the present article were aided and strengthened by the use of the reporter construct YEC, which we have shown is a reliable and efficient tool to obtain spatiotemporal information about ErbB2 cleavage in single cells and subcellular compartments. We envision that such a construct can also be used for live cell studies of shedding of the extracellular part of ErbB2 and the consequences of shedding for ErbB2 function, localization, and mobility. Furthermore, it could even be used for studies of ErbB2 cleavage in transgene animals. Cleavage is also an important regulator of other proteins, e.g., ErbB4, Met, Notch, CD44, p75/NTR, and APP (Selkoe et al., 1996
; Haass and De, 1999
; Wallenius et al., 2000
; Ni et al., 2001
; Zampieri et al., 2005
; Petrelli et al., 2006
; Sugahara et al., 2006
), and tandem fusion proteins made from these proteins similarly to YEC could be highly useful. An important advantage of such constructs is that one avoids the problems inherent to ratiometric studies based on immunofluorescence, namely availability of protein epitopes and steric hindrance. Indeed, doubly fluorescent reporter proteins are not failure-free, and they should be supplemented by other methods. In the present study the major findings obtained with YEC are in agreement with data obtained by a biotin internalization assay.
ErbB2 Is Cleaved at the Plasma Membrane
The GA-induced cleavage of ErbB2, which has previously been observed in Western blots (Tikhomirov and Carpenter, 2000
, 2001
, 2003
), could essentially be a result of proteolysis of internalized ErbB2 in the endosomal/lysosomal degradation pathway. Here we demonstrate by several means that ErbB2 is cleaved at the plasma membrane. First, ratiometry demonstrated that YEC localized to the plasma membrane is cleaved after GA stimulation. Second, ErbB2 was already cleaved in early endosomes, ruling out cleavage en route in the lysosomal degradation pathway. Third, imaging of YEC in monensin- or latrunculin-treated cells confirmed that GA did induce YEC cleavage despite inhibited recycling or endocytosis.
Cleavage of ErbB2 Increases Its Internalization and Lysosomal Degradation
The biotin internalization assay investigating GA-stimulated ErbB2 internalization and cleavage demonstrated a clear difference in the behavior of full-length and C-terminally cleaved ErbB2. Most importantly, cells with inhibited lysosomal degradation accumulated 20-fold more cleaved p135 ErbB2 than full-length p185 ErbB2. This reflects the overall impact of cleavage on the rates of internalization and lysosomal targeting. We have demonstrated that the internalization of ErbB2 increases several fold after cleavage, and in most cells the YFP-CFP ratio of YEC in vesicles was higher than that of the plasma membrane YEC. Thus, a major factor contributing to the relatively high lysosomal degradation rate of p135 compared with p185 is an increased internalization rate. This conclusion is supported by the modest increase in the amount of internalized p185 ErbB2 after GA stimulation. Both p135 and p185 ErbB2 are recycled in GA-stimulated cells, but monensin treatment caused a 10-fold increase in intracellularly accumulated p135 ErbB2, whereas the relative effect on p185 ErbB2 was far higher. Altogether, this suggests that in GA-stimulated cells p185 is efficiently recycled and that cleavage increased the amount of ErbB2 targeted for lysosomal degradation.
We previously found that cleavage is not a requirement for ErbB2 internalization (Lerdrup et al., 2006
), and in agreement with this we here observed internalization of full-length ErbB2 after GA stimulation. However on the basis of immunofluorescence colocalization studies of the termini of ErbB2, we also observed an apparent inverse relationship between the amount of internalization and cleavage in each cell (Lerdrup et al., 2006
). A likely explanation of this is that we studied apoptotic as well as nonapoptotic cells and that apoptotic cells both had a reduced internalization and a sudden accumulation of cytoplasmic ErbB2 fragments that markedly reduced colocalization of ErbB2's termini (Supplementary Figures 3 and 4). In contrast, the more slow and moderate cleavage of ErbB2 in nonapoptotic, GA-stimulated cells studied here led to a less pronounced accumulation of cytoplasmic fragments and hence a smaller decrease in colocalization (Supplementary Figures 3 and 4). Lastly, the antibody used here reflects the amount of cleavage of the intracellular part of ErbB2 more accurately than the antibody cocktail used previously (Lerdrup et al., 2006
; Supplementary Figure 5).
Proteasomal Activity Is Needed for Cleavage of ErbB2
GA-induced degradation of ErbB2 can be inhibited by proteasomal inhibitors (Mimnaugh et al., 1996
), and a straight-forward interpretation of this is that ErbB2 is degraded by the proteasome itself (Hong et al., 1999
; Zheng et al., 2000
; Xu et al., 2001
; Citri et al., 2002
; Way et al., 2004
). We recently demonstrated that proteasomal activity is needed for GA-induced internalization and lysosomal degradation of ErbB2 (Lerdrup et al., 2006
). Because we here show that cleavage of ErbB2 promotes its internalization, we asked if the cleavage of the intracellular part of ErbB2 also depended on proteasomal activity. In cells cotreated with GA and one of two proteasomal inhibitors, the GA-induced cleavage of ErbB2 was absent. These observations are in accordance with previous experiments (Tikhomirov and Carpenter, 2000
). Interestingly, YFP-ErbB2
C994 was internalized regardless of inhibition of the proteasome. This suggests that the proteasomal dependence is at the cleavage step and that internalization of ErbB2 once it is cleaved is a proteasome independent process. The cleavage of ErbB2 after GA stimulation is due to endoproteolytic activity, giving rise to cytoplasmic fragments with short half-lives and a transmembrane p135 fragment that has a well-defined size, suggesting that the proteolysis occurs at a specific site (Tikhomirov and Carpenter, 2000
, 2001
, 2003
). The simplest interpretation of the dependence of ErbB2 cleavage on proteasomal activity is that the proteasome is cleaving ErbB2 itself, although it would imply that the proteasome is able to cleave ErbB2 endoproteolytically. Interestingly, it was recently reported that the 20S proteasome actually functions as an endoprotease in processing of the NF
B precursor, p105 (Moorthy et al., 2006
). The requirement of proteasomal activity for ErbB2 cleavage could also be indirect. One possibility is that free ubiquitin becomes sequestered when the proteasome is inhibited with lactacystin. However, inhibition of proteasomal activity leads to an accumulation of ubiquitinylated ErbB2 (Zhou et al., 2003
; our unpublished data), and more importantly ErbB2 was found still to become ubiquitinylated in cells treated with lactacystin and GA (Mimnaugh et al., 1996
; our unpublished data).
Various Mechanisms May Lead from Inhibition of HSP90 to Cleavage of ErbB2
The interaction between HSP90 and its clients occurs in a repetitive ATP-dependent manner, which includes temporary association to several cochaperones and is often termed the chaperone cycle (Caplan et al., 2007
). If the chaperone cycle is inhibited, e.g., by GA, then the cochaperone and ubiquitin ligase carboxyl terminus of HSP70-interacting protein (CHIP) is recruited to the ErbB2-associated chaperone complex stimulating ubiquitinylation of ErbB2 (Xu et al., 2002
; Zhou et al., 2003
; Whitesell and Lindquist, 2005
; Caplan et al., 2007
). Overexpression of CHIP stimulates ErbB2 ubiquitinylation and degradation, whereas overexpression of a ligase-inactive version of CHIP inhibits ErbB2 ubiquitinylation. However, ErbB2 degradation after HSP90 inhibition is not completely abolished in CHIP–/– mouse embryonic fibroblasts (Xu et al., 2002
; Zhou et al., 2003
). We speculate that overexpression of ligase-inactive CHIP would inhibit GA-induced ErbB2 C-terminal cleavage and subsequent internalization. It would be relevant for future studies to address this, as well as if overexpression of CHIP itself could induce ErbB2 C-terminal cleavage and internalization.
Tikhomirov and Carpenter (2000)
tested a range of protease inhibitors in order to characterize the protease(s) responsible for ErbB2 C-terminal cleavage and found that cleavage was inhibited most efficiently by ALLN, less efficiently by lactacystin, and to some extent by the cathepsin B inhibitor Ca074Me. Concordantly, we observed similar effects by these inhibitors on cleavage of YEC (Figure 7, B and C and our unpublished data). ALLN is known to inhibit a range of proteases, most notably the proteasome and calpains; however calpains are not responsible for the cleavage of ErbB2 (Tikhomirov and Carpenter, 2000
). If the proteasome is the actual protease cleaving ErbB2 as hypothesized above, it is puzzling why cleavage can be inhibited with the cathepsin inhibitor Ca074Me, except if it has so far unreported off target effects. An alternative explanation involves lysosomal rupture that has been shown to precede and cause apoptosis (Guicciardi et al., 2004
; Fehrenbacher and Jaattela, 2005
), and it remains a possibility that GA induces a proteasome-dependent lysosome destabilization releasing varying amounts of cathepsins to the cytosol.
The C-Terminus of ErbB2 May Inhibit ErbB2 Internalization
It has been suggested that the resistance of ErbB2 toward endocytosis is due to a retention mechanism (Sorkin et al., 1993
; Austin et al., 2004
; Hommelgaard et al., 2004
; Lerdrup et al., 2006
), and a single study suggested that this is mediated through the C-terminal tail of ErbB2 (Sorkin et al., 1993
). We here show that the C-terminally cleaved ErbB2 is internalized far more readily than full-length ErbB2, supporting that the C-terminus of ErbB2 inhibits its internalization as previously proposed (Sorkin et al., 1993
). There are essentially two different interpretations of this phenomenon: 1) a cryptic motif that stimulates endocytosis is normally hidden and becomes exposed when the C-terminal part of ErbB2 is lacking. 2) Alternatively, full-length ErbB2 could be retained from the endocytic machinery by one of several possible means. The retention could be due to a stable protein–protein association, a dynamic but frequent protein-protein association, a factor competing with endocytic proteins for ErbB2 binding, or removal of covalent modifications recruiting endocytic proteins, e.g., by a deubiquitinase. Future research should address which of the putative mechanisms are responsible for retaining ErbB2 from the endocytic machinery. Given the clear link between ErbB2 overexpression and cancers it is highly important to improve our understanding of this mechanism and identify its components.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
![]()
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
* These authors contributed equally to this work. ![]()
Address correspondence to: Bo van Deurs (b.v.deurs{at}mai.ku.dk).
| REFERENCES |
|---|
|
|
|---|
Baulida, J., Kraus, M. H., Alimandi, M., Di Fiore, P. P., and Carpenter, G. (1996). All ErbB receptors other than the epidermal growth factor receptor are endocytosis impaired. J. Biol. Chem 271, 5251–5257.
Bendtsen, J. D., Nielsen, H., von, H. G., and Brunak, S. (2004). Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol 340, 783–795.[CrossRef][Medline]
Bucci, C., Thomsen, P., Nicoziani, P., McCarthy, J., and van Deurs, B. (2000). Rab7, a key to lysosome biogenesis. Mol. Biol. Cell 11, 467–480.
Burack, M. A., Silverman, M. A., and Banker, G. (2000). The role of selective transport in neuronal protein sorting. Neuron 26, 465–472.[CrossRef][Medline]
Caplan, A. J., Mandal, A. K., and Theodoraki, M. A. (2007). Molecular chaperones and protein kinase quality control. Trends Cell Biol 17, 87–92.[CrossRef][Medline]
Citri, A., Alroy, I., Lavi, S., Rubin, C., Xu, W., Grammatikakis, N., Patterson, C., Neckers, L., Fry, D. W., and Yarden, Y. (2002). Drug-induced ubiquitylation and degradation of ErbB receptor tyrosine kinases: implications for cancer therapy. EMBO J 21, 2407–2417.[CrossRef][Medline]
De Placido, S., Carlomagno, C., De Laurentiis, M., and Bianco, A. R. (1998). c-erbB2 expression predicts tamoxifen efficacy in breast cancer patients. Breast Cancer Res. Treat 52, 55–64.[CrossRef][Medline]
Fehrenbacher, N., and Jaattela, M. (2005). Lysosomes as targets for cancer therapy. Cancer Res 65, 2993–2995.
Guicciardi, M. E., Leist, M., and Gores, G. J. (2004). Lysosomes in cell death. Oncogene 23, 2881–2890.[CrossRef][Medline]
Gupta-Rossi, N., Six, E., LeBail, O., Logeat, F., Chastagner, P., Olry, A., Israel, A., and Brou, C. (2004). Monoubiquitination and endocytosis direct gamma-secretase cleavage of activated Notch receptor. J. Cell Biol 166, 73–83.
Haass, C., and De, S. B. (1999). The presenilins in Alzheimer's disease—proteolysis holds the key. Science 286, 916–919.
Haslekas, C., Breen, K., Pedersen, K. W., Johannessen, L. E., Stang, E., and Madshus, I. H. (2005). The inhibitory effect of ErbB2 on epidermal growth factor-induced formation of clathrin-coated pits correlates with retention of epidermal growth factor receptor-ErbB2 oligomeric complexes at the plasma membrane. Mol. Biol. Cell 16, 5832–5842.
He, Y. Y., Huang, J. L., and Chignell, C. F. (2006). Cleavage of epidermal growth factor receptor by caspase during apoptosis is independent of its internalization. Oncogene 25, 1521–1531.[CrossRef][Medline]
Hommelgaard, A. M., Lerdrup, M., and van Deurs, B. (2004). Association with membrane protrusions makes ErbB2 an internalization-resistant receptor. Mol. Biol. Cell 15, 1557–1567.
Hong, R. L., Spohn, W. H., and Hung, M. C. (1999). Curcumin inhibits tyrosine kinase activity of p185neu and also depletes p185neu. Clin. Cancer Res 5, 1884–1891.
Hynes, N. E., and Stern, D. F. (1994). The biology of erbB-2/neu/HER-2 and its role in cancer. Biochim. Biophys. Acta 1198, 165–184.[Medline]
Klapper, L. N., Kirschbaum, M. H., Sela, M., and Yarden, Y. (2000). Biochemical and clinical implications of the ErbB/HER signaling network of growth factor receptors. Adv. Cancer Res 77, 25–79.[Medline]
Lerdrup, M., Hommelgaard, A. M., Grandal, M., and van Deurs, B. (2006). Geldanamycin stimulates internalization of ErbB2 in a proteasome-dependent way. J. Cell Sci 119, 85–95.
Longva, K. E., Pedersen, N. M., Haslekas, C., Stang, E., and Madshus, I. H. (2005). Herceptin-induced inhibition of ErbB2 signaling involves reduced phosphorylation of Akt but not endocytic down-regulation of ErbB2. Int. J. Cancer 116, 359–367.[CrossRef][Medline]
Magnifico, A., Albano, L., Campaner, S., Campiglio, M., Pilotti, S., Menard, S., and Tagliabue, E. (2007). Protein kinase C
determines HER2 fate in breast carcinoma cells with HER2 protein overexpression without gene amplification. Cancer Res 67, 5308–5317.
Mimnaugh, E. G., Chavany, C., and Neckers, L. (1996). Polyubiquitination and proteasomal degradation of the p185c-erbB-2 receptor protein-tyrosine kinase induced by geldanamycin. J. Biol. Chem 271, 22796–22801.
Moorthy, A. K., Savinova, O. V., Ho, J. Q., Wang, V. Y., Vu, D., and Ghosh, G. (2006). The 20S proteasome processes NF-kappaB1 p105 into p50 in a translation-independent manner. EMBO J 25, 1945–1956.[CrossRef][Medline]
Muthuswamy, S. K., Gilman, M., and Brugge, J. S. (1999). Controlled dimerization of ErbB receptors provides evidence for differential signaling by homo and heterodimers. Mol. Cell. Biol 19, 6845–6857.
Ni, C. Y., Murphy, M. P., Golde, T. E., and Carpenter, G. (2001). gamma-secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294, 2179–2181.
Pegram, M. D., Pauletti, G., and Slamon, D. J. (1998). HER-2/neu as a predictive marker of response to breast cancer therapy. Breast Cancer Res. Treat 52, 65–77.[CrossRef][Medline]
Petrelli, A., Circosta, P., Granziero, L., Mazzone, M., Pisacane, A., Fenoglio, S., Comoglio, P. M., and Giordano, S. (2006). Ab-induced ectodomain shedding mediates hepatocyte growth factor receptor down-regulation and hampers biological activity. Proc. Natl. Acad. Sci. USA 103, 5090–5095.
Selkoe, D. J., Yamazaki, T., Citron, M., Podlisny, M. B., Koo, E. H., Teplow, D. B., and Haass, C. (1996). The role of APP processing and trafficking pathways in the formation of amyloid beta-protein. Ann. NY Acad. Sci 777, 57–64.[Abstract]
Shimizu, H., Seiki, T., Asada, M., Yoshimatsu, K., and Koyama, N. (2003). Alpha6beta1 integrin induces proteasome-mediated cleavage of erbB2 in breast cancer cells. Oncogene 22, 831–839.[CrossRef][Medline]
Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. L. (1987). Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177–182.
Sorkin, A., Di Fiore, P. P., and Carpenter, G. (1993). The carboxyl terminus of epidermal growth factor receptor/erbB-2 chimerae is internalization impaired. Oncogene 8, 3021–3028.[Medline]
Sugahara, K. N., Hirata, T., Hayasaka, H., Stern, R., Murai, T., and Miyasaka, M. (2006). Tumor cells enhance their own CD44 cleavage and motility by generating hyaluronan fragments. J. Biol. Chem 281, 5861–5868.
Tikhomirov, O., and Carpenter, G. (2000). Geldanamycin induces ErbB-2 degradation by proteolytic fragmentation. J. Biol. Chem 275, 26625–26631.
Tikhomirov, O., and Carpenter, G. (2001). Caspase-dependent cleavage of ErbB-2 by geldanamycin and staurosporin. J. Biol. Chem 276, 33675–33680.
Tikhomirov, O., and Carpenter, G. (2003). Identification of ErbB-2 kinase domain motifs required for geldanamycin-induced degradation. Cancer Res 63, 39–43.
van Deurs, B., Holm, P. K., and Sandvig, K. (1996). Inhibition of the vacuolar H(+)-ATPase with bafilomycin reduces delivery of internalized molecules from mature multivesicular endosomes to lysosomes in HEp-2 cells. Eur. J. Cell Biol 69, 343–350.[Medline]
Vernimmen, D., Gueders, M., Pisvin, S., Delvenne, P., and Winkler, R. (2003). Different mechanisms are implicated in ERBB2 gene overexpression in breast and in other cancers. Br. J. Cancer 89, 899–906.[CrossRef][Medline]
Wallenius, V., Hisaoka, M., Helou, K., Levan, G., Mandahl, N., Meis-Kindblom, J. M., Kindblom, L. G., and Jansson, J. O. (2000). Overexpression of the hepatocyte growth factor (HGF) receptor (Met) and presence of a truncated and activated intracellular HGF receptor fragment in locally aggressive/malignant human musculoskeletal tumors. Am. J. Pathol 156, 821–829.
Wang, Z., Zhang, L., Yeung, T. K., and Chen, X. (1999). Endocytosis deficiency of epidermal growth factor (EGF) receptor-ErbB2 heterodimers in response to EGF stimulation. Mol. Biol. Cell 10, 1621–1636.
Way, T. D., Kao, M. C., and Lin, J. K. (2004). Apigenin induces apoptosis through proteasomal degradation of HER2/neu in HER2/neu-overexpressing breast cancer cells via the phosphatidylinositol 3-kinase/Akt-dependent pathway. J. Biol. Chem 279, 4479–4489.
Whitesell, L., and Lindquist, S. L. (2005). HSP90 and the chaperoning of cancer. Nat. Rev. Cancer 5, 761–772.[CrossRef][Medline]
Wiley, H. S., and Burke, P. M. (2001). Regulation of receptor tyrosine kinase signaling by endocytic trafficking. Traffic 2, 12–18.[Medline]
Worthylake, R., Opresko, L. K., and Wiley, H. S. (1999). ErbB-2 amplification inhibits down-regulation and induces constitutive activation of both ErbB-2 and epidermal growth factor receptors. J. Biol. Chem 274, 8865–8874.
Xu, W., Marcu, M., Yuan, X., Mimnaugh, E., Patterson, C., and Neckers, L. (2002). Chaperone-dependent E3 ubiquitin ligase CHIP mediates a degradative pathway for c-ErbB2/Neu. Proc. Natl. Acad. Sci. USA 99, 12847–12852.
Xu, W., Mimnaugh, E., Rosser, M. F., Nicchitta, C., Marcu, M., Yarden, Y., and Neckers, L. (2001). Sensitivity of mature Erbb2 to geldanamycin is conferred by its kinase domain and is mediated by the chaperone protein Hsp90. J. Biol. Chem 276, 3702–3708.
Yarden, Y. (2001). Biology of HER2 and its importance in breast cancer. Oncology 61, (Suppl 2), 1–13.[Medline]
Zampieri, N., Xu, C. F., Neubert, T. A., and Chao, M. V. (2005). Cleavage of p75 neurotrophin receptor by alpha-secretase and gamma-secretase requires specific receptor domains. J. Biol. Chem 280, 14563–14571.
Zheng, F. F., Kuduk, S. D., Chiosis, G., Munster, P. N., SeppLorenzino, L., Danishefsky, S. J., and Rosen, N. (2000). Identification of a geldanamycin dimer that induces the selective degradation of HER-family tyrosine kinases. Cancer Res 60, 2090–2094.
Zhou, P., Fernandes, N., Dodge, I. L., Reddi, A. L., Rao, N., Safran, H., DiPetrillo, T. A., Wazer, D. E., Band, V., and Band, H. (2003). ErbB2 degradation mediated by the co-chaperone protein CHIP. J. Biol. Chem 278, 13829–13837.
This article has been cited by other articles: